A food allergen detection kit, its preparation method and application
By modifying microneedle patches and nanoenzyme signal amplification technology with specific nucleic acid aptamers, a rapid detection kit for food allergens was developed, which achieved rapid, simple, sensitive and specific detection of food allergens, and solved the problems of complex preprocessing and professional dependence in the prior art.
Patent Information
- Application Number
- CN202210249570.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-03-15
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2042-03-15
AI Technical Summary
The existing food allergen detection methods are complex and time-consuming, which limits the application of rapid on-site screening, and the protein-specific extraction ability of microneedle patches is insufficient.
A kit that modifies a microneedle patch with specific nucleic acid aptamer combined with nanoenzyme signal amplification function is used to quickly extract food allergen proteins through microneedles, and nanoenzymes are used to catalyze the chromogenic substrate reaction to achieve high sensitivity detection.
It realizes rapid, simple, sensitive and specific detection of food allergens, solving the problems of complex pre-processing and professional dependence in traditional methods.
Smart Images

Figure CN115096828B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of food allergen detection technology, specifically relating to a rapid food allergen detection kit based on microneedle patches and nanozymes, its preparation method, and its application. Background Technology
[0002] Food allergies have become a global public health concern. Currently, the main methods for quantitative analysis of allergens in food include enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and mass spectrometry. However, these methods all suffer from drawbacks such as complex pretreatment and time-consuming detection procedures, limiting their application in rapid on-site screening of allergens. For example, commercially available rapid ELISA kits for allergens can require up to 30 minutes of pretreatment, involving cumbersome sample processing steps such as enzymatic digestion, centrifugation, and extraction, which is time-consuming and labor-intensive. Therefore, developing a rapid quantitative method for allergens with simple pretreatment is crucial for achieving rapid on-site screening of allergens.
[0003] Microneedle patches are patch materials composed of an array of micron-sized needle-like protrusions. Studies have shown that hydrogel-based microneedle patches have a strong ability to extract biomarkers from biological tissues. This is achieved through capillary flow driven by the swelling of the microneedles, which causes target molecules to aggregate around the microneedle tips. Domestic and international literature reports that the swelling capacity of microneedle patches can be used to successfully extract pathogen DNA from plant leaves for rapid diagnosis of plant diseases. In the field of immunoassay, microneedle patches can extract interstitial fluid from the skin for ultrasensitive quantitative studies of protein biomarkers. The advent of microneedles has made it possible to rapidly detect sensitized proteins in food samples on-site without complex pretreatment. However, existing microneedle patches suffer from poor protein-specific extraction capabilities, limiting their widespread application. Therefore, researching microneedle patches with specific extraction capabilities is an important direction for expanding their application scope.
[0004] Aptamers are single-stranded nucleotides with strong affinity for and specific binding to targets. They fold into well-defined three-dimensional structures through base pairing, hydrogen bonding, and van der Waals forces, achieving specific binding to target molecules through spatial conformational complementarity. Covalently modifying aptamers onto microneedle patches could enable their specific extraction of target proteins.
[0005] Nanozymes are a class of artificial enzymes that combine the unique properties of nanomaterials with catalytic functions. Since the discovery in 2007 that magnetic Fe3O4 nanomaterials possess horseradish peroxidase-like catalytic activity, nanozymes have become a research hotspot in analytical sensing, biomedicine, and environmental remediation. A series of nanomaterials, including metal (single metal and alloy) nanomaterials, carbon nanotubes, graphene and its derivatives, cerium oxides, vanadium oxides, and cobalt oxides, have been found to possess enzyme-like activities. Compared with natural enzymes, nanozymes have advantages such as high sensitivity and good stability. In the field of analytical sensing, their excellent signal amplification effect can be used to improve the sensitivity of detection systems.
