Self-assembled ferritin nanoantigen particles and influenza vaccine and preparation method

Abstract

The present invention discloses self-assembled ferritin nanoantigen particles and influenza vaccines and preparation methods. The present invention fuses the extracellular domain of influenza virus hemagglutinin protein with the N-terminus of the subunit of self-assembled ferritin nanoparticles, and displays the influenza virus hemagglutinin protein on the surface of the self-assembled ferritin cage structure. The present invention performs mutation optimization on the influenza virus hemagglutinin protein to increase its soluble expression amount and expression efficiency, increase the immune efficacy and width of the vaccine, and increase the immunogenicity of the influenza virus hemagglutinin protein. The present invention utilizes Escherichia coli prokaryotic expression system, silkworm and AcMNPV-insect cell eukaryotic expression system to express and prepare recombinant protein vaccines respectively, or generates antigen-induced antibody production by gene presentation in vertebrate body tissues through recombinant baculovirus. The influenza vaccine of the present invention can induce broadly neutralizing anti-influenza antibodies, which can not only improve the immune efficacy but also expand the immune range, and has the potential of a universal vaccine with cross-immunity efficacy.

Description

[0001] This application is a divisional application of the invention patent application with application number "201910302335.1", application date "April 16, 2019", and invention name "Self-assembled ferritin nanoantigen particles, influenza vaccine and preparation method". Technical Field

[0002] The invention relates to self-assembled ferritin nano antigen particles, in particular to nano antigen particles comprising influenza virus hemagglutinin protein and monomeric ferritin subunits fused together and influenza vaccines prepared from the nano particle antigens, belonging to the field of influenza vaccines. Background Art

[0003] Influenza (flu) is an acute respiratory infectious disease caused by influenza virus. Influenza virus is highly contagious, has a high incidence rate, and is widely spread, which has a serious impact on human health and the global economy. Influenza viruses are divided into three types: A, B, and C. The bovine influenza virus discovered in recent years is classified as D. Among them, influenza A virus often undergoes antigenic mutations, causing several influenza pandemics around the world. The best tool for preventing and treating influenza viruses is mainly vaccines. The main mechanism of the influenza vaccine currently used is to induce the body to produce protective antibodies against influenza virus surface antigens hemagglutinin (HA) and neuraminidase (NA). However, antigenic drift and antigen conversion are prone to occur on the surface of influenza A virus, which requires regular redesign of vaccines to adapt to the viruses that are most likely to cause influenza in the coming year. In view of the current trend of influenza virus prevention and treatment, it is urgent to prepare a universal vaccine with broad spectrum and high immune efficacy. The best treatment for diseases is to prevent them before they occur, and vaccines for various diseases are the main force in preventing them. Traditional vaccines are mostly live attenuated vaccines, including natural attenuated strains and genetically recombinant attenuated strains. The biggest drawback of using attenuated strain vaccines is the risk of attenuated strains recovering virulence in susceptible populations. Therefore, the production of safe, efficient and inexpensive genetically engineered vaccines has become a new demand. Ferritin nanoparticles, which are self-assembled from 24 subunits, are an ideal platform for antigen presentation and vaccine development.

[0004] In recent years, ferritin has been used as a nanomaterial in many fields. Ferritin is a cage-like protein widely found in organisms. Its protein shell is self-assembled by 24 ferritin subunits, of which three subunits form a trimer subunit. The N-terminus of ferritin extends to the outer surface, which is easy to be genetically modified and fused to protein polypeptides. Highly ordered repeating antigens are easily induced to produce strong T cell-dependent antibody responses when distributed at intervals of 5-10nm on the surface of microorganisms. Ferritin is very stable and can withstand high temperatures (70-80℃) and a variety of denaturants without affecting the natural protein structure. Ferritin is sensitive to pH. The protein shell disintegrates under acidic conditions of pH 2.0, and when the pH returns to physiological conditions (pH 7.0), the disintegrated protein subunits can reassemble into complete ferritin. In recent years, the research on ferritin has mainly focused on: (1) modifying the inner surface of ferritin to encapsulate specific drugs in the ferritin shell or promote the synthesis of nanomaterials; (2) modifying the outer surface of ferritin to connect with PEG or antibodies to expand new functions; (3) controlling the self-assembly of ferritin by modifying the outer surface of ferritin or the contact surface between subunits. Ferritin nanoparticles display antigens, which can significantly enhance the immunogenicity of antigens and induce stronger humoral and cellular immune responses. Therefore, ferritin is an ideal nanovaccine platform. Summary of the invention

[0005] One of the objects of the present invention is to provide a self-assembled ferritin nanoantigen particle comprising a fusion protein;

[0006] The second purpose of the present invention is to mutate the fusion protein to increase the expression amount or expression efficiency of the fusion protein;

[0007] The third object of the present invention is to provide a nanoparticle influenza vaccine based on self-assembled ferritin nanoantigen particles;

[0008] A fourth object of the present invention is to provide a method for efficiently expressing the fusion protein;

[0009] The fifth object of the present invention is to provide a method for presenting a fusion gene constructed by self-assembled ferritin nanoparticles and hemagglutinin protein into an animal and presenting antigens in the animal to induce the production of antibodies.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The present invention first provides a nano antigen particle comprising a fusion protein, wherein the fusion protein is obtained by connecting the N-terminus of an influenza virus hemagglutinin protein and a monomeric ferritin subunit;

[0012] The monomeric ferritin subunit includes any one of bacterial ferritin, plant ferritin, algae ferritin, insect ferritin, fungal ferritin or mammalian ferritin; preferably, the monomeric ferritin subunit is a Helicobacter pylori ferritin monomer, whose amino acid sequence is shown in SEQ ID NO.1, and whose nucleotide sequence of the encoding gene is shown in SEQ ID NO.2;

[0013] The influenza virus hemagglutinin protein is an H9 influenza virus hemagglutinin protein or an H5 influenza virus hemagglutinin protein; preferably, the selected region of the influenza virus hemagglutinin protein includes a region selected from the following regions: a region capable of allowing the formation of a hemagglutinin trimer, a stem region, and an extracellular domain; most preferably, the H9 influenza virus hemagglutinin protein only selects a specific portion of the extracellular domain of the H9 influenza virus hemagglutinin protein, and the H5 influenza virus hemagglutinin protein only selects a specific portion of the extracellular domain of the H5 influenza virus hemagglutinin protein.

[0014] The amino acid sequence of the H9 influenza virus hemagglutinin protein is shown in SEQ ID NO.3; the amino acid sequence of the H5 influenza virus hemagglutinin protein is shown in SEQ ID NO.5;

[0015] Preferably, the influenza virus hemagglutinin protein and the N-terminus of the monomeric ferritin subunit are connected via a connecting peptide SGG to obtain a fusion protein.

[0016] The amino acid sequence of a fusion protein provided by the present invention is shown in SEQ ID NO.7 (H9 HA-Ferritin), and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.8; the amino acid sequence of another fusion protein provided by the present invention is shown in SEQ ID NO.9 (H5 HA-Ferritin), and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.10.

[0017] In order to increase the expression of the fusion protein obtained by connecting the influenza virus hemagglutinin protein to the ferritin monomer, the present invention further performs mutation optimization on the consensus sequence of the fusion protein shown in SEQ ID NO.7 and SEQ ID NO.9, and performs glycosylation site analysis after sequence optimization to eliminate the glycosylation site to increase soluble expression. Thus, after the consensus sequence optimization, amino acid single-site mutation, double-site mutation and multi-site mutation are performed to improve its soluble expression and expression efficiency:

[0018] Specifically, the inventors compared and analyzed the amino acid sequences of the hemagglutinin proteins of 20 H5 and H9 strains prevalent in different regions in recent years, and found the most common consensus sequence as the antigen gene of the corresponding strain, in order to achieve the best protective effect; on this basis, the present invention further used OptimumGene TM The technology optimizes the amino acid sequence of H5 and H9 hemagglutinin proteins, and transforms the amino acid sequence of the optimized hemagglutinin protein amino acid sequence and the amino acid sequence of the ferritin monomer subunit according to the codon preference of Escherichia coli, and optimizes the design of various related parameters such as GC content, CpG dinucleotide content, codon preference, secondary structure of mRNA, mRNA free energy stability, RNA instability gene sequence, and repeat sequence that affect gene transcription efficiency, translation efficiency, and protein folding, and keeps the final translated protein sequence unchanged. In addition, in order to increase the expression amount of ferritin and improve soluble expression at the same time, the ferritin monomer subunit is subjected to point mutation N19Q. Finally, the present invention obtains the amino acid of the optimized sequence of the consensus sequence of the fusion protein shown in SEQ ID NO.7 according to the above-mentioned optimization method as shown in SEQ ID NO.11, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.12; the amino acid sequence of the optimized sequence obtained by the consensus sequence of the fusion protein shown in SEQ ID NO.9 according to the above-mentioned optimization method is shown in SEQ ID NO.13, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.14.

[0019] The present invention expresses the optimized consensus sequence in a silkworm expression system. According to the ELISA titer results of the gene expression products, it can be seen that the expression amount of the consensus sequence after codon optimization is significantly improved compared with that before optimization.

[0020] The present invention obtains H9 HA-Ferritin-C and H5 HA-Ferritin-C mutants, and uses the codon-optimized gene sequences of H9 HA-Ferritin-C and H5 HA-Ferritin-C mutants as templates to design multiple pairs of primers for site-directed mutagenesis of the conserved sequences:

[0021] The amino acid sequence shown in SEQ ID NO. 11 was mutated in the manner of amino acid single-site mutation of N40S, N41D, A47T, L51I, M58I, G63N, P83L, P101S, T138K, E181G, N191H, H192Q, D196E, T197A, G236R, I267V, Q304H, D367N, N419S or V469M to obtain multiple single-site mutants;

[0022] The amino acid sequence shown in SEQ ID NO. 13 was mutated in the manner of V40I, K51R, T52A, K56R, S72R, N100S, H126R, G155E, E186K, D187N, V190I, L191M, G193W, I242M, N289Y, N325S, Y366F, E406G, D462E or Q501H to obtain multiple single-site mutants;

[0023] The present invention expresses these single-site mutants in a silkworm expression system. According to the expression results, the titers of the expression products of the six mutants obtained by mutating the amino acid sequence shown in SEQ ID NO.11 by amino acid single-site mutations of N40S, N41D, A47T, N191H, H192Q or D196E are significantly improved;

[0024] The titer of the expression products of the six mutants obtained by subjecting the amino acid sequence shown in SEQ ID NO.13 to amino acid single-point mutations of V40I, K51R, K56R, V190I, L191M or G193W was significantly improved.

[0025] Based on the fact that some of the determined single-site mutations are effective mutations, the purpose of increasing the expression of H9 HA-Ferritin-COM and H5 HA-Ferritin-COM mutants can be achieved. Considering that the order of amino acid arrangement is the primary structure of the protein and determines the higher-order structure of the protein, and that the positions of some mutation sites of the above-mentioned amino acid single-site mutations may be interrelated, the present invention further performs amino acid double-site mutations. The present invention combines the single mutation sites H9 HA: N40S, N41D, A47T, N191H, H192Q, or D196E that can increase the expression amount; H5 HA: V40I, K51R, K56R, V190I, L191M or G193W in pairs to perform double-site mutations, as follows:

[0026] The amino acid sequence shown in SEQ ID NO.11 was mutated in a double-site manner according to N40S-N41D, N40S-A47T, N40S-N191T, N40S-H192Q, N40S-D196E, N41D-A47T, N41D-N191H, N41D-H192Q, N41D-D196E, A47T-N191H, A47T-H192Q, A47T-D196E, N191H-H192Q, N191H-D196E or H192Q-D196E to obtain 15 double-site mutants;

[0027] The amino acid sequence shown in SEQ ID NO. 13 was mutated in a double-site manner according to V40I-K51R, V40I-K56R, V40I-V190I, V40I-L191M, V40I-G193W, K51R-K56R, K51R-V190I, K51R-L191M, K51R-G193W, K56R-V190I, K56R-L191M, K56R-G193W, V190I-L191M, V190I-G193W or L191M-G193W to obtain 15 site mutants;

[0028] The 30 double-site mutants obtained by the present invention are respectively expressed in a silkworm expression system. According to the expression results, it can be seen that the titers of the expression products of the three site mutants obtained by subjecting the amino acid sequence shown in SEQ ID NO.11 to the double-site mutation of N40S-N41D, N41D-A47T or A47T-H192Q are significantly improved, among which the titer of the mutant obtained by subjecting the amino acid shown in SEQ ID NO.11 to the double-site mutation of N41D-A47T (the amino acid sequence of the mutant is shown in SEQ ID NO.19, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.20) is the most significantly improved;

[0029] The titers of the expression products of the three site mutants obtained by double-site mutation of amino acids in V40I-K51R, K51R-V190I or V190I-G193W according to the amino acid sequence shown in SEQ ID NO.13 were significantly improved, among which the site mutant obtained by double-site mutation of amino acids in V190I-G193W according to the amino acid sequence shown in SEQ ID NO.13 (the amino acid sequence of the mutant is shown in SEQ ID NO.21, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.22) had the most significant improvement in titer.

[0030] In view of the fact that some double-site mutations can effectively increase the titer after expression, and considering that the order of amino acid arrangement is the primary structure of the protein and determines the higher-level structure of the protein, it is speculated that it may be because the positions of some mutation points of the amino acid single-site mutations are close to each other and related to each other, and the present invention further attempts to perform amino acid multi-site mutations. The present invention analyzes the glycosylation sites and obtains that 6 single mutation sites can effectively increase the expression of the target gene. Therefore, the multi-site mutation is based on the above-mentioned effective double-site mutation sequence, and the site-directed mutation of multiple mutation sites is performed by the fusion PCR method. The specific mutation method is as follows:

[0031] The amino acid sequence shown in SEQ ID NO.11 is subjected to N40S-N41D-A47T-N191H-H192Q-D196E amino acid multi-site mutation to obtain a multi-site mutant, the amino acid sequence of the multi-site mutant is shown in SEQ ID NO.23, and the nucleotide sequence of the gene encoding it is shown in SEQ ID NO.24; the amino acid sequence shown in SEQ ID NO.13 is subjected to V40I-K51R-K56R-V190I-L191M-G193W amino acid multi-site mutation to obtain a multi-site mutant, the amino acid sequence of the multi-site mutant is shown in SEQ ID NO.25, and the nucleotide sequence of the gene encoding it is shown in SEQ ID NO.26.

[0032] The present invention expresses the obtained two multi-site mutants (SEQ ID NO.23, SEQ ID NO.25) in the silkworm expression system, respectively. According to the expression results, it can be seen that the expression levels of the obtained two multi-site mutants are significantly improved compared with the expression levels of the above-mentioned single mutants and double mutants. The present invention further purifies the expression products of the two multi-site mutants in the silkworm expression system and observes them using an electron microscope. The observation results show that the product size is consistent with the expected nanoparticles, the diameter of the cage is about 12 nanometers, and antenna-like protrusions can be seen by careful observation.

[0033] The invention clones the obtained two multi-site mutant (SEQ ID NO.23, SEQ ID NO.25) encoding genes into a baculovirus mammalian expression vector to construct a recombinant baculovirus presenting gene; the recombinant baculovirus is presented to mice and chickens, and the results show that the antibody titers produced by the mice and chickens are significantly higher than those of healthy silkworm pupa controls and traditional vaccines.

[0034] Therefore, the self-assembled ferritin nanoantigen particles containing fusion protein provided by the present invention can be used to prepare influenza vaccines, and the application method thereof includes:

[0035] (I) expressing the fusion protein encoding gene in prokaryotic cells using a prokaryotic expression system to obtain nanoantigen particles, purifying the expressed nanoantigen particle product and mixing it with a medically acceptable immune adjuvant or carrier to obtain an influenza vaccine;

[0036] For reference, the steps of expressing nanoantigen particles in prokaryotic cells using a prokaryotic expression system include:

[0037] (1) Cloning the original sequence of the fusion protein or the fusion protein sequence after mutation optimization into the expression vector pET28a to obtain the recombinant plasmids pET28a-H9 HA-Ferritin and pET28a-H5 HA-Ferritin;

[0038] (2) The recombinant plasmids pET28a-H9 HA-Ferritin and pET28a-H5 HA-Ferritin were transformed into BL21 (DE3) competent cells for expression, and then purified by nickel column.

[0039] (II) The fusion protein encoding gene is expressed in eukaryotic cells using a eukaryotic expression system, and the expressed antigen product is purified and then mixed with a medically acceptable immune adjuvant or carrier to obtain an influenza vaccine.

[0040] For reference, the method for expressing the fusion protein encoding gene in eukaryotic cells using a eukaryotic expression system includes: expressing the fusion protein encoding gene in a silkworm expression system, collecting and purifying the expressed antigen; preferably, constructing the fusion protein encoding gene into a silkworm bacilliform expression vector to prepare a recombinant silkworm baculovirus; amplifying the recombinant silkworm baculovirus in silkworm cells and then expressing it in silkworms or silkworm pupae;

[0041] Alternatively, the fusion protein encoding gene is expressed in the AcMNPV-insect cell eukaryotic expression system, and the expressed antigen is collected and purified; preferably, the fusion protein encoding gene is cloned into a baculovirus transfer vector to construct a recombinant baculovirus transfer vector; the recombinant baculovirus transfer vector and baculovirus DNA are co-transfected into insect cells to obtain a recombinant baculovirus; the recombinant baculovirus is infected with an insect host or insect cells, and the infected insect cells or insect hosts are cultured to express the corresponding antigen, and purified to obtain the antigen;

[0042] (III) The fusion protein encoding gene can also be cloned into a gene presentation vector to construct a recombinant baculovirus transfer vector for presenting foreign genes to vertebrate cells or individuals, and the recombinant baculovirus transfer vector is transfected into silkworm cells to obtain a recombinant virus; the obtained recombinant virus presents antigens in animals through injection or oral administration and induces animals to produce antibodies.

[0043] The present invention further provides a vaccine for preventing and treating influenza, comprising: a preventive or therapeutically effective amount of self-assembled ferritin nanoantigen particles containing fusion protein and a pharmaceutically acceptable immune adjuvant or carrier.

[0044] Vaccine of the present invention can be prepared with various pharmaceutical excipients or carriers. They can include salt and buffer to provide physiological ionic strength and pH, surfactants such as polysorbate 20 and 80 to prevent antigen aggregation, stabilizers for antigen stability, such as PEG, trehalose and gelatin and polymers such as CMC, HEC and dextran for sustained release. Vaccine can also be prepared with controlled release or enhanced display systems, such as hydrogels, virosomes, nanoparticles and emulsions. Vaccine can also be prepared with adjuvants to further increase cross-reaction immune responses and cross protection, and the suitable adjuvant can be selected from polysaccharides such as lipopolysaccharides and saponins, nucleic acids such as CpG and poly-I:C, lipids such as MPL (monophosphoryl lipid A), proteins such as bacterial flagellin, inorganic salts such as aluminum salts and calcium phosphate, emulsions such as Freund's incomplete adjuvant, MF59 and AS03 and various Toll-like receptor ligands. Different adjuvants can be tested with treated antigens to identify suitable adjuvants that produce higher levels of cross-reactive immune responses and cross-protection, including complete or 100% protection, at appropriate adjuvant doses.

[0045] The influenza vaccine of the present invention can be administered by various routes, such as intramuscularly, subcutaneously, intranasally, topically, sublingually, or orally.

[0046] The vaccine provided by the present invention can induce broadly neutralizing influenza antibodies by displaying the influenza virus protein trimer structure on the surface of the Helicobacter pylori ferritin cage structure. The neutralizing antibodies induced by this vaccine in individuals not only increase the immune efficacy, but also increase the immune range, and can immunize against the same type and different type influenza viruses of different years.

