An analysis method for multiple target microRNA detection by a dual entropy-driven amplification system combined with silver nanoclusters
By combining a dual-entropy-driven amplification system with silver nanoclusters, an enzyme-free rapid sensing platform was constructed, which solved the problem of insufficient sensitivity in the detection of various microRNAs and enabled the simultaneous detection and analysis of multiple targets.
Patent Information
- Application Number
- CN202210719430.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-23
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2042-06-23
AI Technical Summary
Existing nucleic acid amplification technologies lack sufficient sensitivity and are demanding to operate in the detection of various microRNAs, making it difficult to meet the needs of accurate diagnosis. Furthermore, traditional methods have strict environmental requirements, which limits their application scope.
By employing a dual-entropy driven amplification system combined with silver nanoclusters (AgNCs), an enzyme-free and rapid sensing platform was constructed through AgNCs fluorescence enhancement induced by G-rich sequence proximity and AgNCs dimer formation, enabling the simultaneous detection of multiple targets.
It enables rapid and ultrasensitive simultaneous detection of multiple microRNAs, and improves the sensitivity and selectivity of detection by enhancing the response to different fluorescence signals to screen out multiple analytes.
Smart Images

Figure CN115094119B_ABST
Abstract
Description
An analytical method for detecting multiple target microRNAs using a dual-entropy-driven amplification system combined with silver nanoclusters. Technical Field
[0001] This invention pertains to biochemical analysis methods, specifically relating to a dual-entropy driven amplification system for detecting multiple target microRNAs and its application method. Background Technology
[0002] Differences in intracellular microRNA (miRNA) levels provide valuable information for the early diagnosis and treatment of cancer. Studies have shown that cancer development is associated with multiple miRNAs, and detecting a single miRNA may not meet the requirements for accurate diagnosis. Therefore, developing sensing platforms that can simultaneously detect multiple miRNAs is crucial. To improve the sensitivity of target detection, researchers have developed various nucleic acid amplification platforms, mainly divided into enzyme-mediated and enzyme-free categories. Common enzyme-mediated nucleic acid amplification techniques include polymerase chain reaction (PCR), rolling circle amplification (RCA), and double-stranded specific nuclease (DSN)-mediated target cycling signal amplification. Although these nucleic acid amplification techniques have high sensitivity, the presence of enzymes makes them highly sensitive to environmental conditions (such as temperature and pH), limiting their application in many areas. Enzyme-free nucleic acid amplification techniques mainly rely on DNA strand hybridization and strand displacement reactions to achieve target cycling signal amplification. Entropy-driven amplification reactions achieve target cycling and signal amplification through sticky end-mediated branching migration and strand displacement reactions. As an enzyme-free nucleic acid amplification technique, it is simpler and faster to operate than other enzyme-free amplification techniques, and has better selectivity, making it particularly suitable for the analysis of multiple targets. DNA-AgNCs, using DNA as a template, possess unique luminescent properties, good biocompatibility and fluorescence stability. More importantly, their fluorescence emission wavelength and color can be adjusted according to different designed DNA templates, making them widely applicable in biosensing and cell imaging. Therefore, based on dual-entropy driven reaction signal amplification combined with the color-changing AgNCs fluorescence signal method, a unique new approach is provided for the simultaneous detection of multiple miRNAs. Summary of the Invention
[0003] In view of this, we integrated the dual-entropy driven amplification design into the same DNA assembly structure, and used two AgNC template sequences with different emission wavelengths as fuel chains for two entropy-driven systems, which were combined in the system. By utilizing the fluorescence enhancement of AgNCs induced by the proximity of G-rich sequences and the fluorescence signal turn-on caused by the formation of AgNC dimers, we constructed a simple, enzyme-free, and rapid sensing platform for the simultaneous detection and analysis of multiple targets.
[0004] The present invention specifically provides the following technical solution:
[0005] 1. A simple, enzyme-free, and rapid sensing platform for simultaneous detection and analysis of multiple targets. First, F-41-DNA or L21-DNA or F21-DNA is prepared in PB buffer at a DNA:AgNO3:NaBH4 ratio of 1:6:6. For independent detection, L141, S141, and Linker, or L21-AgNCs, S21, and Linker strands are mixed in a 1:1:1 molar ratio in PB and CH3COONa buffer and annealed to form a stable triple-stranded DNA substrate. For target 1 miRNA-141, F141-AgNCs are first added to the pre-formed (L141, S141, Linker) triple-stranded DNA substrate, followed by different concentrations of miRNA-141. The mixture is thoroughly mixed and reacted at 25°C for 2 hours. The fluorescence intensity at 585 nm is then detected. For the detection of target miRNA-21, F21-AgNCs were first added to a pre-formed triple-stranded DNA substrate (L21-AgNCs, S21, Linker), followed by different concentrations of miRNA-21. The mixture was thoroughly mixed and reacted at 25°C for 2 hours. The fluorescence intensity at 630 nm was then detected.