[0006] Based on the above introduction to microneedle patches, nucleic acid aptamers, and nanozymes, a rapid detection kit for food allergens was developed by utilizing the rapid protein extraction performance of microneedle patches and the signal amplification effect of nanozymes. This kit can effectively overcome the bottleneck of cumbersome and complex pretreatment in traditional methods and provide a new approach for rapid on-site screening of allergens. Summary of the Invention
[0007] The purpose of this invention is to solve the aforementioned technical problems existing in the prior art and provide a rapid food allergen detection kit based on microneedle patches and nanozymes, and its preparation method. The kit includes: microneedle patches capable of specifically and rapidly extracting allergen proteins from food; reagent A with high-sensitivity signal amplification function; reagent B for color development; standard protein solution; agar powder; and washing solution. Reagent A refers to a nanozyme solution covalently modified with aptamer complementary sequences, and reagent B refers to a colorimetric substrate solution that can undergo a redox reaction with peroxidase or peroxidase-like enzymes in the presence of peroxidase. First, the microneedle patch modified with specific nucleic acid aptamers can rapidly and specifically extract target allergen proteins from food, achieving rapid sample pretreatment. Second, the nanozyme in reagent A is surface-modified with complementary sequences that pair with the aptamer bases, effectively binding any unbound aptamers in the microneedles. Furthermore, the nanozyme's ability to catalyze the color development of substrate reagent B enhances detection sensitivity. This kit, through the specific binding of aptamers to complementary sequences, can quantitatively detect the content of allergens in samples. It not only boasts high sensitivity, good specificity, and fast detection speed, but also effectively solves the problems of complex pretreatment and high dependence on professional personnel in traditional methods. To address the above technical challenges, this invention adopts the following technical solution:
[0008] The kit includes: microneedle patches, reagent A, reagent B for color development, standard protein solution, agar powder, and washing solution.
[0009] As a preferred embodiment, reagent A can be prepared by chemically covalently modifying a complementary nucleic acid sequence with any nanozyme solution having peroxidase-like activity, such as metal oxides, metal nanoparticles, and metal-organic frameworks; the complementary sequence is added at a concentration of 0.5 μmol / g nanozyme.
[0010] As a preferred embodiment, reagent B can be any chromogenic substrate solution that can undergo redox reactions with peroxides in the presence of peroxidase or peroxidase-like enzymes.
[0011] As a preferred embodiment, the standard protein solution can be any allergen standard protein with a purity of not less than 90%.
[0012] As a preferred embodiment, the washing solution can be any one or more of ultrapure water, phosphate buffer with pH=5.7-8.0, and glycine buffer with pH=8.6-10.6;
[0013] As a preferred embodiment, the microneedle patch preparation includes the following steps:
[0014] (a) A carboxyl-containing aptamer (Apt) is modified on the amino group of chitosan (Cs) by chemical methods, and then mixed with a certain concentration of polyvinyl alcohol (PVA) solution and crosslinking agent to prepare a needle preparation solution;
[0015] (b) Using a polymer template with a microporous structure, the needle preparation solution is poured into the template, and the air bubbles are removed and the needle preparation solution is completely filled into the microneedle tip chamber through positive pressure and vacuum processes;
[0016] (c) After it is fully dried, carefully peel it off from the mold to obtain the microneedle patch that can specifically and rapidly extract allergens from food;
[0017] As a preferred embodiment, in step (a), the degree of deacetylation of chitosan is not less than 95%, the viscosity is in the range of 100-200 mPa·s, and the chitosan concentration is 1 wt%; the aptamer addition concentration is 0.05 μmol / g chitosan.
[0018] As a preferred embodiment, the polyvinyl alcohol in step (a) should be selected with a degree of alcoholysis in the range of 98-99% (mol / mol) and a concentration of 15-18 wt%; the mass ratio of polyvinyl alcohol to chitosan should be in the range of 1:1-9:1.
[0019] As a preferred embodiment, the crosslinking agent in step (a) is glutaraldehyde, with a concentration in the range of 0.2-0.5 v / v%.
[0020] As a preferred embodiment, the polymer template is a polydimethylsiloxane material;
[0021] As a preferred embodiment, the vacuum condition in the vacuum drying oven is 0.02 MPa;
[0022] Instructions for using the reagent kit:
[0023] (a) After inserting the microneedle patch with the aptamer into the food for several minutes, peel it off from the food surface and rinse the microneedle with the washing solution in the kit more than 3 times.