[0047] Compared with the prior art, the present invention has the following advantages and effects:

[0048] 1. The present invention utilizes prokaryotic expression system Escherichia coli, silkworm baculovirus and AcNPV-insect cell eukaryotic expression system to express recombinant protein vaccine. The vaccine preparation process does not involve live harmful viruses. Compared with the traditional chicken embryo influenza vaccine preparation method, the operation is safer and simpler, and is suitable for rapid large-scale production.

[0049] 2. The nano influenza vaccine provided by the present invention can induce influenza antibodies with broad-spectrum properties, laying the foundation for the preparation of a universal influenza vaccine.

[0050] 3. The nano-influenza vaccine provided by the present invention induces a significantly higher level of anti-influenza antibodies in animals when immunized with the nano-influenza vaccine than that of traditional vaccines.

[0051] Definitions of terms used in this invention

[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0053] The terms "antigen" and "immunogen" are used interchangeably and refer to a molecule, substance, protein, glycoprotein, or live virus that is capable of inducing a specific humoral (antibody) and cellular immune response.

[0054] The term "antigenicity" refers to the ability of an antibody to react or bind to a specific antigen; the term "immunogenicity" refers to the ability of an antigen or vaccine to induce a specific immune response; the term "immune response" refers to a humoral or antibody-mediated and cell-mediated immune response to an antigen, vaccine, or infectious agent; the term "vaccine" refers to a composition including an antigen for therapeutic treatment or prophylactic immunization against infectious or non-infectious diseases; the term "immunity" refers to an immune response produced by vaccination or infection that provides protection against infectious or foreign agents; the term "recombinant protein or antigen" refers to a protein or antigen produced by recombinant DNA technology, which can be used to clone and express genes in various hosts including bacteria, mammalian cells, insect cells, and plants to produce proteins. The term "potency" refers to the amount of an antigen in an antigen preparation or vaccine as measured by a specified potency assay.

[0055] The terms "mutation" and "mutant" have their ordinary meanings herein and refer to genetic, naturally occurring or introduced changes in nucleic acid or polypeptide sequences, and their meanings are the same as those generally known to those skilled in the art.

[0056] The term "host cell" or "recombinant host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome.

[0057] The term "transfection" refers to the process by which eukaryotic cells acquire new genetic markers as a result of the incorporation of foreign DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 Schematic diagram of the hemagglutination test of the product expressed by H9 HA-Ferritin-CO-M6 in the silkworm expression system; the initial dilution value was 100 times, and the hemagglutination value reached 51200.

[0059] Figure 2 Schematic diagram of the hemagglutination test of the product expressed by H5 HA-Ferritin-CO-M6 in the silkworm expression system; the initial dilution value was 400 times, and the hemagglutination value reached 12800.

[0060] Figure 3 Virus neutralization experiment diagram. A is a neutralizing antibody inhibition virus experiment diagram, the figure shows the normal cell growth state; B is a partial cell infection virus experiment diagram, the figure shows the cells in a shrunken state after being infected with the virus.

[0061] Figure 4 Western blotting detection of H9 HA-Ferritin-CO-M6 expression products in the silkworm expression system; A is the H9 HA-Ferritin-CO-M6 silkworm expression product; B is the negative control.

[0062] Figure 5 Western blotting detection of H5 HA-Ferritin-CO-M6 expression products in the silkworm expression system; A is the H5 HA-Ferritin-CO-M6 silkworm expression product; B is the negative control.

[0063] Figure 6 H9 HA-Ferritin-CO-M6 or H5 HA-Ferritin-CO-M6 nanoparticles were initially purified and then examined by transmission electron microscopy. Scale bar: 20 nm. A large number of spherical substances of the expected size were observed, indicating that the fusion protein successfully self-assembled into nanoparticle antigens. DETAILED DESCRIPTION

[0064] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the scope of protection of the present invention.

[0065] 1. Test materials and reagents

[0066] (1) Bacteria strains, virus strains, and vectors: The prokaryotic expression vector pET-28a(+), Escherichia coli TOP10 strain, transfer vector pVL1393, prokaryotic expression strain BL21(DE3), silkworm cells BmN, Sf-9 cells, Hi5 insect cells, Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid, Autographa californica polyhedrosis virus parent strain AcBacmid, and silkworm variety JY1 were all preserved in the Molecular Microbiology Laboratory, Institute of Biotechnology, Chinese Academy of Agricultural Sciences.

[0067] (2) Ferritin sequence and influenza virus HA protein gene sequence: The consensus sequence obtained through analysis was sent to GenScript for synthesis and cloned into the prokaryotic expression vector pUC57.

[0068] (3) Enzymes and reagents: Restriction endonucleases, T4 DNA ligase and corresponding buffers were purchased from Promega; LA Taq polymerase and buffer were purchased from TaKaRa; DNA and protein molecular weight standards of various specifications were products of TranGen Biotech; 2K PlusⅡ DNA Marker was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody was purchased from MBL; DEPC and M-MLV-Rtase (reverse transcriptase) were purchased from Promega;

[0069] (4) Biochemical reagents: Tris, ampicillin, kanamycin, IPTG, SDS, urea, imidazole, TritonX-100, TEMED (N,N,N',N'-Tetramethylethylene diamine), ammonium persulfate, and kanamycin were purchased from Sigma; bisacrylamide, acrylamide, IPTG, and X-Gal were purchased from Promega; agarose was a product of Sunbiotech; yeast extract and trypsin were purchased from OXOID, UK; 0.2um and 0.45um filters were purchased from Gelman Sciences; ethidium bromide (EB) and Coomassie brilliant blue R-250 were purchased from Fluka; Ni-NTA agarose, proteinase K, and fetal bovine serum were purchased from Invitrogen; bovine serum albumin was purchased from Roche; all other reagents were domestically produced or imported analytical grade reagents. Primer synthesis and gene sequencing were completed by Beijing Qingke Xinye Biotechnology Co., Ltd.

[0070] (5) Culture medium: LB medium was used for Escherichia coli culture medium; TC-100 medium for silkworm insect cells was purchased from AppliChem;

[0071] (6) Animal experiments on nanovaccines constructed by fusion of influenza virus and ferritin were conducted in an isolated laboratory.

[0072] 2. Fusion PCR method for site-directed mutagenesis in experimental methods

[0073] The method described by Kuang Feiting et al. (A new method for vector construction: recombinant fusion PCR method, Genomics and Applied Biology, 2012, Vol. 31, No. 6, pp. 634-639) was used.

[0074] Example 1 Preparation and efficacy testing of H9 HA-Ferritin and H5 HA-Ferritin original sequence nanoparticle vaccines 1 Configuration of relevant solutions and culture medium

[0075] For the preparation methods of solutions and culture media, please refer to relevant reference books (Joseph et al., Molecular Cloning Laboratory Manual, 3rd Edition, 2002; Osber et al., Concise Guide to Molecular Biology, 1998).

[0076] Synthesis of 2H9, H5 hemagglutinin protein gene sequences and ferritin gene sequences.

[0077] In order to better express the fusion of influenza virus hemagglutinin and ferritin, the amino acid sequences of H9 (SEQ ID NO.3) and H5 (SEQ ID NO.4) influenza virus hemagglutinin proteins were analyzed using signal peptide analysis software (SignalP) and transmembrane domain analysis software (TMHMM), respectively, and it was found that the signal peptide of H9 hemagglutinin protein was the first 18 amino acids, and its extracellular domain was the first 524 amino acids. The signal peptide of H5 hemagglutinin protein was the first 16 amino acids, and its extracellular domain was the first 532 amino acids.

[0078] In order to promote the expression efficiency of influenza virus and ferritin fusion nanoparticles and improve soluble expression, the 19th asparagine (N) in the Helicobacter pylori ferritin amino acid sequence (SEQ ID NO.1) was mutated to glutamine (Q) to eliminate the glycosylation site. The influenza virus hemagglutinin protein sequence and the ferritin sequence are connected by a connecting peptide (SGG), the first 4 amino acids of the ferritin amino acid sequence are removed, and then the connecting peptide is connected to the 5th amino acid at the N-terminus of ferritin.

[0079] In order to improve the translation initiation efficiency of the target gene in the Bombyx mori baculovirus eukaryotic expression system, the Kozak sequence AAC was added in front of the gene, and the stop codon was changed to TAA to improve the translation termination efficiency. In addition, the restriction enzyme sites such as BamHI and EcoRI in the gene sequence were removed, and BamHI and EcoRI restriction enzyme sites were added upstream and downstream of the gene, so as to facilitate subsequent cloning into the eukaryotic transfer vector pVL1393.

[0080] The signal peptide of the target gene sequence was removed, and the ATG on the pET-28a(+) vector was used to initiate translation. In addition, the restriction enzyme sites such as BamHI and EcoRI in the gene sequence were removed, and BamHI and EcoRI restriction enzyme sites were added upstream and downstream of the gene, so that the gene could be cloned into the prokaryotic vector pET-28a(+) later.

[0081] The influenza virus hemagglutinin gene sequence and ferritin sequence designed above were handed over to the relevant biotechnology company for synthesis.

[0082] 3. Plasmid construction of influenza virus and ferritin fusion protein

[0083] 3.1 PCR amplification of influenza virus and ferritin fusion protein

[0084] Influenza virus and ferritin were fused together using fusion PCR technology. The specific experimental method is shown in the above experimental method 2. 3.1.1 PCR amplification of E. coli expression plasmid

[0085] PCR amplification of H9 HA extracellular domain sequence: using plasmid pUC57-H9 HA as template

[0086] F1 5'-CGGGATCCACTATACTACTAGTAGTAACAG-3' R1 5'-TTGATGATGTCGCCACCGGAGATTTTGTAAGTTCCTTCAG-3'

[0087] PCR amplification of Ferritin sequence: using pUC57-Ferritin as template,

[0088] F2 5'-CTGAAGGAACTTACAAAATCTCCGTGGCGACATCATCAA-3' R2 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0089] Using PCR products H9 HA and Ferritin as templates, Overlap-PCR amplified H9 HA-Ferritin

[0090] F1 5'-CGGGATCCATAACTATACTACTAGTAGTAA-3' R2 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0091] PCR amplification of H5 HA extracellular domain sequence: using plasmid pUC57-H5 HA-Ferritin as template,

[0092] F3 5'-CGGGATCCGATCAGATTTGCATTGGTTAC-3' R3 5'-TTGATGATGTCGCCACCGGATATTTGGTAAGTTCCTATTG-3'

[0093] PCR amplification of Ferritin sequence: using pUC57-Ferritin as template,

[0094] F4 5'-CAATAGGAACTTACCAAATATCCGGTGGCGACATCATCAA-3' R4 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0095] Using PCR products H5 HA and Ferritin as templates, Overlap-PCR amplified H5 HA-Ferritin.

[0096] F3 5'-CGGGATCCTTCTTCTTGCAATAGTCAGT-3' R4 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0097] 3.1.2 PCR amplification of expression plasmids in the silkworm expression system

[0098] PCR amplification of H9 HA extracellular domain sequence: using plasmid pUC57-H9 HA as template

[0099] F5 5'-CGGGATCCAACATGGAGACAGCATCACTGATAACT-3' R5 5'-TTGATGATGTCGCCACCGGAGATTTTGTAAGTTCCTTCAG-3'

[0100] PCR amplification of Ferritin sequence: using pUC57-Ferritin as template,

[0101]

[0102]

[0103] Using PCR products H9 HA and Ferritin as templates, Overlap-PCR amplified H9 HA-Ferritin

[0104] F5 5'-CGGGATCCAACATGGAGACAGCATCACTGATAACT-3' R6 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0105] PCR amplification of H5 HA extracellular domain sequence: using plasmid pUC57-H5 HA-Ferritin as template,

[0106] F7 5'-CGGGATCCAACATGGAGAAAATAGTGCTTCT-3' R7 5'-TTGATGATGTCGCCACCGGATATTTGGTAAGTTCCTATTG-3'

[0107] PCR amplification of Ferritin sequence: using pUC57-Ferritin as template,

[0108] F8 5'-CAATAGGTTACCAAATATCCGGGTGGCGACATCATCAA-3' R8 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0109] Using PCR products H5 HA and Ferritin as templates, Overlap-PCR amplified H5 HA-Ferritin.

[0110] F7 5'-CGGGATCCAACATGGAGAAAATAGTGCTTCT-3' R8 5'-GAATTCTTAGCTCTTGCCGGACTTGG-3'

[0111] The PCR reaction system is as shown in Table 1:

[0112] Table 1 PCR reaction system

[0113]

[0114] PCR parameter settings:

[0115]

[0116] 3.2 Purification and recovery of DNA fragments from glass milk

[0117] Prepare 1% (w / v) agarose gel and perform electrophoresis on the PCR amplified products; place the agarose gel under ultraviolet light, quickly cut out the gel containing a single target nucleic acid band, put it into a 1.5mL centrifuge tube, weigh it, add three times the volume of 6M NaI, and put it in a 37℃ constant temperature incubator to melt; add 8μL Glassmilk to the completely melted solution, mix well, ice bath for 5min, and shake twice in the middle; centrifuge at 8000rpm for 10s, and discard the supernatant; add 800μL New Wash to wash, gently flick and centrifuge, repeat 2 times; discard the supernatant, put the centrifuge tube in a 37℃ constant temperature incubator to dry for 2-3min; after drying, add 20μL 0.1×TE to dissolve, mix to fully dissolve the DNA, centrifuge at 12000rpm for 5min, take the supernatant and use it for connection immediately, and store the rest at -20℃.

[0118] 3.3 Enzyme digestion of target gene PCR product

[0119] The PCR products were run on a gel, and the correct products were recovered from the gel and double-digested with restriction endonucleases BamH I and EcoR I to obtain the target fragments H9 HA-Ferritin and H5 HA-Ferritin. The enzyme digestion system is shown in Table 2 below:

[0120] Table 2 Enzyme digestion system

[0121]

[0122] 3.4 Small-scale preparation of competent cells

[0123] Prepare E. coli Top10 competent cells and store at -80℃.

[0124] 3.5 Ligation and transformation of target gene with pET-28a(+) vector and pVL1393 vector

[0125] 3.5.1 Enzyme digestion of pET-28a(+) and pVL1393 vectors

[0126] The transfer vectors pVL1393 and pET-28a(+) were double-digested with restriction endonucleases BamHI and EcoRI, inactivated at 65°C for 20 min, and stored at -20°C for later use.

[0127] 3.5.2 Connection

[0128] The target fragment recovered by restriction digestion was connected with the transfer vector pVL1393 and pET-28a(+) after double digestion with BamHI / EcoRI. Use T4 DNA ligase at 16°C for overnight connection. The connection system is shown in Table 3 below:

[0129] Table 3 Connection system

[0130]

[0131] 3.5.3 Conversion

[0132] Take the competent cells stored at -80℃, quickly melt half of them, add 3μL of the above-mentioned ligation product, and place on ice for half an hour; place in a 42℃ constant temperature water bath for 90s, and quickly place on ice for 3-5min; add an appropriate amount of 1mL LB culture medium to the tube, and culture it in a 37℃ constant temperature incubator for 60min; centrifuge, discard most of the supernatant, keep 200μL and spread it on an LB plate (100μg / mL Amp), and culture it upright in a 37℃ constant temperature incubator for 30min, and then culture it inverted overnight.

[0133] 3.6 Rapid nucleic acid extraction method to screen positive clones

[0134] Pick a single colony on the LB plate, inoculate it in LB liquid culture medium (100μg / mL Amp), place it in a 37℃ constant temperature shaking incubator, set the speed to 220rpm, and culture overnight; take 500μL of bacterial solution in a centrifuge tube to collect the bacteria; add 30μL Loading Buffer and 20μL phenol / chloroform (1:1), mix thoroughly with a vortex shaker to resuspend the bacteria; centrifuge at 12000rpm for 3min, take 8μL of supernatant for agarose gel electrophoresis, and use the empty vector treated in the same way as a control. Observe the bands under the ultraviolet light of the gel imaging system, and select the bacterial solution with obvious retardation of the plasmid band to extract the plasmid.

[0135] 3.7 Extraction of plasmid DNA by SDS alkaline lysis method

[0136] Collect 3 mL of bacterial solution in a centrifuge tube, extract plasmid DNA by SDS alkaline lysis method, and store at -20℃ for future use.

[0137] 3.8 Restriction digestion and sequencing of positive clones

[0138] The enzyme digestion system is shown in Table 4 below:

[0139] Table 4 Enzyme digestion system

[0140]

[0141] After reacting at 37℃ for 2h, 7μL was taken for electrophoresis detection with 1% agarose. The correct plasmid DNA was detected by enzyme digestion and sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for sequencing. The results were consistent with the target gene, and the recombinant plasmids were named pET28a-H9 HA-Ferritin, pET28a-H5 HA-Ferritin, pVL1393-H9 HA-Ferritin, and pVL1393-H5HA-Ferritin.

[0142] 4 Expression and purification of recombinant plasmid

[0143] 4.1 Induced expression of recombinant plasmid in E. coli

[0144] The correctly identified recombinant expression plasmids pET28a-H9 HA-Ferritin and pET28a-H5 HA-Ferritin were transformed into BL21 competent cells, and the bacterial liquid was collected after induction at 37°C with a final IPTG concentration of 0.5mM for 1h, 2h, 3h, 4h, and 5h, respectively. The expression was analyzed by SDS-PAGE electrophoresis. A specific band appeared at about 81kD for pET28a-H9 HA-Ferritin and at about 84kD for pET28a-H5 HA-Ferritin, which was consistent with the expected size of the recombinant protein with His, while the uninduced recombinant expression vector did not produce the specific band, indicating that the fusion protein was successfully expressed in Escherichia coli. The expression level gradually increased 1 to 4h after the addition of IPTG, and the accumulated recombinant proteins after 5h and 4h induction were almost the same. The bacterial cells were broken by ultrasound, and a small amount of target protein was found in the supernatant and obvious target bands were found in the precipitate, indicating that the recombinant proteins His-H9 HA-Ferritin and His-H5 HA-Ferritin mainly existed in the form of insoluble inclusion bodies.

[0145] 4.2 Large-scale expression of recombinant proteins and treatment of inclusion body protein samples

[0146] Streak the strains with high expression level stored at -80℃, culture at 37℃ overnight, pick a single colony and inoculate it into 4mL LB liquid medium (50μg / mL Kan), and culture it at 37℃ overnight; transfer 1% of the bacterial solution into 200mL LB liquid medium (50μg / mL Kan), culture at 37℃ with shaking until the OD value reaches about 0.6, add IPTG (final concentration of 0.5mM), and continue to culture at 37℃ for 4h; collect the bacteria by centrifugation at 4℃, 5000rpm for 10min, wash twice with sterile ddH2O, and collect the bacteria by centrifugation. Resuspend the bacteria with lysis buffer at a dosage of 100 μL lysis buffer / mL bacterial solution, place on ice for 30 min, and disrupt and lyse the bacteria by ultrasonication on ice; centrifuge at 4°C, 12000 rpm for 10 min, discard the supernatant, and the precipitate is the recombinant protein inclusion body; resuspend and wash the precipitate with an appropriate amount of inclusion body washing solution I and inclusion body washing solution II, and discard the supernatant; resuspend the precipitate with an appropriate amount of urea NTA-0 buffer, and dissolve it overnight at 4°C.

[0147] 4.3 Purification of recombinant protein by nickel column affinity chromatography

[0148] Take the inclusion body solution dissolved overnight, centrifuge at 4°C, 12000rpm for 15min, take the supernatant, and filter with a 0.45μm membrane; purify the expressed protein with a Ni-NTA resin chromatography column, collect the eluate in urea NTA-25, urea NTA-50, urea NTA-100, urea NTA-250, urea NTA-500, 5 gradients, collect the penetration liquid and eluate, collect one NTA volume in each tube, and SDS-PAGE analysis to determine the protein binding and the distribution of the target protein in the eluate. Protein electrophoresis shows that the most protein is eluted at a concentration of 50mM imidazole, and there is also protein eluted at a concentration of 100mM, while very little is eluted at a concentration of 250mM. After SDS-PAGE electrophoresis of the purified recombinant protein, a protein band with the correct size and a single band is observed.