[0006] For simultaneous detection, a five-stranded DNA substrate containing L141, S141, Linker, L21-AgNCs, and S21 strands was annealed and stabilized in a PB and CH3COONa cross-linking buffer at a molar ratio of 1:1:1:1:1. During detection, F141-AgNCs and F21-AgNCs were added to the pre-formed five-stranded DNA substrate, followed by different concentrations of miRNA-21 and miRNA-141. The mixture was thoroughly mixed and incubated at 25°C for 2 hours. Fluorescence intensities at 585 nm and 630 nm were then measured.
[0007] The above-mentioned dual-entropy driven amplification system combined with silver nanoclusters for the analysis of multiple targets includes the following steps:
[0008] 1) Mix a certain volume of F141 or L21 or F21 of a certain concentration with AgNO3 solution using PB buffer, shake vigorously for 5 s, and incubate in an ice-water bath at 4 ℃ in the dark for 1 h.
[0009] 2) Add NaBH4 solution to the solution after incubation in step 1), shake vigorously for 20 s, and incubate overnight in an ice-water bath at 4°C in the dark to prepare F141-AgNCs\L21-AgNCs\F21AgNCs monomers.
[0010] 3) Mix equal volumes and concentrations of L141, S141, and Linker or L21-AgNCs, S21, and Linker, and anneal in PB and CH3COONa buffer to 25°C for 2 hours to form triple-stranded hybrid DNA substrate.
[0011] 4) Mix equal volumes and concentrations of L141, S141, Linker, L21-AgNCs, and S21, and anneal in PB and CH3COONa buffer to 25°C for 2 hours to form a five-stranded hybrid DNA substrate.
[0012] 5) Individual detection of the fuel chain: Add fuel chain F141-AgNCs or F21-AgNCs to the triple-stranded DNA substrate obtained in step 3), mix thoroughly, dilute and divide into 10 PCR tubes;
[0013] 6) Simultaneous detection of fuel chains: Add fuel chains F141-AgNC and F21-AgNCs to the five-stranded DNA substrate obtained in step 4), mix thoroughly, dilute and divide into 10 PCR tubes;
[0014] 7) Individual detection: Add different concentrations of miRNA-141 or miRNA-21 to each PCR tube in step 5), and add buffer to the control group. Incubate at 25 °C for 30 min, and perform fluorescence detection to obtain specific detection results for miRNA-141 or miRNA-21;
[0015] 8) Simultaneous detection: Add different concentrations of miRNA-141 and miRNA-21 to each PCR tube in step 6), and add buffer to the control group. Incubate at 25 °C for 30 min, and perform fluorescence detection to obtain specific detection results for miRNA-141 and miRNA-21.
[0016] Further, in step 1), the molar ratio of DNA (F141, L21, or F21) to AgNO3 is maintained at 1:6; the PB buffer in step 1) contains 20 mM Na2HPO4 and NaH2PO4, pH=7.4; and the concentration of AgNO3 solution in step 1) is 1.8 µM.
[0017] Furthermore, in step 2), the molar ratio of DNA (F141, L21, or F21), AgNO3, and NaBH4 is always maintained at 1:6:6; and the concentration of the NaBH4 solution in step 2) is 1.8 µM.
[0018] Furthermore, in step 3), the molar ratio of L141, S141, Linker or L21-AgNCs, S21, Linker chains is always maintained at 1:1:1; in step 4), the molar ratio of L141, S141, Linker, L21-AgNCs, S21 chains is always maintained at 1:1:1:1:1.
[0019] Furthermore, the annealing process described in steps 3) and 4) involves heating at 95 °C for 5 min, cooling to 65 °C at a rate of -5 °C / min, and then cooling to 25 °C at a rate of -1 °C / min.
[0020] Furthermore, in step 5), when detecting miRNA-141 alone, the ratio of triple-stranded DNA substrate to F141-AgNCs is 1:1.5, and the optimal reaction time is 30 min; in step 5), when detecting miRNA-21 alone, the ratio of triple-stranded DNA substrate to F21-AgNCs is 1:2, and the optimal reaction time is 30 min.