[0024] (b) After soaking the microneedles in reagent A of the kit for several minutes, remove the microneedles and rinse them with the washing solution in the kit at least 3 times;
[0025] (c) Immerse the microneedles in reagent B of the kit, measure the absorbance after several minutes, and compare it with the standard curve obtained by preparing an agar gel containing a certain concentration of protein using standard protein in the kit to calculate the protein concentration in the sample.
[0026] As a preferred method, the aptamer is covalently modified onto chitosan by catalysis with 16.67 mg / mL 1-ethyl-(3-dimethylaminopropyl)carbodiimide and 13.33 mg / mL N-hydroxysuccinimide.
[0027] As a preferred embodiment, the catalyst concentration is 1.5 mg / mL 1-ethyl-(3-dimethylaminopropyl)carbodiimide and 2 mg / mL N-hydroxysuccinimide;
[0028] As a preferred embodiment, the concentration of the standard protein used to establish the standard curve is selected as 1, 10, 100, 500, or 1000 ppm;
[0029] As a preferred embodiment, the agar content of the standard protein agar gel used to establish the standard curve is 0.5 wt%.
[0030] Compared with existing technologies, the reagent kit prepared using this method has the following advantages:
[0031] 1. The kit of the present invention includes a microneedle patch for specifically and rapidly extracting allergens from food, reagent A with high-sensitivity signal amplification function, reagent B for color development, standard protein solution, agar powder, and washing solution. Using the microneedle patch to extract allergens eliminates the need for complex pretreatment before subsequent detection, thus shortening the overall detection process time.
[0032] 2. This invention modifies the surface of the nanozyme with a complementary sequence that pairs with the aptamer bases, effectively binding vacant aptamers and utilizing their catalytic ability to induce substrate color development, thereby improving detection sensitivity. This kit can quantitatively detect the content of allergens in samples with high sensitivity, good specificity, and fast detection speed, effectively solving the problems of complex pretreatment and the need for professional personnel to operate traditional methods. Attached Figure Description
[0033] Figure 1 This is the operation flowchart of this reagent kit;
[0034] Figure 2 This is a digital top view of the microneedle patch provided in Embodiment 1 of the present invention;
[0035] Figure 3 This is a top view taken by a scanning electron microscope according to Embodiment 1 of the present invention;
[0036] Figure 4 This is the standard curve graph provided in Embodiment 1 of the present invention;
[0037] Figure 5 This is an evaluation of the specificity of the reagent kit provided in Embodiment 1 of the present invention. Detailed Implementation
[0038] To more clearly illustrate the embodiments of the present invention, specific implementation methods will be described below with reference to the accompanying drawings. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings and other implementation methods can be obtained based on these drawings without any creative effort.
[0039] Example 1:
[0040] This example is based on a rapid food allergen detection kit and its preparation method based on microneedle patches and nanozymes, using the detection of β-lactoglobulin as an example, specifically including:
[0041] 1. The microneedle patch was prepared as follows: 25 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide, 20 mg of N-hydroxysuccinimide, and 15 μL of carboxyl-loaded β-lactoglobulin aptamer (Apt) were added to 1485 μL of ultrapure water. After activating with shaking for 3 hours, 3 g of 1% chitosan (Cs) was added and shaken overnight. Unbound aptamers in the Cs-Apt mixture were removed using an ultrafiltration tube. The mixture was then chemically cross-linked with 18 wt% polyvinyl alcohol solution at a 3 / 7 ratio under the action of 0.3 v / v% glutaraldehyde to form a needle preparation solution. Using a polymer template with a microporous structure, the needle preparation solution was poured into the template. Positive pressure and vacuum processes were used to remove air bubbles and completely fill the microneedle tip chamber with the needle preparation solution. The patch was then placed in a vacuum drying oven and, after thorough drying, carefully peeled off from the mold to obtain the microneedle patch. The specific sequence of the β-lactoglobulin aptamer is as follows:
[0042] CGACGATCGGACCGCAGTACCCACCCACCAGCCCCAACATCATGCCCATCCGTGTGTG.
[0043] Figure 2 This is a digital top-view image of the microneedle patch. Figure 3 It is a top view taken with a scanning electron microscope, from Figure 2 and Figure 3 The structure of the microneedle patch is clearly visible. The microneedle patch prepared using this method is modified with specific nucleic acid aptamers, enabling rapid and specific extraction of target allergenic proteins from food, achieving rapid sample pretreatment; it can then be used for subsequent detection, shortening the overall detection process time.