[0149] 5 Expression and purification of recombinant plasmids in the silkworm eukaryotic expression system

[0150] 5.1 Propagation of the Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid and preparation of viral DNA

[0151] 1×TC-100 medium was prepared according to the product instructions of AppliChem Company, the pH was adjusted to 6.22 with 2M NaOH, 10% fetal bovine serum was added to the filtered and sterilized medium, and the silkworm cells BmN were cultured at 27°C. About 50 mL of cells in the logarithmic growth phase were infected with the parent strain of Bombyx mori nuclear polyhedrosis virus. After 3 to 4 days, the virus infection fluid was collected and centrifuged at 10,000 rpm for 10 min. The precipitate was removed and the supernatant was centrifuged at 25,000 rpm for 1 hour. The supernatant was removed and the virus particle precipitate was suspended in 1 ml of virus DNA extraction solution (1 L containing Tris 12.1 g, EDTA 33.6 g, KCl 14.1 g, pH 7.5) and transferred to a 1.5 ml centrifuge tube. Proteinase K was added to a final concentration of 50 μg / ml, and the tube was incubated at 50°C for 2 hours. Then 35% Sarkorsel was added to a final concentration of 1%, and the tube was incubated at 50°C for 2 hours. The tube was extracted with equal volumes of saturated phenol, phenol:chloroform (1:1), and chloroform, respectively. The upper aqueous phase was transferred to a new tube and 1 / 10 volume of 3M NaCl, then add 2 times the volume of anhydrous ethanol, place at -20℃ for more than 2 hours to precipitate viral DNA, centrifuge at 5000rpm for 10 minutes, wash the precipitate once with 75% ethanol, freeze-dry, dissolve in 100μl TE Buffer, and store at 4℃ for later use.

[0152] 5.2 Recombinant Bombyx mori baculovirus rBmBacmid (P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin) Construction and Acquisition

[0153] Inoculate approximately 1 × 10 6 Cells at 15cm 2 In the culture flask, after the cells adhere to the wall, remove the culture medium containing fetal bovine serum (FBS), wash three times with culture medium without FBS, and add 1.5ml of culture medium without FBS. Add 1μg of Bombyx mori baculovirus parent strain BmBcmid DNA (patent number: ZL201110142492.4), 2μg of recombinant transfer plasmid pVL1393-H9HA-Ferritin, or pVL1393-H5 HA-Ferritin and 5μl of liposomes to a sterilized tube in sequence, make up the volume to 60μl with sterile double distilled water, mix gently, let stand for 15min, and then add dropwise to the culture flask for co-transfection. After culturing at 27℃ for 4h, add 1.5ml of serum-free culture medium and 300μl of FBS. Culture at 27℃ for 4-5 days, collect the supernatant for recombinant virus rBmBacmid (P PH -H9 HA-Ferritin, P PH-H5 HA-Ferritin) screening. Inoculate an appropriate amount of cells (about 70-80%) in a 35mm small dish. After the cells adhere to the wall, remove the culture medium, dilute the co-transfection supernatant at different concentrations, take 1ml of the co-transfection solution and add it to the adherent cells and distribute it evenly. After infection at 27℃ for 1h, remove the infection solution, melt the 2% low melting point agarose gel in a 60℃ water bath, cool to 40℃ and mix it evenly with the 2×TC-100 culture medium (containing 20% ​​FBS) preheated at 40℃, add 4ml of gel to each dish, seal it with Parafilm after solidification, and culture it upside down at 27℃ for 3-5d and observe it under a microscope. Select the plaques that do not contain polyhedrons, repeat the above steps, and obtain the pure recombinant silkworm baculovirus rBmBacmid (P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin).

[0154] 5.3 Recombinant virus rBmBacmid (P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin) amplification in silkworm cells

[0155] The recombinant Bombyx mori baculovirus rBmBacmid (P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin) was used to infect the normally growing BmN cells. After 3 days of culture, the supernatant was collected. The supernatant contained a large amount of recombinant virus rBmBacmid (P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin).

[0156] 5.4 Identification of recombinant viruses

[0157] The PCR method was used to analyze the integration of exogenous genes. The extraction method of free viral genomic DNA was as follows: 150 μl of viral supernatant was added with 150 μl (0.5 mol / L) of NaOH and mixed, then 20 μl (8 mol / L) of ammonium acetate was added, and then mixed, and then extracted with equal volumes of phenol and chloroform respectively, and after alcohol precipitation, the DNA was dissolved with 20 μl of TE.

[0158] 1 μl of the viral genomic DNA was taken for PCR amplification, and the reaction conditions were: 94°C denaturation for 5 min, 94°C for 1 min, 58°C for 1 min, 72°C for 3 min, 30 cycles, and finally 72°C extension for 10 min. 15 μl of the reaction product was taken for electrophoresis analysis, and the results showed that the recombinant virus was obtained.

[0159] 5.5 Expression of H9 HA-Ferritin and H5 HA-Ferritin in Silkworm Body and Pupa

[0160] The silkworm pupae used were high-expression varieties JY1 (preserved in this laboratory). JY1 varieties of silkworms were reared according to the conventional method in Chinese Sericulture edited by Lv Hongsheng (Shanghai Science and Technology Press, 1991). 48 hours after feeding, silkworms with the same average weight and 15 silkworm pupae with the same average weight after seven days of cocooning were selected. Each silkworm pupae and silkworm were inoculated with about 1.0×10 5 pfurBmBacmid(P PH -H9 HA-Ferritin, P PH -H5 HA-Ferritin), and 4-5 days later, the diseased silkworm pupae and silkworm blood were collected and stored at -20℃ for double antibody sandwich ELISA detection.

[0161] 5.6 Collection and purification of H9 HA-Ferritin and H5 HA-Ferritin virus-like particles

[0162] The silkworm pupae expressing the target gene were ground in a homogenizer with pre-cooled PBS (solid-liquid ratio of 1:9) and filtered with a 0.45 μm filter. 5 g ultra-high speed centrifugation for 2h. Use a solution containing 0.1M NaCl in Tris-HCl (pH 7.0) to redissolve the precipitate to the original volume, pass through a cation exchange chromatography medium SP (GE Company), and elute with 0.5M NaCl in Tris-HCl (pH 7.0). Then pass through molecular sieve chromatography S200 (GE Company). The purity can reach 95% and the yield can reach more than 40%. At the same time, it was proved that the target protein expressed in silkworms can self-assemble into virus-like particles at high concentrations, and a corresponding purification method for silkworms expressing genetically engineered chicken infectious bursal disease virus virus-like particle antigens has also been established. 6 Western blotting detection

[0163] The hemolymph of silkworm infected with recombinant virus was diluted 10 times with PBS (pH 7.4) and ultrasonically disrupted, and then SDS-PAGE gel electrophoresis was performed, with a concentration of 5% gel and a separation gel concentration of 15%. The protein was then transferred to a polyvinylidene fluoride (PVDF) membrane using a semi-dry transfer method, and blocked with 3% BSA prepared with PBST. The serum of mice immunized with prokaryotic expressed His-Ferritin and His-Ferritin protein was used as the primary antibody (1:1000 dilution), and HRP-labeled goat anti-mouse IgG was used as the secondary antibody (1:5000 dilution). Finally, DAB (diaminobenzidine) was used for color development, and then deionized water was used for termination. The results of Western blotting showed that specific bands of 81kDa (H9HA-Ferritin) and 84kDa (H5HA-Ferritin) could be detected in the supernatant of the hemolymph sample of silkworm infected with recombinant virus.

[0164] 7. Hemagglutination test

[0165] 7.1 Material preparation

[0166] 96-well V-shaped microplate, micropipette (equipped with a dropper); Alsevers solution, chicken red blood cell suspension (1%); pH 7.2 PBS.

[0167] 7.2 Operation Method

[0168] Add 0.025mL PBS to wells 1 to 12 of the microplate and change the dripper. Pipette 0.025mL of virus suspension into the first well and mix. Pipette 0.025mL of virus solution from the first well and add it to the second well. After mixing, pipette 0.025mL into the third well. Perform a 2-fold gradient dilution to the 11th well. Pipette 0.025mL from the 11th well and discard it. Change the dripper. Add 0.025mL PBS to each well. Set up a red blood cell control well without adding sample. Add 0.025mL of 1% chicken red blood cell suspension to each well (shake the chicken red blood cell suspension thoroughly before adding). Vortex to mix, let stand at room temperature for 20 to 40 minutes and observe the results. The red blood cells in the control well will sink to the bottom of the well in a distinct button shape.

[0169] Table 5 ELISA titer of H9 HA-Ferritin and H5 HA-Ferritin original sequence expression products

[0170] Group Potency H9 HA-Ferritin 1：1024 H5 HA-Ferritin 1：800

[0171] ELISA result determination: A P / N value (OD value of the positive well minus the OD value of the blank control well / OD value of the negative well) greater than or equal to 2.1 was considered positive. The results showed that the ELISA titers of the H9 HA-Ferritin and H5 HA-Ferritin gene expression products could reach 1:1024 and 1:800 respectively.

[0172] Table 6 Hemagglutination titer of H9 HA-Ferritin and H5 HA-Ferritin original sequence expression products

[0173] Group Potency H9 HA-Ferritin 1：2048 H5 HA-Ferritin 1：1600

[0174] Tables 5 and 6 are all experimental data measured by the expression products of the original gene sequences of H9 HA-Ferritin and H5 HA-Ferritin. Example 2 Preparation and efficacy detection of nanoparticle vaccines after consensus sequence design and optimization of the original sequences of H9 HA-Ferritin and H5 HA-Ferritin

[0175] 1. Preparation of solutions and culture media

[0176] The specific method for preparing the solution and culture medium is shown in Example 1.

[0177] 2 Gene acquisition of the conservative sequence of influenza virus hemagglutinin protein

[0178] The present invention compares the original amino acid sequence of influenza virus hemagglutinin protein in Example 1 with 20 other hemagglutinin amino acid sequences obtained from NCBI to obtain a consensus sequence. This consensus sequence is optimized and further optimized using OptimumGene TM The technology optimizes the amino acid sequence of H5 and H9 hemagglutinin proteins, transforms the amino acid sequence of the optimized hemagglutinin protein amino acid sequence and the ferritin monomer subunit amino acid sequence according to the codon preference of silkworm, optimizes and designs various related parameters such as GC content, CpG dinucleotide content, codon preference, secondary structure of mRNA, mRNA free energy stability, RNA instability gene sequence, and repeat sequence that affect gene transcription efficiency, translation efficiency, and protein folding, and keeps the final translated protein sequence unchanged. Named H9 HA-Ferritin-CO (SEQ ID NO.11) and H5 HA-Ferritin-CO (SEQ ID NO.13), the specific optimization process is shown in Example 1.

[0179] 3. Construction of fusion protein plasmid

[0180] See Example 1 for the specific experimental method.

[0181] H9 HA-Ferritin-CO fusion PCR primers:

[0182] H9 HA hemagglutinin extracellular domain PCR primers:

[0183] F9:CGGGATCCAACATGGAAGTAGTAAGTCTGATAACC

[0184] R9:TTGATGATGTCGCCACCGGAAATCTTGTATGTACCCTCGCTTTC

[0185] Ferritin PCR Primers:

[0186] F10: GAAAGCGAGGGTACATACAAGATTTCCGGTGGCGACATCATCAA

[0187] R10: GAATTCTTAGCTCTTGCGGGACTTGG

[0188] Over-lapPCR primers:

[0189] F9: CGGGATCCAACATGGAAGTAGTAAGTCTGATAACC

[0190] R10: GAATTCTTAGCTCTTGCGGGACTTGG

[0191] H5 HA-Ferritin-CO fusion PCR primers:

[0192] H5 HA hemagglutinin extracellular domain PCR primers:

[0193] F11:CGGGATCCAACATGGAAAAAATCGTGCTGCTG

[0194] R11:GGTATTTACCAGATCCTGTCCATTTCCGGTGGCGACATCATCAAGCTG

[0195] Ferritin PCR Primers:

[0196] F12: CAGCTTGATGATGTCGCCACCGGAAATGGACAGGATCTTGGTAAATACC

[0197] R12: CGGAATTCTTAGCTCTTGCGGGACTTGGCGAT

[0198] Over-lapPCR primers:

[0199] F11: CGGGATCCAACATGGAAAAAATCGTGCTGCTG

[0200] R12: CGGAATTCTTAGCTCTTGCGGGACTTGGCGAT

[0201] 3.1 Ligation and transformation of target gene and pVL1393 vector

[0202] 3.2 Rapid nucleic acid extraction method to screen positive clones

[0203] The specific experimental method is shown in Example 1.

[0204] 3.3 Extraction of plasmid DNA by SDS alkaline lysis method

[0205] The specific experimental method is shown in Example 1.

[0206] 3.4 Restriction digestion and sequencing of positive clones

[0207] The specific experimental method is shown in Example 1.

[0208] 4 Expression and purification of recombinant plasmids pVL1393-H9 HA-Ferritin-CO and pVL1393-H5 HA-Ferritin-CO in the silkworm expression system

[0209] 4.1 Propagation of the Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid and preparation of viral DNA

[0210] See Example 1 for the specific experimental method.

[0211] 4.2 Construction and acquisition of recombinant silkworm baculovirus rBmBacmid

[0212] See Example 1 for the specific experimental method.

[0213] 4.3 Amplification of recombinant rBmBacmid virus in silkworm cells

[0214] See Example 1 for the specific experimental method.

[0215] 4.4 Identification of recombinant viruses

[0216] See Example 1 for the specific experimental method.

[0217] 4.5 Expression of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO in Silkworm Body and Pupa

[0218] See Example 1 for the specific experimental method.

[0219] 4.6 Collection and purification of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO virus-like particles

[0220] See Example 1 for the specific experimental method.

[0221] 5. Western blotting

[0222] See Example 1 for the specific experimental method.

[0223] 6. Hemagglutination test

[0224] See Example 1 for the specific experimental method.

[0225] 7. Result Identification

[0226] Table 7 ELISA titers of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO gene expression products

[0227] Group Potency H9 HA-Ferritin 1：1024 H5 HA-Ferritin 1：800 H9 HA-Ferritin-CO 1：1600 H5 HA-Ferritin-CO 1：1600

[0228] ELISA result determination: A P / N value (OD value of the positive well minus the OD value of the blank control well / OD value of the negative well) greater than or equal to 2.1 was considered positive. The results showed that the ELISA titer of the H9 HA-Ferritin-CO and H5 HA-Ferritin-CO gene expression products could reach 1:1600.

[0229] Table 8 Hemagglutination titer of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO gene expression products

[0230] Group Potency H9 HA-Ferritin 1：2048 H5 HA-Ferritin 1：1600 H9 HA-Ferritin-CO 1：3200 H5 HA-Ferritin-CO 1：3200

[0231] From the results in Table 7 and Table 8, it can be seen that the expression level of the consensus sequence after codon optimization has been greatly improved, indicating that the transformation and optimization work of this example is successful.

[0232] Example 3 Preparation and efficacy testing of nanoparticle vaccines after amino acid single-site mutation of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO mutants

[0233] 1 Experimental methods

[0234] 1.1 Construction of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO amino acid sequence single site mutant genes Based on the results of Example 2, the present invention obtained H9 HA-Ferritin-C and H5 HA-Ferritin-C mutants. Using the codon-optimized gene sequences of H9 HA-Ferritin-C and H5 HA-Ferritin-C mutants as templates, multiple pairs of primers were designed to perform site-directed mutagenesis on the conserved sequences. The site-directed mutagenesis was performed using the fusion PCR method. The fusion PCR method is shown in Example 1.

[0235] The mutation sites are H9: N40S, N41D, A47T, L51I, M58I, G63N, P83L, P101S, T138K, E181G, N191H, H192Q, D196E, T197A, G236R, I267V, Q304H, D367N, N419S, V469M; H5: V40I, K51R, T52A, K56R, S72R, N100S, H126R, G155E, E186K, D187N, V190I, L191M, G193W, I242M, N289Y, N325S, Y366F, E406G, D462E or Q501H. The obtained mutants were named H9 HA-Ferritin-COM (N40S, N41D, A47T, L51I, M58I, G63N, P83L, P101S, T138K, E181G, N191H, H192Q, D196E, T197A, G236R, I267V, Q304H, D367N, N419S, V469M), H5 HA-Ferritin-COM(V40I, K51R, T52A, K56R, S72R, N100S, H126R, G155E, E186K, D 187N, V190I, L191M, G193W, I242M, N289Y, N325S, Y366F, E406G, D462E, Q501H).

[0236] Primers required for amino acid single-site mutation of H9 HA-Ferritin-CO and H5 HA-Ferritin-CO:

[0237] H9 HA-Ferritin-CO:

[0238] (1) Upstream and downstream primers on both sides:

[0239] F: CGGGATCCAACATGGAAGTAGTAAGTCTGATAACC

[0240] R: CGGAATTCTTAGCTCTTGCGGGACTTGGCG

[0241] (2) Middle upstream and downstream primers: 1.

[0243] F: GGACACGCTGACAGAG AGT AATGTGCCGGTTAC

[0244] R: GTAACCGGCACATT ACT CTCTGTCAGCGTGTCC 2.

[0246] F: CTGACAGAGAAC GAT GTGCCGGTTACTCACGC

[0247] R: GCGTGAGTAACCGGCAC ATC GTTCTCTGTCAG 3.

[0249] F: CCGGTTACTCAC ACC AAAGAACTGTTGCACACC

[0250] R: GGTGTGCAACAGTTCTTT GGT GTGAGTAACCGG 4.

[0252] F: AAAGAACTG ATA CACACCGAGCATAACGGTATGC

[0253] R: GCATACCGTTATGCTCGGTGTG TAT CAGTTCTTT 5.

[0255] F: CGAGCATAACGGT ATA CTCTGCGCCACTGGTTTAG

[0256] R: CTAAACCAGTGGCGCAGAG TAT ACCGTTATGCTCG 6.

[0258] F: CTCTGCGCCACT AAT TTAGGACATCCTCTTATCCTG

[0259] R:CAGGATAAGAGGATGTCCTAA TTA AGTGGCGCAGAG 7.

[0261] F:GTTTAATTTACGGAAAC TTG TCCTGTGATCTCTTAC

[0262] R:GTAAGAGATCACAGGA CAA GTTTCCGTAAATTAAAC 8.

[0264] F:CATTGTGGAGAGG AGT TCTGCTGTTAATGGAC

[0265] R:GTCCATTAACAGCAGA ACT CCTCTCCACAATG 9.

[0267] F:CAAATCTTCCCTGAC AAG ATATGGAACGTAAC

[0268] R:GTTACGTTCCATAT CTT GTCAGGGAAGATTTG 10.

[0270] F:CCAACAATCAG GGT AAGAACATCCTTTTTATG

[0271] R:CATAAAAAGGATGTTCTT ACC CTGATTGTTCC 11.

[0273] F:GTGGGGAATT CAC CACCCTCCAACGGACACAG

[0274] R:CTGTGTCCGTTGGAGGGTG GTG AATTCCCCAC 12.

[0276] F:CTTTTTATGTGGGGAATTAAT CAA CCTCCAACGG

[0277] R:CCGTTGGAGG TTG ATTAATTCCCCACATAAAAAG 13.

[0279] F:CACCCTCCAACG GAA ACAGTCCAAACTAATCTGTAC

[0280] R:GTACAGATTAGTTTGGACTGT TTC CGTTGGAGGGTG 14.