[0021] Furthermore, in step 7), when detecting miRNA-141 alone, the concentration of triple-stranded DNA substrate (L141, S141, Linker) is 200 nM, and the concentration of F141-AgNCs is 300 nM; in step 7), when detecting miRNA-21 alone, the concentration of triple-stranded DNA substrate (Linker, L21-AgNCs, S21) is 200 nM, and the concentration of F21-AgNCs is 400 nM.
[0022] Further, in step 8), when simultaneously detecting miRNA-141 and miRNA-21, the concentration of the five-stranded DNA substrate (L141, S141, Linker, L21-AgNCs, S21) is 200 nM, the concentration of F141-AgNCs is 300 nM, the concentration of F21-AgNCs is 400 nM, and the final reaction time is 120 min.
[0023] The beneficial effects of this invention are as follows: In this analytical method, we introduce two different emission wavelengths of AgNCs fluorescence—G-rich proximity-induced AgNCs fluorescence enhancement and the formation of a fluorescence-enhancing AgNCs dimer by two non-luminescent AgNCs monomers closely adjacent to each other—into a common dual-entropy driven target cyclic signal amplification system. This successfully achieves simultaneous enhancement of two colors of fluorescence signals when two different targets coexist. As the concentration of target 1 miRNA-141 increases, the G-rich-enhanced orange fluorescence at 585 nm gradually increases, exhibiting a linear relationship at lower concentrations. As the concentration of target 2 miRNA-21 increases, the red fluorescence of the dimer at 630 nm also gradually increases. By detecting and analyzing the two enhanced fluorescence signals separately or simultaneously, this analytical method combines multi-color fluorescent AgNCs with an entropy-driven signal amplification system, enabling the screening of multiple analytes in a single detection and achieving rapid and ultrasensitive simultaneous detection of multiple miRNAs. Attached Figure Description
[0024] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided:
[0025] Figure 1 is a schematic diagram of the dual-entropy driven amplification system combined with silver nanoclusters for the analysis of multiple targets according to the present invention;
[0026] Figure 2 shows the UV-vis spectra of F141-AgNCs and L141+F141-AgNCs;
[0027] Figure 3 shows the fluorescence spectra of F141-AgNCs and L141+F141-AgNCs; and the fluorescence spectra of L21-AgNCs, F21-AgNCs, and L21-AgNCs+F21-AgNCs dimers.
[0028] Figure 4 shows a gel electrophoresis diagram validating the simultaneous detection of miRNA-141 and miRNA-21;
[0029] Figure 5 shows the normalized fluorescence results for different ratios of triple-stranded DNA substrate to F strand;
[0030] Figure 6 shows the determination of the reaction time in the entropy-driven scale-up system;
[0031] Figure 7 shows the spectrum of fluorescence intensity in the single detection system as a function of miRNA-141 concentration (A); and the graphs of fluorescence intensity in the system as a function of miRNA-141 concentration (BC).
[0032] Figure 8 shows the spectrum of fluorescence intensity in the single detection system as a function of miRNA-21 concentration (A); and the graphs of fluorescence intensity in the system as a function of miRNA-21 concentration (BC).
[0033] Figure 9 shows the fluorescence intensity of the dual detection system as a function of the concentrations of miRNA-141 and miRNA-21 (A); and the fluorescence intensity of the dual detection system as a function of the concentrations of miRNA-141 and miRNA-21 (B, C, D, E).
[0034] In Figure 10, (A) shows the specificity for detecting miRNA-141; (B) shows the specificity for detecting miRNA-21.
[0035] Figure 11 shows (A) the detection of miRNA-141 in buffer and 1% serum; and (B) the detection of miRNA-21 in buffer and 1% serum.
[0036] Figure 12 shows (A) a schematic diagram of a logic OR gate; and (B) a truth table of a logic OR gate used to detect miRNA-141 and miRNA-21. Detailed Implementation
[0037] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings.
[0038] As shown in Figure 1, the experimental principle is based on two AgNC fluorescence enhancement principles: AgNC fluorescence enhancement induced by G-rich sequence proximity and AgNC dimer formed by the close proximity of two non-fluorescent AgNC monomers. We combined AgNCs with two emission wavelengths in a dual-entropy driven amplification system to construct a fluorescent biosensor for multiple target analysis. Among them, the G-rich proximity-induced fluorescence-enhanced AgNCs probe was used to detect miRNA-141. The G-rich sequence was designed at the 3' end of the L141 strand, and the non-luminescent AgNCs template was designed at the 5' end of the F141 strand. When miRNA-141 was present, an entropy-driven strand displacement reaction was triggered. The hybridization of L141 and F141-AgNCs, i.e., the close proximity of G-rich and AgNCs, showed a significantly enhanced orange fluorescence at 585 nm. In addition, the formation of AgNCs dimers served as a signal probe for detecting miRNA-21. Two non-luminescent AgNCs templates were designed at the 5' end of L21 and the 3' end of F21 strand, respectively. When miRNA-21 was present, an entropy-driven strand displacement reaction was triggered. The hybridization of L21-AgNCs and F21-AgNCs led to the close proximity of the two non-fluorescent AgNCs monomers to form AgNCs dimers, resulting in a significant enhancement of red fluorescence at 630 nm. This design enables separate detection and simultaneous detection and analysis of two types of targets.