[0044] 2. Preparation of Nanozyme Solution Loaded with Complementary Sequence. In this example, MIL-88B(Fe) was selected as the peroxidase-like nanozyme, and 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2) were chosen as the substrates. The specific procedure was as follows: 1 mg of MIL-88B(Fe) was weighed and dispersed in 800 μL of phosphate buffer (pH=7.2-7.4), and 100 μL of 15 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 100 μL of 20 mg / mL N-hydroxysuccinimide were added for activation for 2 h. After centrifugation to remove unreacted catalyst, 5 μL of the complementary sequence solution (100 μM) was added, and the mixture was shaken overnight. Centrifugation was then performed at least three times to remove unreacted complementary sequences. The precipitate was collected and dispersed in phosphate buffer for later use. The specific complementary sequence was: CCCCCCCTTGGGGCTGGTGGGTGGGTA.
[0045] Using the above method, a nanozyme solution reagent A with a surface modified with complementary sequences that pair with the aptamer bases was prepared, which can effectively bind the vacant aptamers in the microneedles that are not bound to the protein.
[0046] 3. Preparation of substrate solutions. The concentration of TMB in the final colorimetric solution used in the final experiment was 1.0 mM, and the concentration of H2O2 in the final colorimetric solution used in the final experiment was 2.5 mM. The system was then uniformly adjusted to a certain volume using sodium acetate buffer (0.2 mM, pH=4). The above method yielded colorimetric substrate solution reagent B, which can undergo redox reactions with peroxides in the presence of peroxidase or peroxidase-like enzymes.
[0047] 4. Figure 4 This is a standard curve plotted based on standard protein agarose gel blocks. Specifically, β-lactoglobulin standard solutions were prepared at concentrations of 1, 10, 100, 500, and 1000 ppm and then prepared into agarose gel blocks for later use. The agar powder content was 0.5 wt%.
[0048] 5. Figure 1 This is a brief description of the reagent kit's operating procedure. The reagent kit usage method is as follows:
[0049] (a) After inserting the microneedle patch loaded with aptamer into the food, after 3 min, peel the microneedle patch off the food surface and rinse the microneedle with the washing solution in the kit more than 3 times to remove non-specific adsorption.
[0050] (b) Immerse the microneedles in 1.5 mL of solution, shake and incubate for 20 min, then remove the microneedles and rinse them with the washing solution in the kit at least 3 times;
[0051] (c) Immerse the microneedles in 1.8 mL of reagent B, and measure the absorbance at 652 nm after 30 min;
[0052] (d) Using the same test method, a standard curve was obtained using an agar gel block made from a standard protein solution, and the content of the target protein in the sample was calculated.
[0053] 6. Figure 5The specificity evaluation of the provided kit is shown in the figure. The specific verification of the kit's specificity is as follows: β-lactoglobulin (β-lg), shrimp tropomyosin (TM), arginine kinase (AK), parvoprotein (PV), α-casein (α-CN), whey protein (WP), ovalbumin (OVA), soy protein isolate (SP), and total wheat protein (POW) were prepared into agarose gels with a concentration of 10 ppm and an agar content of 0.1 wt%, which are the experimental groups. At the same time, an agarose gel with an agar content of 0.1 wt% prepared with ultrapure water was set as the control group. After performing the relevant operations according to the above kit operation steps, the absorbance value of each group in the experimental group was subtracted from the absorbance value of the control group to obtain the absorbance difference of each group in the experimental group. The specificity of the method was verified by comparing the absorbance difference of each group in the experimental group.
[0054] This invention modifies the surface of nanozymes with complementary sequences that pair with the aptamers' bases, effectively binding vacant aptamers and utilizing their catalytic ability to induce substrate color development, thereby improving detection sensitivity. Standard curves are obtained using a series of concentration-standard protein gel samples, enabling quantitative detection of allergen content in samples with high sensitivity, good specificity, and fast detection speed.