[0282] F:CACCCTCCAACGGAC GCT GTCCAAACTAATCTG

[0283] R:CAGATTAGTTTGGAC AGC GTCCGTTGGAGGGTG 15.

[0285] F:GGTGAATGGTCTCCAA CGC AGAATTGACTAC

[0286] R:GTAGTCAATTCT GCG TTGGAGACCATTCACC 16.

[0288] F:CCTGGTACGGCCAC GTA CTTTCGGGCGAAAGTC

[0289] R:GACTTTCGCCCGAAAG TAC GTGGCCGTACCAGG 17.

[0291] F:GACATTGCCGTTC CAC AATGTATCCAAATACG

[0292] R:CGTATTTGGATACATT GTG GAACGGCAATGTC 18.

[0294] F:CAACACTCTAAC AAT CAGGGCGTTGGTATG

[0295] R:CATACCAACGCCCTG ATT GTTAGAGTGTTG 19.

[0297] F:GACTGAACATGATC AGT AACAAAATCGAC

[0298] R:GTCGATTTTGTT ACT GATCATGTTCAGTC 20.

[0300] F:GATCGAACGCG ATG GAAGACGGAAAAGG

[0301] R:CCTTTTCCGTCTTC CAT CGCGTTCGATC

[0302] H5 HA-Ferritin-CO:

[0303] (1) Upstream and downstream primers on both sides:

[0304] F: CGGGATCCAACATGGAAAAAATCGTGCTGCTGTTCGC

[0305] R: CGGAATTCTTAGCTCTTGCGGGACTTGGCG

[0306] (2) Middle upstream and downstream primers: 1.

[0308] F:CCATTATGGAGAAGAAC ATT ACTGTGACCCACGC

[0309] R:GCGTGGGTCACAGT AAT GTTCTTCTCCATAATGG 2.

[0311] F:GGACATCCTGGAG CGC ACACATAACGGCAAG

[0312] R:CTTGCCGTTATGT GTG CGCTCCAGGATGTCC 3.

[0314] F:GGACATCCTGGAGAAA GCT CATAACGGCAAGC

[0315] R:GCTTGCCGTTATG AGC TTTCTCCAGGATGTCC 4.

[0317] F:GAAAACACATAACGGC CGC CTGTGCGATC

[0318] R:GATCGCACAG GCG GCCGTTATGTGTTTTC 5.

[0320] F:GATCCTGAAGGACTGC CGC GTGGCAGGC

[0321] R:GCCTGCCAC GCG GCAGTCCTTCAGGATC 6.

[0323] F:GTGGAGAAAGCC AGT CCTGCTAATGATCTGTGC

[0324] R:GCACAGATCATTAGCAGG ACT GGCTTTCTCCAC 7.

[0326] F:GTCCAGAATCAAC CGC TTCGAAAAGATCC

[0327] R:GGATCTTTTCGAA GCG GTTGATTCTGGAC 8.

[0329] F:CGCTTGTCCATACCAG GAA AACAGCTCCTTC

[0330] R:GAAGGAGCTGTTTTCCTGGTATGGACAAGCG 9.

[0332] F:CAACACCAACCAG AAA GATCTGCTGGTG

[0333] R:CACCAGCAGATC TTT CTGGTTGGTGTTG 10.

[0335] F:CAACACCAACCAGGAG AAC CTGCTGGTGCTGTG

[0336] R:CACAGCACCAGCAG GTTCTCCTGGTTGGTGTTG 11.

[0338] F:GGAGGATCTGCTG ATT CTGTGGGGAATC

[0339] R:GATTCCCCACAG AAT CAGCAGATCCTCC 12.

[0341] F:GAGGATCTGCTGGTG ATG TGGGGAATCCACC

[0342] R:GGTGGATTCCCCA CAT CACCAGCAGATCCTC 13.

[0344] F:GGTGCTGTGG TGG ATCCACCATCCAAACG

[0345] R:CGTTTGGATGGTGGAT CCA CCACAGCACC 14.

[0347] F:CCAGTCTGGACGG ATG GATTTCTTTTGG

[0348] R:CCAAAAGAAATCCATCCGTCCAGACTGG 15.

[0350] F:GGTGGAATACGGG TAC TGCAATACCCGCTGTC

[0351] R:GACAGCGGGTATTGCA GTA CCCGTATTCCACC 16.

[0353] F:GTGAAAAGC AGT AAGCTGGTGCTGGCTAC

[0354] R:GTAGCCAGCACCAGCTT ACT GCTTTTCAC 17.

[0356] F:GTGGATGGGTGGGTACGGT TTC CACCATAGTAAC

[0357] R: GTTACTATGGTG GAA ACCGTACCACCCATCCAC 18.

[0359] F:GAACACCCAGTTC GGT GCTGTGGGGAGG

[0360] R:CCTCCCCACAGC ACC GAACTGGGTGTTC 19.

[0362] F:GAAAAATCTGTAT GAA AAAGTGAGGCTCC

[0363] R:GGAGCCTCACTTT TTC ATACAGATTTTTC 20.

[0365] F:GGCACTTACGAC CAC CCTCAGTATTCAGAGGR: CCTCTGAATACTGAGG GTG GTCGTAAGTGCC

[0366] Plasmid construction of 2H9 HA-Ferritin-COM and H5 HA-Ferritin-COM mutants

[0367] See Example 1 for the specific experimental method.

[0368] 3. Transformation and identification of recombinant plasmid

[0369] See Example 1 for the specific experimental method.

[0370] 4 Expression and purification of recombinant plasmids in silkworm expression system

[0371] 4.1 Propagation of the Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid and preparation of viral DNA

[0372] The specific method is the same as that of Example 1.

[0373] 4.2 Construction and acquisition of recombinant silkworm baculovirus

[0374] The specific method is the same as that of Example 1.

[0375] 4.3 Amplification of recombinant rBmBacmid virus in silkworm cells

[0376] See Example 1 for the specific experimental method.

[0377] 4.4 Identification of recombinant viruses

[0378] See Example 1 for the specific experimental method.

[0379] 4.5 The specific method for expressing H9 HA-Ferritin-COM and H5 HA-Ferritin-COM mutant genes in silkworm bodies and silkworm pupae is the same as that in Example 1.

[0380] 4.6 Collection and purification of H9 HA-Ferritin-COM and H5 HA-Ferritin-COM virus-like particles

[0381] The specific method is the same as that of Example 1.

[0382] 5. Western blotting detection

[0383] See Example 1 for the specific experimental method.

[0384] 6. Hemagglutination test

[0385] See Example 1 for the specific experimental method.

[0386] 7. Result Identification

[0387] Table 9 ELISA titers of H9 HA-Ferritin-COM and H5 HA-Ferritin-CM mutant expression products

[0388]

[0389]

[0390] ELISA result judgment standard: P / N value (positive well OD value minus blank control well OD value / negative well OD value) greater than or equal to 2.1 is positive. Although the highest ELISA value is about 3200, because this experiment uses threshold and dilution multiple as quantitative indicators, the specific sample amount is different due to the size of the P / N value; the same hemagglutination is also double dilution, the time when the hemagglutination phenomenon can be determined is also different, although the hemagglutination value is the same, it does not mean that the content is completely consistent. Similar phenomena also exist in the following experiments and are not explained one by one.

[0391] Table 10 Hemagglutination titer of H9 HA-Ferritin-COM and H5 HA-Ferritin-COM mutant expression products

[0392]

[0393]

[0394] From the data in Tables 9 and 10, it can be seen that based on the consensus sequence (SEQ ID NO.11), amino acid single-point mutations were performed, and the expression levels of the expression products of six single mutants (N40S, N41D, A47T, N191H, H192Q, and D196E) obtained were significantly improved compared with the expression levels of the consensus sequence.

[0395] From the data in Tables 9 and 10, it can be seen that based on the consensus sequence (SEQ ID NO.13), amino acid single-point mutations were performed, and the expression levels of the expression products of six single mutants (V40I, K51R, K56R, V190I, L191M, G193W) obtained were significantly improved compared with the expression levels of the consensus sequence.

[0396] Example 4 Preparation and efficacy testing of nanoparticle vaccines after double amino acid mutation of H9 HA-Ferritin-COM and H5 HA-Ferritin-COM

[0397] In view of the results of Example 3, it was determined that the mutations at some sites were effective mutations, which could achieve the purpose of increasing the expression of H9HA-Ferritin-COM and H5HA-Ferritin-COM mutants. Considering that the order of amino acids is the primary structure of the protein and determines the higher-order structure of the protein, and that the positions of some mutation sites in the amino acid single-site mutations performed in Example 3 may be interrelated, an attempt was made to perform amino acid double-site mutations. The present invention combines the single mutation sites H9 HA: N40S, N41D, A47T, N191H, H192Q, or D196E; H5 HA: V40I, K51R, K56R, V190I, L191M or G193W that can increase the expression amount in pairs to perform double-site mutation. The double-site mutation is based on the single-site mutation sequence obtained in Example 3, using it (H9 HA-Ferritin-COM, H5 HA-Ferritin-COM) as a template, using corresponding primers, and performing a second site-directed mutation by a fusion PCR method to obtain a double-site mutation target fragment. The fusion PCR method is shown in Example 1.

[0398] There were 15 combinations of double mutation sites in H9 HA: N40S-N41D, N40S-A47T, N40S-N191T, N40S-H192Q, N40S-D196E, N41D-A47T, N41D-N191H, N41D-H192Q, N41D-D196E, A47T-N191H, A47T-H192Q, A47T-D196E, N191H-H192Q, N191H-D196E, or H192Q-D196E. The mutants obtained were named H 9HA-Ferritin-COD (N40S-N41D, N40S-A47T, N40S-N191T, N40S-H192Q, N40S-D196E, N41D-A47T, N41D-N191H, N 41D-H192Q, N41D-D196E, A47T-N191H, A47T-H192Q, A47T-D196E, N191H-H192Q, N191H-D196E or H192Q-D196E), H5 HA-Ferritin-COD (V40I-K51R, V40I-K56R, V40I-V190I, V40I-L191M, V40I-G193W, K51R-K56R, K51R-V190I, K51R-L191M, K51R-G193W, K56R-V190I, K56R-L191M, K56R-G193W, V190I-L191M, V190I-G193W or L191M-G193W) mutants.

[0399] The double-site mutations of some amino acids in H9 HA-Ferritin-CO and H5 HA-Ferritin-CO are close to each other.

[0400] In order to avoid repeated mutations, additional primers are required as follows:

[0401] H9 HA-Ferritin-COD:

[0402] N40S-N41D:

[0403] F:GGACACGCTGACAGAG AGTGAT GTGCCGGTTAC

[0404] R:GTAACCGGCAC ATCACT CTCTGTCAGCGTGTCC

[0405] N191-H192Q

[0406] F:GTGGGGAATT CACCAACCTCCAACGGACACAG

[0407] R:CTGTGTCCGTTGGAGG TTGGTG AATTCCCCAC

[0408] H192Q-D196E

[0409] F:GAATTAAT CAA CCTCCAACG GAA ACAGTCCAAACTAATCTG

[0410] R:CAGATTAGTTTGGACTGT TTC CGTTGGAGG TTG ATTAATTC

[0411] H5 HA-Ferritin-C-O-D:

[0412] K51R-K56R:

[0413] F:GGACATCCTGGAG CGC ACACATAACGGC CGC CTGTGCGATCTG

[0414] R:CAGATCGCACAG GCG GCCGTTATGTGT GCG CTCCAGGATGTCC

[0415] V190I-L191M:

[0416] F:CAACCAGGAGGATCTGCTG ATTATG TGGGGAATCCACCATCC

[0417] R:GGATGGTGGATTCCCCA CATAAT CAGCAGATCCTCCTGGTTG

[0418] V190I-G193W:

[0419] F:CAGGAGGATCTGCTG ATT CTGTGG TGG ATCCACCATCCAAAC

[0420] R:GTTTGGATGGTGGAT CCA CCACAG AAT CAGCAGATCCTCCTG

[0421] L191M-G193W:

[0422] F:GAGGATCTGCTGGTG ATG TGG TGG ATCCACCATCC

[0423] R: GGATGGTGGAT CCA CCA CAT CACCAGCAGATCCTC

[0424] 1. Preparation of solutions and culture media

[0425] The preparation method of the solution and culture medium is the same as that in Example 1.

[0426] Plasmid construction of 2H9 HA-Ferritin-COD and H5 HA-Ferritin-COD mutants

[0427] See Example 1 for the specific experimental method.

[0428] 3. Transformation and identification of recombinant plasmid

[0429] See Example 1 for the specific experimental method.

[0430] 4 Expression and purification of recombinant plasmids pVL1393-H9 HA-Ferritin-COD and pVL1393-H5 HA-Ferritin-COD in the silkworm expression system

[0431] 4.1 Propagation of the Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid and preparation of viral DNA

[0432] The specific method is the same as that of Example 1.

[0433] 4.2 Construction and acquisition of recombinant silkworm baculovirus rBmBacmid

[0434] The specific method is the same as that of Example 1.

[0435] After 2-3 rounds of purification, pure recombinant silkworm baculovirus rBmBacmid (P PH -H9 HA-Ferritin-COD, P PH -H5 HA-Ferritin-COD).

[0436] 4.3 Recombinant virus rBmBacmid (P PH -H9 HA-Ferritin-COD, P PH -H5 HA-Ferritin-COD) amplification in silkworm cells

[0437] The recombinant Bombyx mori baculovirus rBmBacmid (P PH -H9 HA-Ferritin-COD, P PH -H5HA-Ferritin-COD) was used to infect the normally growing BmN cells, and the supernatant was collected after 3 days of culture. The supernatant contained a large amount of recombinant virus rBmBacmid (P PH -H9 HA-Ferritin-COD, P PH -H5 HA-Ferritin-COD).

[0438] 4.4 Identification of recombinant viruses

[0439] The specific method is the same as that of Example 1.

[0440] 4.5 Expression of H9 HA-Ferritin-COD and H5 HA-Ferritin-COD in Silkworm Body and Pupa

[0441] The specific method is the same as that of Example 1.

[0442] 4.6 Collection and purification of H9 HA-Ferritin-COD and H5 HA-Ferritin-COD virus-like particles

[0443] The specific method is the same as that of Example 1.

[0444] 5. Western blotting detection

[0445] The specific experimental method is the same as that in Example 1.

[0446] 6. Hemagglutination test

[0447] The specific experimental method is the same as that in Example 1.

[0448] 7. Result Identification

[0449] Table 11 ELISA titers of H9 HA-Ferritin-COD and H5 HA-Ferritin-COD mutant expression products

[0450]

[0451]

[0452] Table 12 Hemagglutination titer determination of H9 HA-Ferritin-COD and H5 HA-Ferritin-COD mutant expression products

[0453]

[0454]

[0455] From the data in Tables 11 and 12, it can be seen that among the consensus sequence amino acid double-site mutations, the mutants obtained by performing amino acid double-site mutations on the basis of the consensus sequence (SEQ ID NO.11) have three double mutants (N40S-N41D, N41D-A47T, A47T-H192Q) whose expression levels are significantly improved compared with the expression level of the consensus sequence.

[0456] From the data in Tables 11 and 12, it can be seen that based on the consensus sequence (SEQ ID NO. 13), double-site amino acid mutations were performed, and the expression levels of the resulting mutants, including three double mutants (V40I-K51R, K51R-V190I or V190I-G193W), were significantly improved compared with the expression levels of the consensus sequence.

[0457] Example 5 Preparation and efficacy testing of nanoparticle vaccines after amino acid multi-site mutation of H9 HA-Ferritin-COD and H5 HA-Ferritin-COD

[0458] Based on the results of Example 4, considering that the order of amino acid arrangement is the primary structure of the protein and determines the higher-level structure of the protein, it is speculated that the amino acid single-site mutation may be due to the positions of some mutation points being close to each other and related to each other, so amino acid multi-site mutation is attempted. The present invention analyzes the glycosylation site and obtains that 6 single mutation sites can effectively increase the expression of the target gene. Therefore, the multi-site mutation is based on the double-site mutation sequence obtained in Example 4, using (H9 HA-Ferritin-COD, H5 HA-Ferritin-COD) as a template, using corresponding primers, and performing mutations at multiple mutation sites by fusion PCR, thereby obtaining the target fragment of multi-site mutation. The fusion PCR method is shown in Example 1.

[0459] In order to avoid repeated mutations of multiple mutations during the PCR process, two additional pairs of primers were set:

[0460] H9 HA-Ferritin-CO-M6 D196E:

[0461] F:TCACCACCCTCCAACG GAA ACAGTCCAAACTAATC

[0462] R:GATTAGTTTGGACTGT TTC CGTTGGAGGGTGGTGA

[0463] H5 HA-Ferritin-CO-M6 G193W:

[0464] F:GATCTGCTGATTATGTGG TGG ATCCACCATCCAAAC

[0465] R:GTTTGGATGGTGGAT CCA CCACATAATCAGCAGATC

[0466] The following two combinations were obtained: H9 HA (N40S-N41D-A47T-N191H-H192Q-D196E); H5 HA (V40I-K51R-K56R-V190I-L191M-G193W), named H9HA-Ferritin-CO-M6 (N40S-N41D-A47T-N191H-H192Q-D196E) and H5HA-Ferritin-CO-M6 (V40I-K51R-K56R-V190I-L191M-G193W).

[0467] H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 were expressed in the silkworm eukaryotic expression system and AcMNPV-insect cell expression system.

[0468] Plasmid construction of 1H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 mutants

[0469] See Example 1 for the specific experimental method.

[0470] 2 Transformation and identification of recombinant plasmid

[0471] The specific method is the same as that of Example 1.

[0472] 3 Expression and purification of recombinant plasmids in silkworm expression system and AcMNPV-insect cell expression system

[0473] 3.1 Propagation of viral parent strains and preparation of viral DNA

[0474] 3.1.1 Propagation of the Bombyx mori nuclear polyhedrosis virus parent strain BmBacmid and preparation of viral DNA

[0475] The specific method is the same as that of Example 1.

[0476] 3.1.2 Construction and preparation of AcBacmid DNA

[0477] Prepared according to the following method (Zhang Zhifang, Li Yinv, Yi Yongzhu, et al. Insect bioreactor expressing multiple exogenous genes and its construction method and application [P]. China: CN102286534A, 2011.):

[0478] The recombinant viral DNA containing the target gene was prepared as follows: 1×TC-100 medium was prepared according to the product instructions of AppliChem, the pH was adjusted to 6.22 with 2M NaOH, 10% fetal bovine serum was added to the filtered and sterilized medium, and Sf-9 cells were cultured at 27°C. About 5 mL of cells in the logarithmic growth phase were infected with the recombinant AcBacmid virus containing the target gene. After 3 to 4 days, the virus infection fluid was collected and centrifuged at 10,000 rpm for 10 min. The precipitate was removed and the supernatant was centrifuged at 25,000 rpm for 1 hour. The supernatant was removed and the virus particle precipitate was suspended with 1 ml of virus DNA extraction solution (1 L containing Tris 12.1 g, EDTA 33.6 g, KCl 14.1 g, pH 7.5). The virus particle precipitate was transferred to a 1.5 ml centrifuge tube, and proteinase K was added to a final concentration of 50 μg / ml. The tube was incubated at 50°C for 2 hours, and then 35% Sarkorsel was added to a final concentration of 1%. The tube was incubated at 50°C for 2 hours, and then the tube was extracted with equal volumes of saturated phenol, phenol:chloroform (1:1), and chloroform. The upper aqueous phase was transferred to a new tube and 1 / 10 volume of 3M NaCl, then add 2 times the volume of anhydrous ethanol, place at -20℃ for more than 2 hours to precipitate viral DNA, centrifuge at 5000rpm for 10 minutes, wash the precipitate once with 75% ethanol, freeze-dry, dissolve in 100μl TE Buffer, and store at 4℃ for later use.