[0039] Example 1: Pretreatment of DNA
[0040] First, the powdered primer DNA ordered from Shanghai Sangon Biotech was centrifuged at 4000 rpm / min for 1 min before use, and then dissolved in ultrapure water as required. Solution. Prepared with PB buffer solution, consisting of 20 mM Na2HPO4, 20 mM NaH2PO4, pH 7.4.
[0041] The L141 sequence is 5'-CCA TCT TTA CCA GAC AGT GTT AGGG ACA TCG TAT CGT CAG
[0042] ACT CAG GGGTGGGTGGGTGGGT-3'
[0043] The S141 sequence is 5'-TCCC TAA CAC TGT CTG GTA -3'
[0044] The linker sequence is 5'- GAT ACT TCC ACT GCG ATT ACC TGA GTC TGA CGA TAC
[0045] GATG -3'
[0046] The sequence of F141 is 5'- CCCACCCACCCACCCA CTG AGT CTG ACG ATA CGA TG TCCC
[0047] TAA CAC TGT CTG GTA -3'
[0048] The miRNA-141 sequence is 5'- UAA CAC UGU CUG GUA AAG AUGG -3'
[0049] The sequence of L21 is 5'- CCCCCTTAATCCCCCAA GTA ATC GCA GTG GAA GTA TC GGGA
[0050] TCA ACA TCA GTC TGA TAA GCTA-3'
[0051] The S21 sequence is 5'- TCA GAC TGA TGT TGA TCCC -3'
[0052] The sequence of F21 is 5'-TCA GAC TGA TGT TGA TCCC GAT ACT TCC ACT GCG ATT AC
[0053] AACCCCCTAATTCCCC -3'
[0054] The miRNA-21 sequence is 5'- UAG CUUA UCA GAC UGA UGU UGA -3'
[0055] Example 2 Synthesis of F141-AgNCs, L21-AgNCs, and F21-AgNCs
[0056] A specific volume and concentration of F141, L21, and F21 were mixed with 500 μM AgNO3 solution in 20 mM pH 7.4 PB buffer at a DNA:AgNO3 molar ratio of 1:6. The mixture was vigorously shaken for 5 s and incubated in a 4 °C ice-water bath in the dark for 1 h. After 1 h, freshly prepared 500 μM NaBH4 solution with a 1:1 molar ratio to AgNO3 was added, and the mixture was vigorously shaken for 20 s and incubated overnight in a 4 °C ice-water bath in the dark. The molar ratio of F141 (L21 or F21), AgNO3, and NaBH4 was maintained at 1:6:6, and the mixture was stored in a 4 °C ice-water bath. The UV-Vis spectra of the DNA were analyzed as shown in Figure 2, and the fluorescence spectra were analyzed as shown in Figure 3.
[0057] As shown in Figure 2, the UV-vis spectra of F141-AgNCs and L141+F141-AgNCs in Figure 2-A reveal an absorption peak at 400 nm for F141-AgNCs, in addition to the DNA absorption peak at 260 nm. This is a characteristic absorption peak of the AgNCs template. Upon approaching G-rich, the absorption peak at 400 nm disappears for L141+F141-AgNCs, while a distinct absorption peak appears at 515 nm, showing a clear difference between the two. In Figure 2-B, the UV-vis spectra of L21-AgNCs, F21-AgNCs, and L21-AgNCs+F21-AgNCs all exhibit a characteristic peak at 410 nm. This is attributed to the shared AgNCs template. After L21-AgNCs and F21-AgNCs form a dimer, the absorption peak at 410 nm slightly increases, while a distinct characteristic peak appears at 560 nm. As can be seen in the illustration, the L21-AgNCs+F21-AgNCs dimer appears distinctly red under ultraviolet light.
[0058] As can be seen from Figure 3, fluorescence is generated when the G-rish in F141-AgNCs and L141+F141-AgNCs are close together and when L21-AgNCs + F21-AgNCs form a dimer.