[0055] In the above embodiments, the standard protein solution can be any selected allergen standard protein with a purity of 90% or higher; the pH of the phosphate buffer in the washing solution can be any selected between 5.7 and 8.0, and the pH of the glycine buffer can be any selected between 8.6 and 10.6; the degree of deacetylation of chitosan can be any selected between 95% and 200 mPa·s; the degree of hydrolysis of polyvinyl alcohol can be any selected between 98% and 99% (mol / mol), and the concentration of polyvinyl alcohol can be any selected between 15% and 18 wt%; the mass ratio of polyvinyl alcohol to chitosan can be any selected between 1:1 and 9:1; and the concentration of the crosslinking agent glutaraldehyde can be any selected between 0.2% and 0.5% v / v.
[0056] The above description is merely a detailed explanation of preferred embodiments and principles of the present invention. For those skilled in the art, there may be changes in specific implementation methods based on the ideas provided by the present invention, and these changes should also be considered within the scope of protection of the present invention. sequence list <110> Zhejiang University of Commerce <120> A food allergen detection kit, its preparation method and application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <400> 1 cgacgatcgg accgcagtac ccacccacca gccccaacat catgcccatc cgtgtgtg 58 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <400> 2 ccccccttgg ggctggtggg tgggta 26
Claims
1. A detection kit, characterized in that: The kit includes: a microneedle patch, reagent A with a highly sensitive signal amplification function, reagent B for color development, an allergen standard protein solution, agar powder, and a washing solution; Reagent A is prepared from a nanozyme solution with any peroxidase-like activity by surface modification with a complementary sequence that is base complementary to the aptamer; Reagent B is any colorimetric substrate solution that reacts with peroxide in the presence of peroxidase or peroxidase-like enzyme; The preparation method of the microneedle patch includes the following steps: (a) Modify the amino group of chitosan with an allergen protein aptamer with a carboxyl group, and mix it with a polyvinyl alcohol solution and a crosslinking agent to prepare a needle body preparation solution; (b) Using a polymer template with a microporous structure, pour the needle body preparation solution into the template, and remove air bubbles and completely fill the microneedle tip chamber with the needle body preparation solution through a positive pressure and vacuum process; (c) Wait for it to dry thoroughly, carefully peel it off from the mold, and obtain a microneedle patch that can specifically and rapidly extract allergens in food.
2. The detection kit according to claim 1, characterized in that: The allergen standard protein solution is any allergen standard protein with a purity of not less than 90%.
3. The detection kit according to claim 1, characterized in that: The washing solution is any one or several of ultrapure water, a phosphate buffer with a pH of 5.7 - 8.0, and a glycine buffer with a pH of 8.6 - 10.
6.
4. The detection kit according to claim 1, wherein: In step (a), the deacetylation degree of chitosan is not less than 95%, the viscosity is in the range of 100 - 200 mPa·s, and the chitosan concentration is 1 wt%.
5. The detection kit according to claim 1, wherein: In step (a), the polyvinyl alcohol is selected with a degree of alcoholysis in the range of 98 - 99% mol / mol, the polyvinyl alcohol concentration is 15 - 18 wt%; the mass ratio of polyvinyl alcohol to chitosan is in the range of 1:1 - 9:
1.
6. The detection kit according to claim 1, wherein: In step (a), the crosslinking agent is glutaraldehyde, and the concentration is in the range of 0.2 - 0.5 v / v%.
7. A method for using the kit according to claim 1, characterized in that: (a) Pierce the microneedle patch loaded with aptamer into the food for several minutes, then peel it off from the food surface, and rinse the microneedle with the washing solution in the kit more than 3 times; (b) Immerse the above microneedle in reagent A in the kit for several minutes, then take out the microneedle, and rinse it with the washing solution in the kit more than 3 times; (c) Immerse the above microneedle in reagent B in the kit, measure the absorbance value after several minutes, and correspond it to the standard curve obtained from the agar gel prepared with the allergen standard protein in the kit to contain a certain concentration of protein, and calculate the protein concentration in the sample.
Citation Information
Patent Citations
Microneedle patch capable of rapidly extracting phosphorus-containing protein as well as preparation method and application thereof
CN112903386A
Difunctional G-quadruplex allosteric biosensor for detecting beta-lactoglobulin
CN114075565A