[0479] 3.2 Construction and acquisition of recombinant baculovirus

[0480] 3.2.1 Construction and acquisition of recombinant silkworm baculovirus rBmBacmid

[0481] The specific method is the same as that of Example 1.

[0482] 3.2.2 Construction and acquisition of recombinant baculovirus rAcBacmid

[0483] Inoculate about 0.5 to 1×10 6 Sf-9 cells in 15 cm 2In a culture flask, adhere to the wall and culture overnight. Remove the medium containing FBS, wash the cells three times with serum-free medium, and then add 1.5 ml of serum-free medium. Add 1 μg AcBcmid DNA, 2 μg recombinant transfer plasmid pVL1393-H9 HA-Ferritin, or pVL1393-H5 HA-Ferritin and 5 μl liposomes to a sterilized tube in sequence, make up the volume to 60 μl with sterile double distilled water, mix gently, let stand for 15 minutes, and then add dropwise to the culture flask for co-transfection. After culturing at 27°C for 4 hours, add 1.5 ml of serum-free medium and 300 μl FBS. Culture at 27°C for 4 to 5 days, and collect the supernatant for screening of recombinant virus rAcBacmid. Inoculate an appropriate amount of Sf-9 cells (about 70-80%) in a 35mm small dish. After the cells adhere to the wall, remove the culture medium, dilute the co-transfection supernatant at different concentrations, take 1ml of the co-transfection solution and add it to the adherent cells and distribute it evenly. After infection at 27℃ for 1h, remove the infection solution, melt the 2% low melting point agarose gel in a 60℃ water bath, cool to 40℃ and mix it evenly with the 40℃ preheated 2×TC-100 culture medium (containing 20% ​​FBS), add 4ml of gel to each dish, seal it with Parafilm after solidification, invert and culture at 27℃ for 3-5d, and observe under a microscope. Select the plaques without polyhedrons, repeat the above steps, and obtain pure recombinant baculovirus rAcBacmid-H9 HA-Ferritin-CO-M6 and rAcBacmid-H5 HA-Ferritin-CO-M6 after 2-3 rounds of purification.

[0484] 3.3 Recombinant virus amplification in cells

[0485] 3.3.1 Amplification of recombinant virus rBmBacmid in silkworm cells

[0486] The specific method is the same as that of Example 1.

[0487] 3.3.2 Amplification of recombinant virus rAcBacmid in insect Sf-9 cells

[0488] The above-mentioned recombinant silkworm baculovirus rAcBacmid-H9 HA-Ferritin-CO-M6 and rAcBacmid-H5HA-Ferritin-CO-M6 were used to infect normally growing Sf-9 cells. After 96 hours of culture, the infected cells were collected and the supernatant contained a large amount of recombinant viruses rAcBacmid-H9 HA-Ferritin-CO-M6 and rAcBacmid-H5HA-Ferritin-CO-M6.

[0489] 3.4 Identification of recombinant virus rBmBacmid

[0490] The specific method is the same as that of Example 1.

[0491] 3.5 Expression of target genes in silkworms and silkworm pupae

[0492] The specific method is the same as that of Example 1.

[0493] 3.6 Identification of recombinant virus rAcBacmid and expression in insect Hi5 cells

[0494] PCR was used to analyze the integration of foreign genes. Viral genomic DNA was extracted.

[0495] 1 μl of the viral genomic DNA was taken for PCR amplification, and 15 μl of the reaction product was analyzed by electrophoresis. The results showed that the recombinant viruses rAcBacmid-H9 HA-Ferritin-CO-M6 and rAcBacmid-H5 HA-Ferritin-CO-M6 were obtained.

[0496] The culture medium of the above recombinant viruses rAcBacmid-H9 HA-Ferritin-CO-M6 and rAcBacmid-H5HA-Ferritin-CO-M6 was heated to 10 6-7 pfu were used to infect 100 ml of Hi5 cells, and the infected cells were collected 96 h later and stored at -20°C for ELISA testing.

[0497] 3.7 Collection and purification of virus-like particles of target gene expression products

[0498] The specific method is the same as that of Example 1.

[0499] 4. Result Identification

[0500] Table 13 ELISA detection of expression products of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 mutants in silkworm and AcMNPV-insect cell expression systems

[0501] Group Potency H9 HA-Ferritin-COD 1：6400 H5 HA-Ferritin-COD 1：6400 <![CDATA[H9 HA-Ferritin-C-O-M6(Silkworm)]]> 1：12800 <![CDATA[H5 HA-Ferritin-C-O-M6(Silkworm)]]> 1：12800 <![CDATA[AcH9 HA-Ferritin-C-O-M6(AcMNPV - insect cells)]]> 1：1280 <![CDATA[AcH5 HA-Ferritin-C-O-M6(AcMNPV-Insect cells)]]> 1：1280

[0502] ELISA result determination: A P / N value (OD value of the positive well minus the OD value of the blank control well / OD value of the negative well) greater than or equal to 2.1 was considered positive; the results showed that the ELISA titer of the H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 gene expression products could reach 1:12800.

[0503] The ELISA values ​​of the expression products of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 mutants in the AcMNPV-insect cell expression system represent the expression amount per milliliter of insect cells. The same is true for hemagglutination titer.

[0504] Table 14 Hemagglutination assay of the expression products of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 mutants in silkworm and AcMNPV-insect cell expression systems

[0505] Group Potency H9 HA-Ferritin-COD 1：12800 H5 HA-Ferritin-COD 1：12800 <![CDATA[H9 HA-Ferritin-C-O-M6(Silkworm)]]> 1：51200 <![CDATA[H5 HA-Ferritin-C-O-M6(Silkworm)]]> 1：32768 <![CDATA[AcH9 HA-Ferritin-C-O-M6(AcMNPV-Insect cells)]]> 1：5120 <![CDATA[AcH5 HA-Ferritin-C-O-M6(AcMNPV-Insect cells)]]> 1：2560

[0506] From the data in Tables 13 and 14, it can be seen that the expression levels of the mutants obtained by performing multiple mutations in the amino acid sites of the consensus sequence of the fusion protein are significantly improved compared with the expression levels of the above-mentioned single mutants, double mutants, etc.

[0507] 5. Western Blotting

[0508] The specific method is the same as that in Example 1. The results of Western blotting showed that specific bands of 81 kDa (H9 HA-Ferritin) and 84 kDa (H5 HA-Ferritin) could be detected in the supernatant of the silkworm hemolymph sample after infection with the recombinant virus (see Figure 4 and Figure 5 ).

[0509] 6 Electron microscopy observation

[0510] Use a 1ml syringe to absorb a certain amount of 1% uranyl acetate for standby use, and use another syringe to absorb a certain amount of distilled water. After the H9HA-Ferritin-CO-M6 or H5 HA-Ferritin-CO-M6 nanoparticles silkworm hemolymph are initially purified, diluted with a suspension, and the suspended sample is dropped on the sealing film to form a small liquid bead. Use the tip of tweezers to clamp the carrier grid with the membrane side facing down, dip the sample, and then use filter paper to absorb it, and then wash away the excess suspended matter, and wash it 5 times. After absorbing it, place the carrier grid on a drop of 1% uranyl acetate dye solution, stain it for 3 minutes, use filter paper to absorb the excess dye from the edge of the copper grid, repeat 2-3 times, and examine it under a microscope after it is dried. The results are as follows Figure 6 As shown, the nanoparticles are of the expected size, with the diameter of the cage being about 12 nanometers, and antenna-like protrusions can be seen upon closer inspection.

[0511] Example 6 Construction of pVLCAG-H9 HA-Ferritin-CO-M6 and pVLCAG-H5 HA-Ferritin-CO-M6 Recombinant Viruses for Mammalian Expression and Animal Experiments

[0512] 1 Construction of pVLCAG vector

[0513] The upstream of the multiple cloning restriction site of the pVL1393 vector is a polyhedron gene promoter (Pph), and the upstream of the promoter is an EcoR V restriction site. The first restriction site of the downstream multiple cloning restriction site is BamH I. These two restriction sites are used to cut Pph and connect to the CAG promoter. The source of the CAG promoter is the pCAGGS vector. The SV40-polyA terminator comes from the pEGFP-N3 vector. The upstream and downstream PCR primers of the CAG promoter are designed. CAG-1F is the upstream primer, plus a HincII restriction site, and CAG-1R is the downstream primer, plus an EcoR I restriction site. The CAG promoter is amplified using the pCAGGS vector as a template and connected to the pMD18T vector. After sequencing verification, it is recovered by double restriction digestion with HincII and EcoR I. Since HincII digestion results in a blunt end, the recovered CAG promoter was connected to the vector digested with EcoR V and BamH I, screened on an Amp-resistant LB plate, digested and identified, and finally sequenced to obtain the pVL1393 vector connected to the CAG promoter. The SV40 terminator matching the CAG promoter was inserted using the NotI and BglII restriction sites in the multiple cloning site.

[0514] Design the upstream and downstream PCR primers of SV40 terminator, SV10-1F is the upstream primer, with two restriction sites NotI and PstI, and SV10-1R is the downstream primer, with BglII restriction site. Use pEGFP vector as template to amplify SV40 terminator and connect to pMD18T, after sequencing verification, use NotI and BglII to digest and recover a fragment of about 250bp, connect the fragment with pVL1393 vector treated with NotI and BglII and inserted with CAG promoter, after verification, pVLCAG vector can be obtained, which is used to transfer the foreign gene together with the upstream and downstream CAG promoter and SV40 terminator to the baculovirus polyhedron gene site during co-transfection, and construct a recombinant baculovirus transfer vector for presenting foreign genes to vertebrate cells or individuals.

[0515] 2 Construction of recombinant virus presenting reporter gene

[0516] 2.1 Cloning of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 genes into gene presentation transfer vector

[0517] The H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 gene fragments with restriction sites in Example 4 were digested, recovered and connected to the pVLCAG vector treated with the same restriction sites. After correct identification, pVLCAG-H9HA-Ferritin-CO-M6 and pVLCAG-H5 HA-Ferritin-CO-M6 were obtained.

[0518] 2.2 Construction and mass production of recombinant viruses for gene presentation

[0519] The pVLCAG-H9 HA-Ferritin-CO-M6 and pVLCAG-H5 HA-Ferritin-CO-M6 transfer vectors were used to co-transfect BmN cells with reBmBac to obtain the recombinant viruses Bm-CAG H9 HA-Ferritin-CO-M6 and Bm-CAG H5HA-Ferritin-CO-M6. During the co-transfection process, pVL1393-Luc was still needed as a control to determine the success of the co-transfection. The virus purification process was the same as above.

[0520] The recombinant virus was used to infect the 5th instar silkworm larvae, and the silkworm hemolymph was harvested 4-5 days later, which contained a large amount of amplified recombinant virus.

[0521] The silkworm hemolymph was diluted with PBS and then ultrasonically disrupted (10 s × 10 times), then centrifuged at 12000 rpm for 10 minutes to remove cell debris, and then centrifuged at 15 × 10 4 The mixture was centrifuged at 400 × 100 × 400 μl for 3 h, the supernatant was removed, and the precipitate was resuspended in an appropriate amount of PBS to obtain the initially purified recombinant baculovirus particles. Here, the recombinant virus of 10 mL of silkworm blood was centrifuged and resuspended in 2 mL of PBS. The amount of recombinant virus after resuspension was about 2.5 × 10 12 PFU / ML (about 5×10 12 viral genomes (vg) / mL, and the viral copy number was calculated by fluorescence quantitative PCR using BmNPV viral DNA backbone sequence primers, GJ-1F (CGAACGGAGACGATGGATGTGG) and GJ-1R (GTGCCGAGCGATTGTAAGGGATC).

[0522] 3. Expression of recombinant viruses in mammalian cells

[0523] VERO cells were used as the target of gene presentation, and the recombinant viruses Bm-CAG H9 HA-Ferritin-CO-M6 and Bm-CAG H5 HA-Ferritin-CO-M6 were each taken at 100 MOI for research. The method steps are as follows:

[0524] 1) VERO cells (1×10 6 cell / well), cultured at 37℃ for 8-12h

[0525] 2) Take 1×10 8 The recombinant viruses Bm-CAG H9 HA-Ferritin-CO-M6 and Bm-CAGH5HA-Ferritin-CO-M6 purified by PFU were added to the cells in the six-well plate and incubated at 37°C for 1 h.

[0526] 3) After incubation, the virus-containing medium was removed and replaced with normal DMEM medium containing serum. The cells were treated for about 42 hours, and the expression products were collected. The titer was 1:800 by hemagglutination test.

[0527] 4 Animal testing

[0528] 4.1 Injection of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 expression products into animals

[0529] The optimal sequences H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 were expressed in the silkworm eukaryotic expression system and the resulting silkworm pupae were expressed according to 2 9-10 Animals were injected with 100 HA units / feather, and vaccines were prepared at 250 doses / g and 160 doses / g of silkworm pupae.

[0530] The preparation method is as follows: weigh 10g of silkworm pupae expressing H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 nanoparticle antigens, add 90ml PBS buffer, stir with a stirrer for 5-10min to fully mix, prepare the mother solution and put it into a sterilized bottle. 206 adjuvant is sterilized in advance and placed in a 30℃ incubator for insulation. The mother solution is first placed on ice. When mixing with the adjuvant, first add 3ml of adjuvant to a 15ml centrifuge tube, slowly add 3ml of the mother solution, and homogenize with a homogenizer for 3min. Add ciprofloxacin hydrochloride at an amount of 30-50mg / 1kg chicken body weight. The vaccine is milky white. When testing the quality of the vaccine, a small amount can be taken out and centrifuged at 3000rpm for 15min. The vaccine is qualified if it is not stratified. Use the same method to treat healthy silkworm pupae and make a vaccine as a control.

[0531] The optimal sequences H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 were expressed in the AcBacmid-insect cell eukaryotic expression system and the resulting cell pellets were expressed according to 2 9-10 Animals were injected with 100 HA units / feather.

[0532] Preparation method: The antigen expressed by insect cells is ultrasonically crushed according to the cell precipitation amount of hemagglutination units required for preparing the vaccine, and then mixed with the corresponding adjuvant.

[0533] According to the method of the Veterinary Pharmacopoeia of the People's Republic of China (2010 edition, China Agriculture Press), 70 21-day-old SPF chickens were subcutaneously injected with 1 dose (0.2 ml) of the vaccine prepared by the expression products of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 in the silkworm eukaryotic expression system at the back of the neck of 10 chickens. 1 dose (0.2 ml) of the vaccine prepared by the expression products of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 in the AcMNPV-insect cell expression system was subcutaneously injected at the back of the neck of 10 chickens. 10 chickens were inoculated with the vaccine prepared by healthy silkworm pupae as the negative silkworm pupa immunization group, 10 chickens were not immunized as the normal control group, and 10 chickens were inoculated with the traditional vaccine strain as the positive control. 21 days after inoculation, blood was collected from the subwing vein, about 2 ml was collected, and placed in a test tube tilted, and then left to stand at 37°C for 2 hours, and then transferred to room temperature overnight. The serum was transferred to a centrifuge tube, centrifuged at 2000 rpm for 10 min, and the serum was collected and HI antibodies were determined using avian influenza virus (H9 subtype) antigen. The HI titers of the negative silkworm pupa immunization group and the normal control group should not be higher than 1:4, and the HI titers of the traditional vaccine strains were all 1:64-128, while the HI titers of the H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 expression sample groups in the silkworm eukaryotic expression system were 1:256 and 1:200 or more. The HI titers of the H9 HA-Ferritin-CO-M6 and H5HA-Ferritin-CO-M6 expression sample groups in the AcMNPV-insect cell expression system were 1:128 and 1:100 or more.

[0534] 4.2 Using recombinant viruses to deliver foreign genes to mice and chickens

[0535] 4.2.1 Presentation of H9 HA-Ferritin-CO-M6 gene to mice

[0536] The purified recombinant virus Bm-CAG H9 HA-Ferritin-CO-M6 was injected into the tail vein (1×1010 vg / mouse) and perfusion (1×10 10 vg / mouse) was delivered into mice, and the weight of the mice was about 25g. The mouse serum was collected on the 5th, 11th, 17th and 21st days to detect the antibody titer.

[0537] 4.2.2 Presentation of H5 HA-Ferritin-CO-M6 gene to mice

[0538] The purified recombinant virus Bm-CAG H5 HA-Ferritin-CO-M6 was injected into the tail vein (1×10 10 vg / mouse) and perfusion (1×10 10 vg / mouse) was delivered into mice, and the weight of the mice was about 25g. The mouse serum was collected on the 5th, 11th, 17th and 21st days to detect the antibody titer.

[0539] 4.2.3 Presentation of H9 HA-Ferritin-CO-M6 gene to chickens

[0540] Similar to the treatment of mice, the purified recombinant virus Bm-CAG H9 HA-Ferritin-CO-M6 was injected into the tail vein (3×10 10 vg / feather) and perfusion (6×10 10 vg / feather) was delivered into 15-day-old chickens weighing about 150g. Chicken serum was collected on the 5th, 11th, 17th and 21st days to test the antibody titer.

[0541] 4.2.4 Presentation of H5 HA-Ferritin-CO-M6 chicken serum gene to chickens

[0542] The purified recombinant virus Bm-CAG H5 HA-Ferritin-CO-M6 was injected into the tail vein (3×10 10 vg / feather) and perfusion (6×10 10 vg / feather) was delivered into 15-day-old chickens weighing about 150g. Chicken serum was collected on the 5th, 11th, 17th and 21st days to test the antibody titer.

[0543] 5 Neutralizing antibody titer

[0544] The specific experimental steps are as above. The neutralizing antibody titer was the highest at 21 days. The specific results are shown in (Table 15).

[0545] Table 15 Neutralizing antibody titers of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 in mouse and chicken sera (21 days)

[0546] composition Potency Healthy silkworm pupa control (chicken) 1：4 Traditional vaccines (chicken) 1：512 Healthy silkworm pupa control (mice) 1：4 Traditional vaccines (mouse) 1：256 <![CDATA[H9 HA-Ferritin-C-O-M6 mouse serum]]> 1：2048 <![CDATA[H5 HA-Ferritin-C-O-M6 mouse serum]]> 1：1600 <![CDATA[H9 HA-Ferritin-C-O-M6 Chicken Serum]]> 1：3200 <![CDATA[H5 HA-Ferritin-C-O-M6 Chicken Serum]]> 1：3200

[0547] From the data in Table 15, it can be seen that the antibody titers produced by the mutants with multiple amino acid mutations in the fusion protein presented to mice and chickens are higher than those of the healthy silkworm pupa control and traditional vaccines.

[0548] 6. Hemagglutination inhibition

[0549] The specific steps are shown in Example 4. The result after 21 days is the best. The results are shown in Table 16.