[0059] Example 3: Feasibility verification of the polyacrylamide gel electrophoresis protocol.
[0060] To verify the formation of triple-stranded DNA substrates and five-stranded DNA substrates, Figure 4 shows that band 1 is the triple-stranded DNA substrate of L141+Linker+S141, band 2 is the triple-stranded DNA substrate of L21-AgNCs+Linker+S21, and band 3 is the five-stranded DNA substrate of L141+S141+Linker+L21-AgNCs+S21.
[0061] To verify the feasibility of using five-stranded DNA substrates for the detection of micRNA-141 and micRNA-21, band 4 (L141+S141+Linker+L21-AgNCs+S21)+F141-AgNCs served as the control group for detecting miRNA-141 in the five-stranded structure. Band 5 (L141+S141+Linker+L21-AgNCs+S21)+miRNA-141+F141-AgNCs served as the experimental group for detecting miRNA-141 in the five-stranded structure. Although the control group showed some background signal, the L141+F141-AgNCs signal in the experimental group was still stronger than that in the control group. Band 6 is (L141+S141+Linker+L21-AgNCs+S21)+F21-AgNCs, serving as a control group for detecting miRNA-21 in the five-strand structure. It can be seen that the background signal is relatively low when miRNA-21 is not added. Band 7 is (L141+S141+Linker+L21-AgNCs+S21)+miRNA-21+F21-AgNCs, serving as an experimental group for detecting miRNA-21 in the five-strand structure. Significantly more L21-AgNCs+F21-AgNCs were obtained. Band 8, consisting of (L141+S141+Linker+L21-AgNCs+S21)+F141-AgNCs+F21-AgNCs, served as a control group for simultaneous detection of miRNA-141 and miRNA-21 in the five-strand structure. Band 9, consisting of (L141+S141+Linker+L21-AgNCs+S21)+miRNA-141+miRNA-21+F141-AgNCs+F21-AgNCs, served as the experimental group for simultaneous detection of miRNA-141 and miRNA-21 in the five-strand structure. It showed significant differences from the control group, with more L141+F141-AgNCs and L21-AgNCs+F21-AgNCs, and a significantly fewer five-strand structures. This demonstrates the feasibility of simultaneously detecting miRNA-141 and miRNA-21 in this study.
[0062] Example 4: Optimization of the proportions and reaction time using fluorescence detection.
[0063] The final ratio of triple-stranded substrate to fuel chain was determined by detecting the fluorescence of the control and experimental groups at different ratios. We also investigated the fluorescence characteristics of triple-stranded DNA substrate to fuel chain F ratios of 1:1, 1:1.5, and 1:2. The system containing only L, Linker, S, and F chains (without the target) was used as the control group, and the system containing the target chain at a 1:1 ratio of L, Linker, and S chains was used as the experimental group. The pre-prepared triple-stranded DNA substrate was reacted with the F and target chains for 2 hours, and the fluorescence results were then detected and normalized. As shown in Figure 5, considering background signal interference from the control group, the largest difference between the control and experimental groups was observed when the ratio of triple-stranded DNA substrate to F141-AgNCs was 1:1.5 in Figure 5-A; therefore, 1:1.5 was selected as the optimal ratio. In Figure 5-B, as the ratio of triple-stranded DNA substrate to F21-AgNCs increased, the difference between the control and experimental groups gradually increased, and 1:2 was ultimately selected as the optimal ratio.
[0064] Next, we optimized the detection time. As shown in Figure 6-A, when detecting miRNA-141, the reaction was basically completed after 120 min when the pre-formed triple-stranded DNA substrate reacted with F141-AgNCs or with F141-AgNCs and miRNA-141, and the difference between the control group and the experimental group was also the largest. As shown in Figure 6-B, when detecting miRNA-21, the reaction was also basically completed after 120 min when the pre-formed triple-stranded DNA substrate reacted with F21-AgNCs or with F21-AgNCs and miRNA-21; therefore, 120 min was chosen as the final reaction time for both detecting miRNA-141 and miRNA-21 alone and simultaneously.
[0065] Example 5: Different miRNA Sensing Analysis
[0066] The specific experimental steps are as follows:
[0067] 1) First, different concentrations of miRNA-141 (final concentrations of 0, 0.1, 0.3, 0.5, 1, 3, 5, 10, 30, 50, and 100 nM) and F141-AgNCs at a molar ratio of 1:1.5 were added to a pre-formed triple-stranded DNA substrate (L141, S141, and Linker), and the reaction was carried out at 25 °C for 2 h. The performance of the sensor was studied by detecting the changes in fluorescence intensity in the systems containing different concentrations of miRNA-141.