[0550] Table 16 Hemagglutination inhibition titer of H9 HA-Ferritin-CO-M6 and H5 HA-Ferritin-CO-M6 in mouse and chicken serum

[0551] composition Potency Healthy silkworm pupa control (chicken) 1：4 Traditional vaccines (chicken) 1：128 Healthy silkworm pupa control (mice) 1：4 Traditional vaccines (mouse) 1：128 <![CDATA[H9 HA-Ferritin-C-O-M6 mouse serum]]> 1：160 <![CDATA[H5 HA-Ferritin-C-O-M6 mouse serum]]> 1：160 <![CDATA[H9 HA-Ferritin-C-O-M6 chicken serum]]> 1：256 <![CDATA[H5 HA-Ferritin-C-O-M6 Chicken Serum]]> 1：256

[0552] From the data in Table 16, it can be seen that the antibody titers produced by the mutants with multiple amino acid mutations in the fusion protein presented to mice and chickens are higher than those of the healthy silkworm pupa control and traditional vaccines. SEQUENCE LISTING <110> Institute of Biotechnology, Chinese Academy of Agricultural Sciences <120> Self-assembled ferritin nanoantigen particles and influenza vaccine and preparation method <130> BJ-2002-190327A-F <160> 26 <170> PatentIn version 3.5 <210> 1 <211> 166 <212> PRT <213> Helicobacter pylori <400> 1 Met Leu Ser Lys Asp Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys 1 5 10 15 Glu Met Asn Ser Ser Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr 20 25 30 Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala 35 40 45 Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn 50 55 60 Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe 65 70 75 80 Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His 85 90 95 Ile Ser Glu Ser Ile Asn Asn Ile Val Asp Ala Ile Lys Ser Lys Asp 100 105 110 His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu 115 120 125 Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly 130 135 140 Asn Glu Asn His Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile 145 150 155 160 Ala Lys Ser Arg Lys Ser 165 <210> 2 <211> 510 <212> DNA <213> Helicobacter pylori <400> 2 atgtccggtg gcgacatcat caagctgctg aacgaacagg tgaacaagga gatgcagtcc 60 <h2 style=";text-align:left;direction:ltr">agcaacctgt acatgtctat gtcttcatgg tgctacaccc actcactgga cggagctggt 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctgttcctgt tcgaccacgc tgccgaggaa tacgaacacg ccaagaagct gatcatcttc 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ctgaacgaga acaacgtgcc tgtccagctg acctccatca gcgctcccga acacaagttc 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gagggtctga ctcaaatctt ccagaaggcc tacgaacacg agcagcacat ctctgaatca 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atcaacaaca tcgtggacca cgctatcaag agcaaggacc acgccacttt caacttcctg 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> caatggtacg tggctgagca gcacgaggaa gaggtcctgt tcaaggacat cctggacaag 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atcgaactga tcggcaacga gaaccacgga ctgtacctgg ctgaccagta cgtcaagggc 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atcgccaagt cccgcaagag ctaagaattc 510<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 3<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 560<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> PRT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Influenza virus<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 3<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Met Glu Thr Ala Ser Leu Ile Thr Ile Leu Leu Val Val Thr Gly Ser<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 1 5 10 15<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Ser Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 20 25 30<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu 50 55 60 Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Ile Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Lys Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His 180 185 190 Pro Pro Thr Asp Thr Ala Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asn Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asn Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Phe Glu Thr Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Leu Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Arg Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr Ile Tyr 515,520,525 Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe 530 535 540 Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile 545 550 555 560 <210> 4 <211> 1742 <212> DNA <213> Influenza Virus <400> 4 agcaaagca ggggaatttc ataccactc aaaatggaga cagcatcact gataactata 60 ctactagtag taacaggag cagtgcagat aagatctgca tcggctatca atcaaac 120 tccacagaaa ctgtagacac actaacagaa aacaatgtcc ctgtgacaca tgccaaagaa 180 ttgctccaca cagagcataa tgggatgctg tgtgcaa gcttgggaca acctttatt 240 ctagacactt gtaccattga aggactaatc tatggcaatc cttcttgtga tatattgttg 300 ggaggaagag aatggtccta tatcgtcgag agaccatcag ctgttaacgg attgtgttat 360 cccgggaatg tagaaatct agaagagcta agtcactct ttagttctgc taagtcttat 420 caaaggatcc agattttccc agacacaatc tggaatgtgt cttatagtgg gacaagcaag 480 gcatgttcgg attcattcta cagaagcatg agatggttga ctcaaaagaa caacgcttac 540 cctattcaag acgcccaata cacaaataat caagaaaaga acattctttt catgtggggc 600 ataaatcacc cacccactga cactgcacag acaaatctgt acacaagaac cgacacaaca 660 acgagtgtgg caacagaaga aataaatagg accttcaaac cattgatagg accaaggcct 720 cttgtcaacg gtttgatggg aagaattaat tattattggt cagtattaaa accgggtcaa 780 acactgcgaa taaaatctaa tggaaatcta atagctccat ggtatggaca cattctttca 840 ggagagagcc acgggagaat cctgaagact gacttaaaaa gaggtagctg cacagtgcaa 900 tgtcagacag agaagggtgg cttaaacaca acattgccat tccaaaatgt gagtaagtat 960 gcatttggaa actgctcaaa atacattggc ataaagagtc tcaaacttgc agttggtctg 1020 aggaatgtac cttctagatc cagtagagga ctattcgggg ccatagcagg attcatagag 1080 ggaggttggt caggactagt tgctggttgg tatgggttcc agcattcaaa taaccaaggg 1140 gttggtatgg cagcagatag ggactcaacc caaaggcaa ttgataaat aacatccaaa gtgaataca tagtagacaa aatgaacaag cagtatgaaa ttatcgatca tgaattcagc gagtttgaa ctagacttaa catgattaac aataagattg acgatcaaat cctggatata tgggcatata atgcagaatt gctagttctg cttgaaaacc agaaaacact cgatgagcat gatgcaaatg taacaaattt gtacaataaa gtgaagaggg cattgggttc caatgcggtg 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500 attcggaacg ggacctacaa cagaaggaag tatcaagagg agtcaagatt agaaagacag aaaatagagg gggtcaagct ggaatctgaa ggaacttaca aaatcctcac catttattcg actgtcgcct catctcttgt aattgcaatg gggtttgctg cctttttgtt ctgggccatg 1680. tccaatgggt cttgcagatg caacatttgt atataattgg caaaaacacc cttgtttcta ct 1742 <210> 5 <211> 568 <212> PRT <213> Influenza virus <400> 5 Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val 20 25 30 Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile 35 40 45 Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 50 55 60 Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Pro Asn Val Ser Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Thr Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asn Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn Arg Phe Glu 115 120 125 Lys Ile Lys Ile Ile Pro Lys Ser Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Gly Pro Ser Phe Tyr 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asn Asn Thr Tyr Pro Thr Ile 165 170 175 Lys Glu Ser Tyr His Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp 180 185 190 Gly Ile His His Pro Asn Asp Glu Glu Glu Gln Thr Arg Ile Tyr Lys 195 200 205 Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Val Glu Phe Phe Trp Thr Ile Leu Lys Ser Asn Asp Thr Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly 275 280 285 Asn Cys Ser Thr Lys Cys Gln Thr Pro Val Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Gly Glu Gly Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 340 345 350 Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr 355 360 365 Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Arg 370 375 380 Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser 385 390 395 400 Ile Ile Asp Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe 405 410 415 Asn Asn Leu Glu Lys Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430 Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 435 440 445 Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 450 455 460 Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480 Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu 485,490,495 Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala 500 505 510 Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 515,520,525 Thr Tyr Gln Ile Will Be Leu Ile Tyr Will Be Thr Val Ala Will Be Leu Wing 530 535 540 Leu Phe Leu Trp Met Cys Ser Asn Gly 545 550 555 560 Ser Leu Gln Cys Arg Ile Cys Ile 565 <210> 6 <211> 1719 <212> DNA <213> Influenza Virus <400> 6 caatctgtca aaatggagaa atagtgctt cttcttgcaa tagtcagtct tgttaaaagt 60 gatcagattt gcattggtta ccatgcaac aactcacag agcaggttga cacaataatg 120 gaaaagaacg tcactgttac acacgctca gatactgg aaagacaca caacgggaaa 180 ctctgcgatc tagatggagt gaagcctcta attttaagag attgtagtgt agctggatgg 240 ctcctcggga acccaatgtg tgacgaattc cccaatgtgt cggaatggtc ctacatagtg 300 gagagacca atccagccaa tgacctctgt tacccaggga atttcaacaa ctatgaagag 360 ctgaaacacc tattgagcag ataaaccgg tttgagaaaa ttaagatcat ccccaaaagt 420 tcttggccag atcatgaagc ctcattagga gtgagctcag catgtccata ccagggagga 480 540 aaggaagtt accataatac caatcaagaa gatcttttgg tgctgtgggg aatccaccat 600 ccaaatgatg aggaagagca gacaaggatc tataaaaaacc caactaccta tatttccgtt 660 720 gggcagagtg gaaggtgga gttcttttgg acaattttaa aatcaaacga tacaataaac 780 tttgagagta atggaaattt cattgctcca gaaaatgcat acaaaattgt caagaaaggg 840 gactcaacaa ttatgaaaag tgagttggaa tatggtaact gcagcaccaa gtgtcaaact 900 ccagtagggg cgataaactc cagtatgcca ttccacaca tccaccctct caccatcggg 960 gatgcccca atatgtgaa atcaacaga ttagtccttg ctactggggct cagaaatagc 1020 cctcaggag agggagag aaaaagaga ggactttg gagctatagc aggttttata 1080 gagggaggat ggcagggaat ggtagatggt tggtaggtt accaccatag caacgagcag 1140 gggagtgggt acgctgcaga cagagaatcc actcaaagg caatagatgg agtcaccaat 1200 aaggtcaact caatcattga aaatgaat actcagttg aggctgttgg aagggaattt 1260 aaacttgg aaagagaat aagaaattta aaaagaga tggagacgg gtttctagat 1320 gtctggactt ataatgctga acttctggtt ctcatggaaa atgagaac tctagacttt 1380 catgactcaa atgtcagaa cctttacgac aaggtgcgac tacagcttag ggacaatgca 1440 aaggagcttg gtaacggttg ttcgagttc tatcacagat gcgataatga atgtatgga 1500 agtgtaagaa acggaacgta tgactacccg cagtattcag aagaagcaag attaaaaga 1560 Gaggaaata gtggagtaa attggaatca atggaactt accaatact atcaatttat 1620 tcaacagtgg caagttccct agcactggca atcatagtgg ctggtctatt tttatggatg 1680 tgctccaatg gatcgttaca atgcagaatt tgcatttaa 1719 <210> 7 <211> 690 <212> PRT <213> Artifical sequence <400> 7 Met Glu Thr Ala Ser Leu Ile Thr Ile Leu Leu Val Val Thr Gly Ser 1 5 10 15 Ser Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu 50 55 60 Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Ile Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Lys Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His 180 185 190 Pro Pro Thr Asp Thr Ala Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asn Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asn Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Phe Glu Thr Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Leu Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Arg Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Ser Gly Gly Asp 515 520 525 Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser 530 535 540 Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp 545 550 555 560 Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His 565 570 575 Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln 580,585,590 Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln 595,600,605 I Phe Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile 610 615 620 Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe 625 630 635 640 Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu 645,650,655 Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His 660,665,670 Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg 675,680,685 Lys Ser 690 <210> 8 <211> 2053 <212> DNA <213> Artificial sequence <400> 8 repeat catcactgat aactatacta ctagtagta repeat tgcactag 60 atctgcatcg gctatcaatc aaaaactcc acagaactg tagacacact aacagaaaac 120 aatgtccctg tgacacatgc caaagaattg ctccacacag agcataatgg gatgctgtgt 180 gcaacaagct tgggacaacc tcttattcta gacacttgta ccattgaagg actaatctat 240 ggcaatcctt cttgtgatat attgttggga ggaagagaat ggtcctatat cgtcgagaga 300 ccatcagctg ttaacggatt gtgttatccc gggaatgtag aaaatctaga agagctaagg 360 tcactcttta gttctgctaa gtcttatcaa aggatccaga ttttcccaga cacaatctgg 420 aatgtgtctt atagtgggac aagcaaggca tgttcggatt cattctacag aagcatgaga 480 tggttgactc aaaagaacaa cgcttaccct attcaagacg cccaatacac aaataatcaa 540 gaaaagaaca ttcttttcat gtggggcata aatcacccac ccactgacac tgcacagaca 600 aatctgtaca caagaaccga cacaacaacg agtgtggcaa cagaagaaat aaataggacc 660 ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattaattat 720 tattggtcag tattaaaacc gggtcaaaca ctgcgaataa aatctaatgg aaatctaata 780 gctccatggt atggacacat tctttcagga gagagccacg ggagaatcct gaagactgac 840 ttaaaaagag gtagctgcac agtgcaatgt cagacagaga agggtggctt aaacacaaca 900 ttgccattcc aaaatgtgag tagtatgca tttggaaact gctcaaaata cattggcata 960 aagagtctca aacttgcagt tggtctgagg aatgtacctt ctagatccag tagaggacta 1020 ttcggggcca tagcaggatt catagaggga ggttggtcag gactagttgc tggttggtat 1080 gggttccagc attcaataa ccaaggggtt ggtatggcag cagataggga ctcaacccaa 1140 aaggcaattg ataaaataac atccaaagtg aataacatag tagacaaaat gaacaagcag 1200 1260 aagattgacg atcaaatcct ggatatatgg gcatataatg cagaattgct agttctgctt 1320 gaaaccaga aaacactcga tgagcatgat ccaaatgtaa acaatttgta caataaagtg 1380 aagagggcat tgggttccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440 aaatgtgatg accaatgcat ggagacaatt cggaacggga cctacaacag aaaggatt 1500 caagaggagt caagattaga aagacagaaa atagaggggg tcaagctgga attccggtgg 1560 cgacatcatc aagctgctga acgaacaggt gaacaaggag atgcagtcca gcaacctgta 1620 catgtctatg tcttcatggt gctacaccca ctcactggac ggagctggtc tgttcctgtt 1680 cgaccacgct gccgaggaat acgaacacgc caagaagctg atcatcttcc tgaacgagaa 1740 caacgtgcct gtccagctga cctccatcag cgctcccgaa cacaagttcg agggtctgac 1800 tcaaatcttc cagaaggcct acgaacacga gcagcacatc tctgaatcaa tcaacaacat 1860 cgtggaccac gctatcaaga gcaaggacca cgccactttc aacttcctgc aatggtacgt 1920 ggctgagcag cacgaggaag aggtcctgtt caaggacatc ctggacaaga tcgaactgat 1980 cggcaacgag aaccacggac tgtacctggc tgaccagtac gtcaagggca tcgccaagtc 2040 ccgcaagagc city 2053 <210> 9 <211> 698 <212> PRT <213> Artificial sequence <400> 9 Put Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val 20 25 30 Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile 35 40 45 Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys 50 55 60 Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Pro Asn Val Ser Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Thr Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asn Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn Arg Phe Glu 115 120 125 Lys Ile Lys Ile Ile Pro Lys Ser Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Gly Pro Ser Phe Tyr 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asn Asn Thr Tyr Pro Thr Ile 165 170 175 Lys Glu Ser Tyr His Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp 180 185 190 Gly Ile His His Pro Asn Asp Glu Glu Glu Gln Thr Arg Ile Tyr Lys 195 200 205 Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Val Glu Phe Phe Trp Thr Ile Leu Lys Ser Asn Asp Thr Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly 275 280 285 Asn Cys Ser Thr Lys Cys Gln Thr Pro Val Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Gly Glu Gly Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile 340 345 350 Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr 355 360 365 Gly Tyr His His Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Arg 370 375 380 Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser 385 390 395 400 Ile Ile Asp Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe 405 410 415 Asn Asn Leu Glu Lys Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp 420 425 430 Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met 435 440 445 Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu 450 455 460 Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly 465 470 475 480 Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu 485 490 495 Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala 500 505 510 Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly 515 520 525 Thr Tyr Gln Ile Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln 530 535 540 Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser 545 550 555 560 Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp 565 570 575 His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu 580 585 590 Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu 595 600 605 His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His 610 615 620 Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val Asp His Ala Ile 625 630 635 640 Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala 645 650 655 Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile 660 665 670 Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu Ala Asp Gln Tyr 675 680 685 Val Lys Gly Ile Ala Lys Ser Arg Lys Ser 690 695 <210> 10 <211> 2097 <212> DNA <213> Artificial sequence <400> 10 atggagaaaa tagtgcttct tcttgcaata gtcagtcttg ttaaaagtga tcagatttgc 60 attggttacc atgcaaacaa ctcaacagag caggttgaca caataatgga aaagaacgtc 120 actgttacac acgctcaaga catactggaa aagacacaca acggggaaact ctgcgatcta 180 gatggagtga agcctctaat tttaagagat tgtagtgtag ctggatggct cctcggggaac 240 ccaatgtgtg acgaattccc caatgtgtcg gaatggtcct acatagtgga gaagaccaat 300 ccagccaatg acctctgtta ccagggaat ttcaacaact atgaagagct gaaacaccta 360 ttgagcagaa taaaccggtt tgagaaaatt aagatcatcc ccaaaagttc ttggccagat 420 catgaagcct cattaggagt gagctcagca tgtccatacc agggaggacc ctcctttat 480 agaaatgtgg tatggcttat caaaaagaac aatacatacc caacaataaa ggaaagttac 540 cataatacca atcaagaaga tcttttggtg ctgtgggggaa tccaccatcc aaatgatgag 600 gaagcaga caaggatcta taaaaaccca actacctata tttccgttgg gacatcaaca 660 720 780 ggaaatttca ttgctccaga aaatgcatac aaaattgtca agaaaggga ctcaacaatt 840 atgaaaagtg agttggata tggtaactgc agcaccaagt gtcaaactcc agtaggggcg 900 ataaactcca gtatgccatt ccacaacatc caccctctca ccatcggga atgcccccaaa 960 tatgtgaaat caaacagatt agtccttgct actgggctca gaatagccc tcaaggagag 1020 ggaagagaa aaaagagagg actatttgga gctatagcag gttttataga gggaggatgg 1080 cagggaatgg tagatggttg gtatgggtac caccatagca acgagcaggg gagtgggtac 1140 gctgcagaca gagaatccac tcaaaggca atagatggag tcaccataa ggtcaactca 1200 atcattgaca aaatgaatac tcagttgag gctgttggaa gggaatttaa taacttggaa 1260 aagagaatag aaatttaaa caagagatg gagacggggtttctagatgt ctggacttat 1320 aatgctgaac ttctggttct catggaaat gagagaactc tagactttca tgactcaat 1380 gtcaagaacc tttacgacaa ggtgcgacta cagcttaggg acatgcaa ggagcttggt 1440 aacggttgtt tcgagttcta tcacagatgc gataatgaat gtatggaag tgtaagaac 1500 ggaacgtag actaccccgca gtattcagaa gaagcagat tAAaagaga ggaatagt 1560 ggagtaaat tggaatcaat aggaacttac caatatccg gtggcgacat catchcaagctg 1620 ctgaacgaac aggtgacaa ggagatgcag tccagcacc tgtacatgtc tatgtcttca 1680 tggtgctaca cccactcact gggacggagct gtctgttcc tgttcgacca cgctgccgag 1740 gatacgaac acgccaagaa gctgatcatc ttcctgaacg agaacaacgt gcctgtccag 1800 ctgacctcca tcagcgctcc cgaacacaag tcgaggtc tgactcaat cttccagaag 1860 gcctacgaac acgagcagca catctctgaa tcaatcaaca acatcgtgga ccacgctatc 1920 aagagcaagg accacgccac tttcaacttc ctgcaatggt acgtggctga gcagcacgag 1980 gaagaggtcc tgttcaagga catcctggac aagatcgaac tgatcggcaa cgagaaccac 2040 ggactgtacc tggctgacca gtacgtcaag ggcatcgcca agtcccgcaa gagctaa 2097 <210> 11 <211> 690 <212> PRT <213> Artifical sequence <400> 11 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Gly Leu 50 55 60 Gly His Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Thr Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His 180 185 190 Pro Pro Thr Asp Thr Val Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Gln Gly Arg Ile Asp Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Arg Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Ala Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asn Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Ser Gly Gly Asp 515 520 525 Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser 530 535 540 Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp 545 550 555 560 Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His 565 570 575 Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln 580 585 590 Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln 595 600 605 Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile 610 615 620 Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe 625 630 635 640 Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu 645 650 655 Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His 660 665 670 Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg 675 680 685 Lys Ser 690 <210> 12 <211> 2073 <212> DNA <213> Artifical sequence <400> 12 atggaagtag taagtctgat aaccattctg ctcgtcgtca ccgtctcaaa cgctgataaa 60 atctgcatcg gctaccaatc cacaaatagc actgaaaccg tggacacgct gacagagaac 120 aatgtgccgg ttactcacgc taaagaactg ttgcacaccg agcataacgg tatgctctgc 180 gccactggtt taggacatcc tcttatcctg gacacttgca ccatcgaagg tttaatttac 240 ggaaacccat cctgtgatct cttacttggt ggacgtgaat ggtcatacat tgtggagagg 300 ccttctgctg ttaatggact ttgctatcca ggcaacgtcg agaatttaga agagcttcgc 360 agcctgttct catctgccag atcctaccaa agaatccaaa tcttccctga cacaatatgg 420 aacgtaacgt acagcggtac atccaaagct tgttcagatt ctttctatag atcaatgcgc 480 tggctcactc aaaagaacaa tgcttaccca atccaagatg cccagtatac caacaatcag 540 gaaaagaaca tcctttttat gtggggaatt aatcaccctc caacggacac agtccaaact 600 aatctgtaca ctcgtaccga tacaactacc tctgtagcca cggaagagat aaaccgtaca 660 ttcaaacctt taatcggccc gaggcccttg gtgaatggtc tccaaggaag aattgactac 720 tattggtcgg ttcttaagcc gggtcagacg ctgcgtata ggagtaacgg aaatttaatc gctccctggt acggccacat tctttcgggc gaaagtcatg gtagaatatt aaagaccgat cttaagcgcg gcagctgcac ggtccaatgt cagacagaga agggcggtct gaacacgaca ttgccgttcc agaatgtatc caatacgca tttggtaact gctcgaagta tattggtatc aaaagtttga agctcgcggt gggactcaga aatgttccct cgcgtagctc caggggctta ttcggtgcaa tagcgggttt tatcgaagga ggctggtcag gactcgtggc aggatggtac 1080 ggcttccaac actctacga ccaggggcgtt ggtatggctg ccgacaggga ttcaacgcaa aaagccatcg father atctaaggtc aacaacatag tagcaaaat gaacaagcag 1260. ttgaatca ttgatcatga gttttcagaa gtggaggcta gactgaacat gatcaacaac 1320. aaaatcgacg atcaaataca ggacatctgg gcttataacg ccgaactgtt ggttctctta gagaatcaaa agaccttgga cgaacacgat gctaacgtca acaacttgta caacaaagta aagagagcac tcggatcga cgcggtgga gacggaaaag gctgtttcga gttgtatcat aagtgcgata atcagtgtat ggaaactatt cgcaacggca cctacaatag acgcaaatat 1500 caagaagaga gtaagctcga acgtcagaaa atagagggcg ttaagctgga aagcgagggt 1560 acatacaaga ttccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1620 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1680 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1740 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1800 cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 1860 tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 1920 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 1980 ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2040 gtcaagggca tcgccaagtc ccgcaagagc taa 2073 <210> 13 <211> 730 <212> PRT <213> Artificial sequence <400> 13 Met Glu Lys Ile Val Leu Leu Phe Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp His Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val 20 25 30 Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile 35 40 45 Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asn Gly Val Lys 50 55 60 Pro Leu Ile Leu Lys Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 115 120 125 Lys Ile Gln Ile Ile Pro Lys Asp Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ala Ala Cys Pro Tyr Gln Gly Asn Ser Ser Phe Phe 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asp Asn Ala Tyr Pro Thr Ile 165 170 175 Lys Lys Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp 180 185 190 Gly Ile His His Pro Asn Asp Glu Ala Glu Gln Thr Arg Leu Tyr Gln 195 200 205 Asn Pro Thr Thr Tyr Val Ser Ile Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Ile Asp Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Val Glu Tyr Gly 275 280 285 Asn Cys Asn Thr Arg Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Arg Glu Gly Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 340 345 350 Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 355 360 365 Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln 370 375 380 Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys 385 390 395 400 Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 405 410 415 Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 420 425 430 Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 435 440 445 Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 450 455 460 Arg Leu Gln Leu Lys Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 465 470 475 480 Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn 485 490 495 Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg 500 505 510 Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Ile Tyr Gln Ile 515 520 525 Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Ala Ile Met 530 535 540 Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys 545 550 555 560 Arg Ile Cys Ile Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln 565 570 575 Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser 580 585 590 Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp 595 600 605 His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu 610 615 620 Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu 625 630 635 640 His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His 645,650,655 Glu Gln His Protein Ser Glu Ser Protein Asn Protein Val Asp Protein Protein 660,665,670 Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala 675,680,685 Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile 690,695,700 Leu Glu With Gly Asn Glu Asn His Gly Leu Tyr Leu Asp Gln Tyr 705 710 715 720 Val Lys Gly Ile Ala Lys Ser Arg Lys Ser 725,730 <210> 14 <211> 2193 <212> DNA <213> Artificial sequence <400> 14 atggaaaaaa tcgtgctgct gttcgcaatc gtgagcctgg tgaagagtga ccatatctgt 60 atcgggtatc atgctaataa ttctactgaa caggtggata ccattatgga gagaacgtg 120 actgtgaccc acgctcagga catcctggag aaaacacata acggcaagct gtgcgatctg 180 aatggagtga aacccctgat cctgaaggac tgctcagtgg caggctggct gctgggaaac 240 cccatgtgtg atgagttcat caatgtgcct gaatggtcct acattgtgga gaagccaac 300 cctgctaatg atctgtgcta cccaggcaac ttcaatgact atgaggaact gaagcacctg 360 ctgtccagaa tcaaccattt cgaaaagatc cagatcattc ccaaggattc ttggcctgac 420 cacgaggcct cactgggtgt gagtgccgct tgtccatacc agggaaacag ctccttcttt 480 aggaatgtgg tgtggctgat taagaaagac aacgcttacc ccactatcaa gaaatcttac 540 aaaacacca accaggaga tctgctgggtg ctgtgggggaa tccaccatcc aaacgacgag 600 ggaaagaga cacgcctgta ccagaatccc accacatatg tgagcattgg gacatccact 660 ctgaaccagc gcctggtgcc taaaatcgca actcggtcca aggtgaacgg ccagtctgga 720 cggatcgatt tcttttggac cattctgaag cctaacgacg ccatcaattt cgaatccaac 780 ggcaatttta tcgcaccaga gtacgcctac aagatcgtga aagaagaga ttctactatc 840 atgaagtcag aggtggata cgggaactgc aatacccgct gtcagacacc aatcggtgcc 900 attaactctt caatgccatt tcacaatatc catcccctga caattgggga gtgccccaag 960 tatgtgaaaa gcaacaagct ggtgctggct actggtctga gaaacagccc tcagagggag 1020 ggtaggggtc tgttcggggc tatcgcaggt tttattgagg gcggatggca gggaatggtg 1080 gatgggtggt acggttatca ccatagtaac gaacagggca gcggatacgc agccgataaa 1140 gagagtacac agaaggccat tgacggagtg actaacaaag tgaatagcat cattgacaag 1200 atgaacaccc agttcgaggc tgtggggagg gaatttaaca atctggagag aaggatcgaa 1260 aacctgaata agaaaatgga agatggcttc ctggacgtgt ggacctacaa cgcagagctg 1320 ctggtgctga tggagaatga aagaacactg gattttcacg acagcaacgt gaaaaatctg 1380 tatgataaag tgaggctcca gctgaaagac aacgccaagg aactggggaa tggttgtttc 1440 gagttttacc ataagtgcga taacgagtgt atggaatctg tgagaaatgg cacttacgac 1500 tatcctcagt attcagagga agctagactg aaaagggagg aaatttcagg ggtgaagctg 1560 gagagtatcg gtatttacca gatcctgtcc atttattcta ccgtggctag tagcctggtg 1620 ctggcaatca tgatggctgg gctgtccctg tggatgtgta gcaatggaag tctccagtgt 1680 cggatttgta tctccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1740 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1800 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1860 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1920 cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 1980 tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 2040 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 2100 ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2160 gtcaagggca tcgccaagtc ccgcaagagc taa 2193 <210> 15 <211> 690 <212> PRT <213> Artificial sequence <400> 15 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asp Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Gly Leu 50 55 60 Gly His Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Thr Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His 180 185 190 Pro Pro Thr Asp Thr Val Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Gln Gly Arg Ile Asp Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Arg Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Ala Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asn Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Ser Gly Gly Asp 515 520 525 Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser 530 535 540 Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp 545 550 555 560 Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His 565 570 575 Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln 580 585 590 Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln 595 600 605 Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile 610 615 620 Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe 625 630 635 640 Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu 645,650,655 Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His 660 665 670 Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg 675 680 685 Lys Ser 690 <210> 16 <211> 2073 <212> DNA <213> Artificial sequence <400> 16 atggaagtag taagtctgat aaccattctg ctcgtcgtca ccgtctcaaa cgctgataaa 60 atctgcatcg gctaccaatc cacaatagc actgaaaccg tggacacgct gacagagaac 120 gatgtgccgg ttactcacgc taaagaactg ttgcacaccg agcataacgg tatgctctgc 180 gccactggtt taggacatcc tcttatcctg gacacttgca ccatcgaagg tttaatttac 240 ggaaacccat cctgtgatct cttacttggt ggacgtgaat ggtcatacat tgtggagagg 300 ccttctgctg ttaatggact ttgctatcca ggcaacgtcg agaatttaga agagcttcgc 360 agcctgttct catctgccag atcctaccaa agaatccaaa tcttccctga caaatatgg 420 aacgtaacgt acagcggtac atccaaagct tgttcagatt ctttctatag atcaatgcgc 480 tggctcactc aaaagaacaa tgcttaccca atccaagatg cccagtatac caacaatcag 540 gaaaagaaca tcctttttat gtggggaatt aatcaccctc caacggacac agtccaaact 600 aatctgtaca ctcgtaccga tacaactacc tctgtagcca cggagaagat aaaccgtaca 660 ttcaaacctt taatcggccc gaggcccttg gtgaatggtc tccaaggaag aattgactac 720 tattggtcgg ttcttaagcc gggtcagacg ctgcgtataa ggagtaacgg aaatttaatc 780 gctccctggt acggccacat tctttcgggc gaaagtcatg gtagaatatt aaagaccgat 840 cttaagcgcg gcagctgcac ggtccaatgt cagacagaga agggcggtct gaacacgaca 900 ttgccgttcc agaatgtatc caaatacgca tttggtaact gctcgaagta tattggtatc 960 aaaagtttga agctcgcggt gggactcaga aatgttccct cgcgtagctc caggggctta 1020 ttcggtgcaa tagcgggttt tatcgaagga ggctggtcag gactcgtggc aggatggtac 1080 ggcttccaac actctaacga ccagggcgtt ggtatggctg ccgacaggga ttcaacgcaa 1140 aaagccatcg ataagataac atctaaggtc aacaacatag tagacaaaat gaacaagcag 1200 tacgaaatca ttgatcatga gttttcagaa gtggaggcta gactgaacat gatcaacaac 1260 aaaatcgacg atcaaataca ggacatctgg gcttataacg ccgaactgtt ggttctctta 1320 gagaatcaaa agaccttgga cgaacacgat gctaacgtca acaacttgta caacaaagta 1380 aagagagcac tcggatcgaa cgcggtggaa gacggaaaag gctgtttcga gttgtatcat 1440 aagtgcgata atcagtgtat ggaaactatt cgcaacggca cctacaatag acgcaaatat 1500 caagaagaga gtaagctcga acgtcagaaa atagagggcg ttaagctgga aagcgagggt 1560 acatacaaga tttccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1620 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1680 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1740 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1800 cacaagttcg agggtctgac tcaatctc cagaaggcct acgaacacga gcagcacacga 1860 tctgaatcaa cgtggaccac gctatcaga gcaaggacca cgccactttc 1920 aacttcctgc aatgtacgt ggctgagcag cacgaggaag aggtcctgtt caggacatc 1980 ctggacaaga tcgaacgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2040 gtcaagggca tcgccaagtc ccgcaaggc taa 2073 <210> 17 <211> 730 <212> PRT <213> Artificial sequence <400> 17 Met Glu Lys Ile Val Leu Phe Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp Contains Cys Contains Gly Tyr Only Asn Asn Served Thr Glu Gln Val 20 25 30 Asp Thr Met Glu Lys Asn Value Only Gln Asp 35 40 45 Leu Glu Lys Thr His and Gly Lys Leu Cys Asp Leu Asn Gly Val Lys 50 55 60 Pro Leu Leu Lys Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 115 120 125 Lys Ile Gln Ile Ile Pro Lys Asp Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ala Ala Cys Pro Tyr Gln Gly Asn Ser Ser Phe Phe 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asp Asn Ala Tyr Pro Thr Ile 165 170 175 Lys Lys Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Ile Leu Trp 180 185 190 Gly Ile His His Pro Asn Asp Glu Ala Glu Gln Thr Arg Leu Tyr Gln 195 200 205 Asn Pro Thr Thr Tyr Val Ser Ile Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Ile Asp Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Val Glu Tyr Gly 275 280 285 Asn Cys Asn Thr Arg Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Arg Glu Gly Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 340 345 350 Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 355 360 365 Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln 370 375 380 Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys 385 390 395 400 Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 405 410 415 Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 420 425 430 Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 435 440 445 Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 450 455 460 Arg Leu Gln Leu Lys Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 465 470 475 480 Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn 485 490 495 Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg 500 505 510 Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Ile Tyr Gln Ile 515 520 525 Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Ala Ile Met 530 535 540 Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys 545 550 555 560 Arg Ile Cys Ile Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln 565 570 575 Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser 580 585 590 Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp 595 600 605 His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu 610 615 620 Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu 625 630 635 640 His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His 645 650 655 Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val Asp His Ala Ile 660 665 670 Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala 675 680 685 Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile 690 695 700 Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu Ala Asp Gln Tyr 705,710,715,720 Val Lys Gly Ile Ala Lys Ser Arg Lys Ser 725 730 <210> 18 <211> 2193 <212> DNA <213> Artificial sequence <400> 18 atggaaaaaa tcgtgctgct gttcgcaatc gtgagcctgg tgaagagtga ccatatctgt 60 atcgggtatc atgctaataa ttctactgaa caggtggata ccattatgga gaagaacgtg 120 actgtgaccc acgctcagga catcctggag aaacacata acggcaagct gtgcgatctg 180 aatggagtga aacccctgat cctgaaggac tgctcagtgg caggctggct gctgggaaac 240 cccatgtgtg atgagttcat caatgtgcct gaatggtcct acattgtgga gaaagccaac 300 cctgctaatg atctgtgcta cccaggcaac ttcaatgact atgaggaact gaagcacctg 360 ctgtccagaa tcaaccattt cgaaaagatc cagatcattc ccaaggattc ttggcctgac 420 cacgaggcct cactgggtgt gagtgccgct tgtccatacc agggaaacag ctccttcttt 480 aggaatgtgg tgtggctgat taagaaagac aacgcttacc ccactatcaa gaaatcttac 540 aaaacacca accaggaga tctgctgatt ctgtgggggaa tccaccatcc aaacgacgag 600 ggaaagaga cacgcctgta ccagaatccc accacatatg tgagcattgg gacatccact 660 ctgaaccagc gcctggtgcc taaaatcgca actcggtcca aggtgaacgg ccagtctgga 720 cggatcgatt tcttttggac cattctgaag cctaacgacg ccatcaattt cgaatccaac 780 ggcaatttta tcgcaccaga gtacgcctac aagatcgtga aagaagaga ttctactatc 840 atgaagtcag aggtggata cgggaactgc aatacccgct gtcagacacc aatcggtgcc 900 attaactctt caatgccatt tcacaatatc catcccctga caattgggga gtgccccaag 960 tatgtgaaaa gcaacaagct ggtgctggct actggtctga gaacagccc tcagagggag 1020 ggtaggggtc tgttcggggc tatcgcaggt tttattgagg gcggatggca gggaatggtg 1080 gatgggtggt acggttatca ccatagtaac gaacagggca gcggatacgc agccgataaa 1140 gagagtacac agaaggccat tgacggagtg actaacaaag tgaatagcat cattgacaag 1200 atgaacaccc agttcgaggc tgtggggagg gaatttaaca atctggagag aaggatcgaa 1260 aacctgaata agaaaatgga agatggcttc ctggacgtgt ggacctacaa cgcagagctg 1320 ctggtgctga tggagaatga aagaacactg gattttcacg acagcaacgt gaaaaatctg 1380 tatgataaag tgaggctcca gctgaaagac aacgccaagg aactggggaa tggttgtttc 1440 gagttttacc ataagtgcga taacgagtgt atggaatctg tgagaaatgg cacttacgac 1500 tatcctcagt attcagagga agctagactg aaaagggagg aaatttcagg ggtgaagctg 1560 gagagtatcg gtatttacca gatcctgtcc atttattcta ccgtggctag tagcctggtg 1620 ctggcaatca tgatggctgg gctgtccctg tggatgtgta gcaatggaag tctccagtgt 1680 cggatttgta tctccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1740 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1800 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1860 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1920 cacaagttcg agggtctgac tcaatctc cagaaggcct acgaacacga gcagcacacga 1980 tctgaatcaa tcacacat cgtggaccac gctatcaga gcaaggacca cgccactttc 2040 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caggacatc 2100 ctggacaaga tcgaacgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2160 gtcaagggca tcgccaagtc ccgcaaggc taa 2193 <210> 19 <211> 690 <212> PRT <213> Artificial sequence <400> 19 Met Glu Will Be Leu Ile Thr Ile Leu Leu Will Thr Will Be 1 5 10 15 Asn Only Asp Lys Ile Cys Ile Gly Tyr Gln Serve Thr Asn Serve Three Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asp Val Pro Val Thr His Thr Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Gly Leu 50 55 60 Gly His Pro With Asp Thr Cys Thr With Glu Gly With Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Thr Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His 180 185 190 Pro Pro Thr Asp Thr Val Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Gln Gly Arg Ile Asp Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Arg Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Ala Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asn Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Ser Gly Gly Asp 515 520 525 Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser 530 535 540 Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp 545 550 555 560 Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His 565 570 575 Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln 580 585 590 Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln 595 600 605 Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile 610 615 620 Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe 625 630 635 640 Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu 645 650 655 Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His 660 665 670 Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg 675 680 685 Lys Ser 690 <210> 20 <211> 2073 <212> DNA <213> Artifical sequence <400> 20 atggaagtag taagtctgat aaccattctg ctcgtcgtca ccgtctcaaa cgctgataaa 60 atctgcatcg gctaccaatc cacaaatagc actgaaaccg tggacacgct gacagagaac 120 gatgtgccgg ttactcacac caaagaactg ttgcacaccg agcataacgg tatgctctgc 180 gccactggtt taggacatcc tcttatcctg gacacttgca ccatcgaagg tttaatttac 240 ggaaacccat cctgtgatct cttacttggt ggacgtgaat ggtcatacat tgtggagagg 300 ccttctgctg ttaatggact ttgctatcca ggcaacgtcg agaatttaga agagcttcgc 360 agcctgttct catctgccag atcctaccaa agaatccaaa tcttccctga cacaatatgg 420 aacgtaacgt acagcggtac atccaaagct tgttcagatt ctttctatag atcaatgcgc 480 tggctcactc aaaagaacaa tgcttaccca atccaagatg cccagtatac caacaatcag 540 gaaaagaaca tcctttttat gtggggaatt aatcaccctc caacggacac agtccaaact 600 aatctgtaca ctcgtaccga tacaactacc tctgtagcca cggaagagat aaaccgtaca 660 ttcaaacctt taatcggccc gaggcccttg gtgaatggtc tccaaggaag aattgactac 720 tattggtcgg ttcttaagcc gggtcagacg ctgcgtata ggagtaacgg aaatttaatc gctccctggt acggccacat tctttcgggc gaaagtcatg gtagaatatt aaagaccgat cttaagcgcg gcagctgcac ggtccaatgt cagacagaga agggcggtct gaacacgaca ttgccgttcc agaatgtatc caatacgca tttggtaact gctcgaagta tattggtatc aaaagtttga agctcgcggt gggactcaga aatgttccct cgcgtagctc caggggctta ttcggtgcaa tagcgggttt tatcgaagga ggctggtcag gactcgtggc aggatggtac 1080 ggcttccaac actctacga ccaggggcgtt ggtatggctg ccgacaggga ttcaacgcaa aaagccatcg father atctaaggtc aacaacatag tagcaaaat gaacaagcag 1260. ttgaatca ttgatcatga gttttcagaa gtggaggcta gactgaacat gatcaacaac 1320. aaaatcgacg atcaaataca ggacatctgg gcttataacg ccgaactgtt ggttctctta gagaatcaaa agaccttgga cgaacacgat gctaacgtca acaacttgta caacaaagta aagagagcac tcggatcga cgcggtgga gacggaaaag gctgtttcga gttgtatcat aagtgcgata atcagtgtat ggaaactatt cgcaacggca cctacaatag acgcaaatat 1500 caagaagaga gtaagctcga acgtcagaaa atagagggcg ttaagctgga aagcgagggt 1560 acatacaaga ttccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1620 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1680 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1740 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1800 cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 1860 tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 1920 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 1980 ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2040 gtcaagggca tcgccaagtc ccgcaagagc taa 2073 <210> 21 <211> 730 <212> PRT <213> Artificial sequence <400> 21 Met Glu Lys Ile Val Leu Leu Phe Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp His Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val 20 25 30 Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile 35 40 45 Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asn Gly Val Lys 50 55 60 Pro Leu Ile Leu Lys Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 115 120 125 Lys Ile Gln Ile Ile Pro Lys Asp Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ala Ala Cys Pro Tyr Gln Gly Asn Ser Ser Phe Phe 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asp Asn Ala Tyr Pro Thr Ile 165 170 175 Lys Lys Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Ile Leu Trp 180 185 190 Trp Ile His His Pro Asn Asp Glu Ala Glu Gln Thr Arg Leu Tyr Gln 195 200 205 Asn Pro Thr Thr Tyr Val Ser Ile Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Ile Asp Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Val Glu Tyr Gly 275 280 285 Asn Cys Asn Thr Arg Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Arg Glu Gly Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 340 345 350 Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 355 360 365 Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln 370 375 380 Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys 385 390 395 400 Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 405 410 415 Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 420 425 430 Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 435 440 445 Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 450 455 460 Arg Leu Gln Leu Lys Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 465 470 475 480 Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn 485 490 495 Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg 500 505 510 Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Ile Tyr Gln Ile 515 520 525 Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Ala Ile Met 530 535 540 Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys 545 550 555 560 Arg Ile Cys Ile Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln 565 570 575 Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser 580 585 590 Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp 595 600 605 His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu 610 615 620 Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu 625 630 635 640 His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His 645,650,655 Glu Gln His Protein Ser Glu Ser Protein Asn Protein Val Asp Protein Protein 660,665,670 Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala 675,680,685 Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile 690,695,700 Leu Glu With Gly Asn Glu Asn His Gly Leu Tyr Leu Asp Gln Tyr 705 710 715 720 Val Lys Gly Ile Ala Lys Ser Arg Lys Ser 725,730 <210> 22 <211> 2193 <212> DNA <213> Artificial sequence <400> 22 atggaaaaaa tcgtgctgct gttcgcaatc gtgagcctgg tgaagagtga ccatatctgt 60 atcgggtatc atgctaataa ttctactgaa caggtggata ccattatgga gagaacgtg 120 actgtgaccc acgctcagga catcctggag aaaacacata acggcaagct gtgcgatctg 180 aatggagtga aacccctgat cctgaaggac tgctcagtgg caggctggct gctgggaaac 240 cccatgtgtg atgagttcat caatgtgcct gaatggtcct acattgtgga gaagccaac 300 cctgctaatg atctgtgcta cccaggcaac ttcaatgact atgaggaact gaagcacctg 360 ctgtccagaa tcaaccattt cgaaaagatc cagatcattc ccaaggattc ttggcctgac 420 cacgaggcct cactgggtgt gagtgccgct tgtccatacc agggaaacag ctccttcttt 480 aggaatgtgg tgtggctgat taagaaagac aacgcttacc ccactatcaa gaaatcttac 540 aaaacacca accaggag tctgctgatt ctgtggtgga tccaccatcc aaacgacgag 600 ggaaagaga cacgcctgta ccagaatccc accacatatg tgagcattgg gacatccact 660 ctgaaccagc gcctggtgcc taaaatcgca actcggtcca aggtgaacgg ccagtctgga 720 cggatcgatt tcttttggac cattctgaag cctaacgacg ccatcaattt cgaatccaac 780 ggcaatttta tcgcaccaga gtacgcctac aagatcgtga aagaagaga ttctactatc 840 atgaagtcag aggtggata cgggaactgc aatacccgct gtcagacacc aatcggtgcc 900 attaactctt caatgccatt tcacaatatc catcccctga caattgggga gtgccccaag 960 tatgtgaaaa gcaacaagct ggtgctggct actggtctga gaaacagccc tcagagggag 1020 ggtaggggtc tgttcggggc tatcgcaggt tttattgagg gcggatggca gggaatggtg 1080 gatgggtggt acggttatca ccatagtaac gaacagggca gcggatacgc agccgataaa 1140 gagagtacac agaaggccat tgacggagtg actaacaaag tgaatagcat cattgacaag 1200 atgaacaccc agttcgaggc tgtggggagg gaatttaaca atctggagag aaggatcgaa 1260 aacctgaata agaaaatgga agatggcttc ctggacgtgt ggacctacaa cgcagagctg 1320 ctggtgctga tggagaatga aagaacactg gattttcacg acagcaacgt gaaaaatctg 1380 tatgataaag tgaggctcca gctgaaagac aacgccaagg aactggggaa tggttgtttc 1440 gagttttacc ataagtgcga taacgagtgt atggaatctg tgagaaatgg cacttacgac 1500 tatcctcagt attcagagga agctagactg aaaagggagg aaatttcagg ggtgaagctg 1560 gagagtatcg gtatttacca gatcctgtcc atttattcta ccgtggctag tagcctggtg 1620 ctggcaatca tgatggctgg gctgtccctg tggatgtgta gcaatggaag tctccagtgt 1680 cggatttgta tctccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1740 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1800 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1860 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1920 cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 1980 tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 2040 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 2100 ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2160 gtcaagggca tcgccaagtc ccgcaagagc taa 2193 <210> 23 <211> 690 <212> PRT <213> Artificial sequence <400> 23 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Ser Asp Val Pro Val Thr His Thr Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Gly Leu 50 55 60 Gly His Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Thr Tyr 130 135 140 Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr 165 170 175 Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile His Gln 180 185 190 Pro Pro Thr Glu Thr Val Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr 195 200 205 Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu 210 215 220 Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Gln Gly Arg Ile Asp Tyr 225 230 235 240 Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Arg Ser Asn 245 250 255 Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser 260 265 270 His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val 275 280 285 Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln 290 295 300 Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile 305 310 315 320 Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser 325 330 335 Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp 340 345 350 Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln 355 360 365 Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Ala Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Ser Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asn Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Ser Gly Gly Asp 515 520 525 Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser 530 535 540 Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp 545 550 555 560 Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His 565 570 575 Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln 580 585 590 Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln 595 600 605 Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile 610 615 620 Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe 625 630 635 640 Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu 645,650,655 Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His 660 665 670 Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg 675 680 685 Lys Ser 690 <210> 24 <211> 2073 <212> DNA <213> Artificial sequence <400> 24 atggaagtag taagtctgat aaccattctg ctcgtcgtca ccgtctcaaa cgctgataaa 60 atctgcatcg gctaccaatc cacaatagc actgaaaccg tggacacgct gacagagagt 120 gatgtgccgg ttactcacac caaagaactg ttgcacaccg agcataacgg tatgctctgc 180 gccactggtt taggacatcc tcttatcctg gacacttgca ccatcgaagg tttaatttac 240 ggaaacccat cctgtgatct cttacttggt ggacgtgaat ggtcatacat tgtggagagg 300 ccttctgctg ttaatggact ttgctatcca ggcaacgtcg agaatttaga agagcttcgc 360 agcctgttct catctgccag atcctaccaa agaatccaaa tcttccctga caaatatgg 420 aacgtaacgt acagcggtac atccaaagct tgttcagatt ctttctatag atcaatgcgc 480 tggctcactc aaaagaacaa tgcttaccca atccaagatg cccagtatac caacaatcag 540 gaaaagaaca tcctttttat gtgggggaatt caccaacctc caacggaaac agtccaaact 600 aatctgtaca ctcgtaccga tacaactacc tctgtagcca cggagaagat aaaccgtaca 660 ttcaaacctt taatcggccc gaggcccttg gtgaatggtc tccaaggaag aattgactac 720 tattggtcgg ttcttaagcc gggtcagacg ctgcgtataa ggagtaacgg aaatttaatc 780 gctccctggt acggccacat tctttcgggc gaaagtcatg gtagaatatt aaagaccgat 840 cttaagcgcg gcagctgcac ggtccaatgt cagacagaga agggcggtct gaacacgaca 900 ttgccgttcc agaatgtatc caaatacgca tttggtaact gctcgaagta tattggtatc 960 aaaagtttga agctcgcggt gggactcaga aatgttccct cgcgtagctc caggggctta 1020 ttcggtgcaa tagcgggttt tatcgaagga ggctggtcag gactcgtggc aggatggtac 1080 ggcttccaac actctaacga ccagggcgtt ggtatggctg ccgacaggga ttcaacgcaa 1140 aaagccatcg ataagataac atctaaggtc aacaacatag tagacaaaat gaacaagcag 1200 tacgaaatca ttgatcatga gttttcagaa gtggaggcta gactgaacat gatcaacaac 1260 aaaatcgacg atcaaataca ggacatctgg gcttataacg ccgaactgtt ggttctctta 1320 gagaatcaaa agaccttgga cgaacacgat gctaacgtca acaacttgta caacaaagta 1380 aagagagcac tcggatcgaa cgcggtggaa gacggaaaag gctgtttcga gttgtatcat 1440 aagtgcgata atcagtgtat ggaaactatt cgcaacggca cctacaatag acgcaaatat 1500 caagaagaga gtaagctcga acgtcagaaa atagagggcg ttaagctgga aagcgagggt 1560 acatacaaga tttccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1620 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1680 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1740 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1800 cacaagttcg agggtctgac tcaatctc cagaaggcct acgaacacga gcagcacacga 1860 tctgaatcaa cgtggaccac gctatcaga gcaaggacca cgccactttc 1920 aacttcctgc aatgtacgt ggctgagcag cacgaggaag aggtcctgtt caggacatc 1980 ctggacaaga tcgaacgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 2040 gtcaagggca tcgccaagtc ccgcaaggc taa 2073 <210> 25 <211> 730 <212> PRT <213> Artificial sequence <400> 25 Met Glu Lys Ile Val Leu Phe Ala Ile Val Ser Leu Val Lys Ser 1 5 10 15 Asp Contains Cys Contains Gly Tyr Only Asn Asn Served Thr Glu Gln Val 20 25 30 Asp Thr Met Glu Lys Asn with Thr Value Only Gln Asp 35 40 45 To Glu Arg Thr and Gly Arg To Cys Asp To Gly Val Lys 50 55 60 Pro Leu Leu Lys Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn 65 70 75 80 Pro Met Cys Asp Glu Phe Ile Asn Val Pro Glu Trp Ser Tyr Ile Val 85 90 95 Glu Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn 100 105 110 Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu 115 120 125 Lys Ile Gln Ile Ile Pro Lys Asp Ser Trp Pro Asp His Glu Ala Ser 130 135 140 Leu Gly Val Ser Ala Ala Cys Pro Tyr Gln Gly Asn Ser Ser Phe Phe 145 150 155 160 Arg Asn Val Val Trp Leu Ile Lys Lys Asp Asn Ala Tyr Pro Thr Ile 165 170 175 Lys Lys Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Ile Met Trp 180 185 190 Trp Ile His His Pro Asn Asp Glu Ala Glu Gln Thr Arg Leu Tyr Gln 195 200 205 Asn Pro Thr Thr Tyr Val Ser Ile Gly Thr Ser Thr Leu Asn Gln Arg 210 215 220 Leu Val Pro Lys Ile Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly 225 230 235 240 Arg Ile Asp Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn 245 250 255 Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Tyr Ala Tyr Lys Ile 260 265 270 Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Val Glu Tyr Gly 275 280 285 Asn Cys Asn Thr Arg Cys Gln Thr Pro Ile Gly Ala Ile Asn Ser Ser 290 295 300 Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys 305 310 315 320 Tyr Val Lys Ser Asn Lys Leu Val Leu Ala Thr Gly Leu Arg Asn Ser 325 330 335 Pro Gln Arg Glu Gly Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile 340 345 350 Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr Gly Tyr His His 355 360 365 Ser Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Lys Glu Ser Thr Gln 370 375 380 Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser Ile Ile Asp Lys 385 390 395 400 Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe Asn Asn Leu Glu 405 410 415 Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp Gly Phe Leu Asp 420 425 430 Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met Glu Asn Glu Arg 435 440 445 Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Asp Lys Val 450 455 460 Arg Leu Gln Leu Lys Asp Asn Ala Lys Glu Leu Gly Asn Gly Cys Phe 465 470 475 480 Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Val Arg Asn 485 490 495 Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala Arg Leu Lys Arg 500 505 510 Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly Ile Tyr Gln Ile 515 520 525 Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Ala Ile Met 530 535 540 Met Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly Ser Leu Gln Cys 545 550 555 560 Arg Ile Cys Ile Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln 565 570 575 Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser 580 585 590 Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp 595 600 605 His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu 610 615 620 Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu 625 630 635 640 His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His 645 650 655 Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val Asp His Ala Ile 660 665 670 Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala 675 680 685 Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile 690 695 700 Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu Ala Asp Gln Tyr 705,710,715,720 Val Lys Gly Ile Ala Lys Ser Arg Lys Ser 725 730 <210> 26 <211> 2193 <212> DNA <213> Artificial sequence <400> 26 atggaaaaaa tcgtgctgct gttcgcaatc gtgagcctgg tgaagagtga ccatatctgt 60 atcgggtatc atgctaataa ttctactgaa caggtggata ccattatgga gaagaacatt 120 actgtgaccc acgctcagga catcctggag cgcacacata acggccgcct gtgcgatctg 180 aatggagtga aacccctgat cctgaaggac tgctcagtgg caggctggct gctgggaaac 240 cccatgtgtg atgagttcat caatgtgcct gaatggtcct acattgtgga gaaagccaac 300 cctgctaatg atctgtgcta cccaggcaac ttcaatgact atgaggaact gaagcacctg 360 ctgtccagaa tcaaccattt cgaaaagatc cagatcattc ccaaggattc ttggcctgac 420 cacgaggcct cactgggtgt gagtgccgct tgtccatacc agggaaacag ctccttcttt 480 aggaatgtgg tgtggctgat taagaaagac aacgcttacc ccactatcaa gaaatcttac 540 aaaacacca accaggag tctgctgatt agttggtgga tccaccatcc aaacgacgag 600 ggaaagaga cacgcctgta ccagaatccc accacatatg tgagcattgg gacatccact 660 ctgaaccagc gcctggtgcc taaaatcgca actcggtcca aggtgaacgg ccagtctgga 720 cggatcgatt tcttttggac cattctgaag cctaacgacg ccatcaattt cgaatccaac 780 ggcaatttta tcgcaccaga gtacgcctac aagatcgtga aagaagaga ttctactatc 840 atgaagtcag aggtggata cgggaactgc aatacccgct gtcagacacc aatcggtgcc 900 attaactctt caatgccatt tcacaatatc catcccctga caattgggga gtgccccaag 960 tatgtgaaaa gcaacaagct ggtgctggct actggtctga gaacagccc tcagagggag 1020 ggtaggggtc tgttcggggc tatcgcaggt tttattgagg gcggatggca gggaatggtg 1080 gatgggtggt acggttatca ccatagtaac gaacagggca gcggatacgc agccgataaa 1140 gagagtacac agaaggccat tgacggagtg actaacaaag tgaatagcat cattgacaag 1200 atgaacaccc agttcgaggc tgtggggagg gaatttaaca atctggagag aaggatcgaa 1260 aacctgaata agaaaatgga agatggcttc ctggacgtgt ggacctacaa cgcagagctg 1320 ctggtgctga tggagaatga aagaacactg gattttcacg acagcaacgt gaaaaatctg 1380 tatgataaag tgaggctcca gctgaaagac aacgccaagg aactggggaa tggttgtttc 1440 gagttttacc ataagtgcga taacgagtgt atggaatctg tgagaaatgg cacttacgac 1500 tatcctcagt attcagagga agctagactg aaaagggagg aaatttcagg ggtgaagctg 1560 gagagtatcg gtatttacca gatcctgtcc atttattcta ccgtggctag tagcctggtg 1620 ctggcaatca tgatggctgg gctgtccctg tggatgtgta gcaatggaag tctccagtgt 1680 cggatttgta tctccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 1740 atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 1800 ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 1860 atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 1920 1980 tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 2040 aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 2100 2160 gtcaagggca tcgccaagtc ccgcaagagc taa 2193