[0068] As shown in Figure 7, the orange fluorescence intensity at 585 nm gradually increases with increasing miRNA-141 concentration (Figure 7-A). When the miRNA-141 concentration is low, the concentration of miRNA-141 (C...) miRNA-141 As shown in the inset of Figure 7-B, with C (nM) as the x-axis and fluorescence intensity as the y-axis, within the range of 0-0.5 nM, fluorescence intensity is related to C. miRNA-141 / nM shows a linear relationship:
[0069] F 585nm =41.34451×C miRNA-141 / nM+188.02997 (R 2 =0.99468)
[0070] Additionally, the logarithm of miRNA-141 concentration Lg[C miRNA-141 As shown in Figure 7-C, with [nM] as the x-axis and fluorescence intensity as the y-axis, the Fm value was obtained in the range of 0-100 nM. 585nm With Lg[C miRNA-141 The relationship between / nM] and [the linear relationship] is as follows:
[0071] F 585nm =27.69046×Lg[C miRNA-141 / nM]+217.39128( The calculated limit of detection is 10.51 pM (LOD=3σ / S, where σ is the blank standard deviation and S is the slope).
[0072] 2) Different concentrations of miRNA-21 (final concentrations of 0, 0.1, 0.3, 0.5, 1, 3, 5, 10, 30, 50, 100 nM) and F21-AgNCs at a molar ratio of 1:2 were added to pre-formed triple-stranded DNA substrates (L21-AgNCs, S21, Linker), and the reaction was carried out at 25 °C for 2 h. The performance of the sensor was studied by detecting the changes in fluorescence intensity in systems containing different concentrations of miRNA-21.
[0073] As shown in Figure 8-A, the red fluorescence intensity at 630 nm gradually increases with increasing miRNA-21 concentration. When the miRNA-21 concentration is low, the concentration of miRNA-21 (C...) miRNA-21 As shown in the inset of Figure 8-B, with C (nM) as the x-axis and fluorescence intensity as the y-axis, within the range of 0-0.5 nM, fluorescence intensity is related to C. miRNA-21 / nM shows a linear relationship:
[0074] F 630nm =28.702×C miRNA-21 / nM+16.44332(R 2 =0.98698)
[0075] Additionally, the logarithm of miRNA-21 concentration Lg[C miRNA-21 As shown in Figure 8-C, with [nM] as the x-axis and fluorescence intensity as the y-axis, the Fn value was obtained in the range of 0-100 nM. 630nm With Lg[C miRNA-21 The relationship between / nM] and [the linear relationship] is as follows:
[0076] F 630nm =16.09587×Lg[C miRNA-21 / nM]+35.0326 ( The calculated limit of detection is 10.46 pM (LOD=3σ / S, where σ is the blank standard deviation and S is the slope).
[0077] 3) First, different concentrations of miRNA-141 and miRNA-21 (final concentrations of 0, 0.1, 0.3, 0.5, 1, 3, 5, 10, 30, 50, and 100 nM) and F141-AgNCs at a molar ratio of 1:1.5 and F21-AgNCs at a molar ratio of 1:2 were added to a pre-formed five-stranded DNA substrate (L141, S141, Linker, L21-AgNCs, and S21). The reaction was carried out at 25 °C for 2 h. The performance of the sensor was studied by detecting the changes in fluorescence intensity at two emission wavelengths (585 nm and 630 nm) in the systems containing different concentrations of miRNA-141 and miRNA-21.
[0078] As shown in Figure 9-A, the fluorescence intensity at 585 nm and 630 nm gradually increases with increasing concentrations of miRNA-141 and miRNA-21. At lower concentrations, plotting the concentration (C / nM) on the x-axis and fluorescence intensity on the y-axis, as shown in the insets of Figures 9-B and D, the fluorescence intensity exhibits a linear relationship with concentration in the range of 0-0.5 nM.
[0079] F 585nm =43.52015×C miRNA-141 / nM+193.19678(R 2 =0.98)
[0080] F 630nm =27.08022×C miRNA-21 / nM+19.84818 (R 2 =0.98843)
[0081] Furthermore, plotting the logarithm of each concentration, Lg[C / nM], on the x-axis and fluorescence intensity on the y-axis, as shown in Figures 9-C and E, reveals a linear relationship between fluorescence intensity and Lg[C / nM] in the range of 0-100 nM:
[0082] F 585nm =26.95028×Lg[C miRNA-141 / nM]+223.7323(R 2 =0.98477)
[0083] F 630nm =15.89599×Lg[C miRNA-21 / nM]+38.02819(R 2 =0.99568)
[0084] The detection limit of miRNA-141 was calculated to be 13.42 pM and that of miRNA-21 was 14.15 pM (LOD = 3σ / S, where σ is the blank standard deviation and S is the slope).
[0085] Example 6 Specificity Experiment
[0086] Since miRNA-141 and miRNA-21 were detected at two different emission wavelengths (585 nm and 630 nm), specificity analyses were performed separately. To evaluate the specificity of this method for detecting miRNA-141, fluorescence signals at 585 nm were measured in systems containing the same concentrations of miRNA-141, miRNA-21, Let-7a, MDR1, and a random sequence, as well as in a control group. To evaluate the specificity of this method for detecting miRNA-21, fluorescence signals at 630 nm were measured in systems containing the same concentrations of miRNA-21, miRNA-141, Let-7a, MDR1, and a random sequence, as well as in a control group. The results are shown in Figure 10. Compared to the fluorescence signals of miRNA-141 at 585 nm and miRNA-21 at 630 nm, the observed fluorescence signals were approximately the same as in the control group when measuring the concentrations of other molecules. This indicates that this method has good selectivity for detecting both miRNA-141 and miRNA-21.
[0087] Example 7: Analysis of Real Samples
[0088] 50 nM miRNA-21 was added to 1% human serum samples. As shown in Figure 11, the analytical results in the serum samples were basically consistent with those in the 20 mM PB + 20 mM CH3COONa buffer, indicating that it has the potential for practical application.
[0089] Example 8 Logic Gates
[0090] As shown in Figure 12, we designed this analytical method as a simple OR logic gate. When miRNA-141 is present, orange fluorescence appears; when miRNA-21 is present, red fluorescence appears; when both miRNA-141 and miRNA-21 are present, both orange and red fluorescence appear.
[0091] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.
Claims
1. An analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters, characterized in that, The steps are as follows: 1) Mix a certain volume and concentration of F141, L21 and F21 with AgNO3 solution using PB buffer, shake vigorously for 5 s, and incubate in an ice-water bath at 4 ℃ in the dark for 1 h; 2) Add NaBH4 solution to the solution after incubation in step 1), shake vigorously for 20 s, and incubate overnight in an ice-water bath at 4 ℃ in the dark to prepare F141-AgNCs / L21-AgNCs / F21-AgNCs monomers; 3) Mix equal volumes and concentrations of L141, S141, and Linker or L21-AgNCs, S21, and Linker, anneal in PB and CH3COONa buffer to 25 ℃, and react for 2 h to form triple-stranded hybrid DNA substrate; 4) Mix equal volumes and concentrations of L141, S141, Linker, L21-AgNCs, and S21, anneal in PB and CH3COONa buffer to 25°C, and react for 2 hours to form a five-stranded hybrid DNA substrate; 5) Individual detection of the fuel chain: Add fuel chains F141-AgNCs or F21-AgNCs to the three-stranded DNA substrate obtained in step 3), mix thoroughly, dilute, and aliquot into 10 PCR tubes; 6) Simultaneous detection of the fuel chain: Add fuel chains F141-AgNCs and F21-AgNCs to the five-stranded DNA substrate obtained in step 4), mix thoroughly, dilute, and aliquot into 10 PCR tubes; 7) Individual detection: Add different concentrations of miRNA-141 or miRNA-21 to each PCR tube in step 5), add buffer to the control group, react at 25°C for 30 min, and perform fluorescence detection to obtain specific detection results for miRNA-141 or miRNA-21; 8) Simultaneous detection: Different concentrations of miRNA-141 and miRNA-21 were added to each PCR tube in step 6), while buffer was added to the control group. The reaction was carried out at 25 °C for 30 min, and fluorescence detection was performed to obtain the specific detection results of miRNA-141 and miRNA-21. Specifically, the L141 sequence is 5'-CCA TCT TTA CCA GAC AGT GTT AGGG ACA TCG TAT CGTCAGACT CAG GGGTGGGTGGGTGGGT-3'; the S141 sequence is 5'-TCCC TAA CAC TGT CTG GTA-3'; the Linker sequence is 5'- GAT ACT TCC ACT GCG ATT ACC TGA GTC TGA CGA TACGATG-3'; and the F141 sequence is 5'- CCCACCCACCCACCCA CTG AGT CTG ACG ATA CGA TG TCCCTAA CACTGT CTG GTA-3'; miRNA-141 The sequence is 5'- UAA CAC UGU CUG GUA AAG AUGG -3'; the L21 sequence is 5'- CCCCCTTAATCCCCCAA GTA ATC GCA GTG GAA GTA TC GGGATCA ACATCA GTC TGA TAA GCTA-3'; the S21 sequence is 5'- TCA GAC TGA TGT TGA TCCC -3'.The F21 sequence is 5'- TCA GAC TGA TGT TGA TCCC GAT ACT TCC ACT GCG ATTACAACCCCCTAATTCCCC -3'; the miRNA-21 sequence is 5'- UAG CUUA UCA GAC UGA UGU UGA -3'.
2. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, Step 1) The molar ratio of F141 or L21 or F21:AgNO3 is maintained at 1:6; Step 2) The molar ratio of F141 or L21 or F21, AgNO3 and NaBH4 is always maintained at 1:6:6; Step 3) The molar ratio of L141, S141, Linker or L21-AgNCs, S21, Linker chain is always maintained at 1:1:1; Step 4) The molar ratio of L141, S141, Linker, L21-AgNCs, S21 chain is always maintained at 1:1:1:1:
1.
3. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, Step 1) The PB buffer solution contains 20 mM Na2HPO4 and NaH2PO4, pH=7.4; Step 1) The AgNO3 solution concentration is 1.8 µM; Step 2) The NaBH4 solution concentration is 1.8 µM.
4. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, The annealing process described in steps 3) and 4) involves heating at 95 °C for 5 min, cooling to 65 °C at a rate of -5 °C / min, and then cooling to 25 °C at a rate of -1 °C / min.
5. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, The platform for detecting target 1, i.e. miRNA-141, is designed with a G-rich sequence at the 3' end of the L141 strand and a non-luminescent AgNCs template at the 5' end of the F141 strand. The platform for detecting target 2, i.e. miRNA-21, is designed with two non-luminescent AgNCs templates at the 5' end of the L21 strand and the 3' end of the F21 strand, respectively.
6. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, When miRNA-141 is present, L141 hybridizes with F141-AgNCs, i.e., G-rich and AgNCs are close together, showing a significantly enhanced orange fluorescence at 585 nm. When miRNA-21 is present, L21-AgNCs hybridizes with F21-AgNCs, resulting in two non-fluorescent AgNCs monomers approaching to form an AgNCs dimer, with a significantly enhanced red fluorescence at 630 nm.
7. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, Includes the following steps: 1) When miRNA-141 is present, the hybridization of L141 and F141-AgNCs, i.e., G-rich and AgNCs are close together, exhibits significantly enhanced orange fluorescence at 585 nm; 2) When miRNA-21 is present, the hybridization of L21-AgNCs and F21-AgNCs leads to the near formation of AgNCs dimers by two non-fluorescent AgNCs monomers, resulting in significantly enhanced red fluorescence at 630 nm; 3) When miRNA-141 and miRNA-21 are present simultaneously, both the orange fluorescence at 585 nm and the red fluorescence at 630 nm are significantly enhanced.
8. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, In step 5), when detecting miRNA-141 alone, the ratio of triple-stranded DNA substrate to F141-AgNCs is 1:1.5, and the optimal reaction time is 30 min; in step 5), when detecting miRNA-21 alone, the ratio of triple-stranded DNA substrate to F21-AgNCs is 1:2, and the optimal reaction time is 30 min.
9. The analytical method for detecting multiple target microRNAs using a dual-entropy driven amplification system combined with silver nanoclusters according to claim 1, characterized in that, In step 7), when miRNA-141 is detected alone, the concentration of the triple-stranded DNA substrate formed by L141, S141, and Linker is 200 nM, and the concentration of F141-AgNCs is 300 nM. In step 7), when miRNA-21 is detected alone, the concentration of the triple-stranded DNA substrate formed by Linker, L21-AgNCs, and S21 is 200 nM, and the concentration of F21-AgNCs is 400 nM. In step 8), when miRNA-141 and miRNA-21 are detected simultaneously, the concentration of the five-stranded DNA substrate formed by L141, S141, Linker, L21-AgNCs, and S21 is 200 nM, the concentration of F141-AgNCs is 300 nM, the concentration of F21-AgNCs is 400 nM, and the final reaction time is 120 min.
Citation Information
Patent Citations
Method for simultaneously detecting two types of HIV DNA through DNA-directed color-variable silver nano-clusters
CN109082480A
Multiple microRNA detection method of silver nano-cluster based on entropy-driven amplification system as template
CN112143779A