Claims

1. A nanoantigen particle comprising a consensus sequence of a fusion protein, characterized in that: The amino acid sequence of the fusion protein is shown in SEQ ID NO.9, and the amino acid sequence of the consensus sequence of the fusion protein is selected from any one of the following (1)-(4): (1) The amino acid sequence is shown in SEQ ID NO.13, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.14; (2) a single-site mutant obtained by subjecting the amino acid sequence of SEQ ID NO. 13 to any one of V40I, K51R, K56R, V190I, L191M or G193W single-site mutations; (3) a double-site mutant obtained by performing any one of the double-site mutations of V40I-K51R, K51R-V190I or V190I-G193W on the amino acids shown in SEQ ID NO. 13; (4) A multi-site mutant obtained by multi-site mutation of the amino acid sequence shown in SEQ ID NO.13 according to V40I-K51R-K56R-V190I-L191M-G193W, the amino acid sequence of the multi-site mutant is shown in SEQ ID NO.25, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.

26.

2. Use of the nano antigen particle according to claim 1 in preparing influenza vaccine.

3. The use according to claim 2, characterized in that include: Expressing the coding gene of the consensus sequence of the fusion protein of claim 1 in an Escherichia coli prokaryotic expression system, and collecting and purifying the expressed antigen; Alternatively, the coding gene of the consensus sequence of the fusion protein of claim 1 is expressed in a silkworm expression system, and the expressed antigen is collected and purified; Alternatively, the coding gene of the consensus sequence of the fusion protein of claim 1 is expressed in the AcMNPV-insect cell eukaryotic expression system, and the expressed antigen is collected and purified; Alternatively, the coding gene of the consensus sequence of the fusion protein of claim 1 is cloned into a baculovirus mammalian expression vector to obtain a recombinant baculovirus; and the recombinant baculovirus is used to present the gene in vertebrate tissues to produce antigens.

4. The use according to claim 3, characterized in that The coding gene of the consensus sequence of the fusion protein is constructed into a Bombyx mori bacilli expression vector to prepare a recombinant Bombyx mori baculovirus; and the recombinant Bombyx mori baculovirus is expressed in Bombyx mori or silkworm pupae; Alternatively, the coding gene of the consensus sequence of the fusion protein is cloned into a baculovirus transfer vector to construct a recombinant baculovirus transfer vector; the recombinant baculovirus transfer vector and baculovirus DNA are co-transfected into insect cells to obtain recombinant baculovirus; the recombinant baculovirus is expressed in insect cells or insect hosts, and purified to obtain the antigen.

5. An influenza vaccine, characterized in that: The method comprises an effective amount of the nano antigen particle according to claim 1 and a pharmaceutically acceptable adjuvant or carrier.

Images