Compositions and methods for inhibiting pcsk9

Abstract

This article provides, in particular, dsRNA compositions targeting PCSK9, methods for inhibiting PCSK9 gene expression, and methods for treating one or more diseases associated with PCSK9 gene expression.

Description

Technical Field

[0001] This disclosure relates to dsRNA compositions targeting the proteoproteotransferase Kexin 9 (PCSK9), methods for inhibiting PCSK9 gene expression, and methods for treating one or more diseases associated with PCSK9 gene expression.

[0002] Submission of sequence list

[0003] The nucleic acid sequences disclosed in this specification are used for reference. The same sequences are also presented in a sequence listing formatted according to standard requirements for patent purposes. If any sequence differences exist from the standard sequence listing, the sequence described in this specification should be used as a reference. Background Technology

[0004] PCSK9 is a member of the subtilisin serine protease family. The other eight mammalian subtilisin proteases, PCSK1-8, are proteoproteases that process a variety of proteins in the secretory pathway and play a role in a variety of biological processes. PCSK9 has been proposed to play a role in cholesterol metabolism. PCSK9 messenger RNA (mRNA) expression is downregulated in mice by dietary cholesterol feeding (Maxwell, KN (2003) J. Lipid Res. 44, 2109-2119), upregulated in HepG2 cells by statins (Duboc, G. (2004) Arterioscler. Thromb. Vasc. Biol. 24, 1454-1459), and upregulated in sterol regulatory element-binding protein (SREBP) transgenic mice (Horton, JD (2003) PNAS 100 12027-12032), which is similar to cholesterol biosynthetic enzymes and low-density lipoprotein receptor (LDLR). Furthermore, PCSK9 missense mutations have been found to be associated with the form of autosomal dominant hypercholesterolemia (Abifadel, M. (2003) Nat. Genet. 34, 154-156; Timms, KM (2004) Hum. Genet. 114, 349-353; Leren, TP (2004) Clin. Genet. 65, 419-422). Since single nucleotide polymorphisms (SNPs) have been associated with cholesterol levels in the Japanese population, PCSK9 may also play a role in determining low-density lipoprotein (LDL) cholesterol levels in the general population (Shioji, K. (2004) J. Genet. 49, 109-114).

[0005] Autosomal dominant hypercholesterolemia (ADH) is a monogenic disorder in which patients exhibit elevated total cholesterol and LDL cholesterol levels, tendon xanthomas, and premature atherosclerosis (Rader, DJ (2003) J. Clin. Invest. 111, 1795-1803). The pathogenesis of ADH and its recessive form, autosomal recessive hypercholesterolemia (ARH) (Cohen, JC (2003) Curr. Opin. Lipidol. 14, 121-127) is due to defects in hepatic LDL uptake. Mutations in LDLR that impair LDL uptake or mutations in apolipoprotein B, a protein on LDL that binds to LDLR, can lead to ADH. ARH is caused by mutations in the low-density lipoprotein receptor adaptor protein 1 (LDLRAP1), a protein essential for the endocytosis of the LDLR-LDL complex via its interaction with clathrin.

[0006] Overexpression studies have indicated the role of PCSK9 in controlling LDLR levels and therefore in controlling hepatic LDL uptake (Maxwell, KN (2004) PNAS 101, 7100-7105; Benjannet, S. et al. (2004) J. Biol. Chem. 279, 48865-48875; Park, SW (2004) J. Biol. Chem. 279, 50630-50638). Adenovirus-mediated overexpression of PCSK9 in mice or humans leads to elevated total cholesterol and LDL cholesterol levels; however, this effect was not observed in LDLR knockout animals (Maxwell, KN (2004) PNAS 101, 7100-7105; Benjannet, S. et al. (2004) J. Biol. Chem. 279, 48865-48875; Park, SW (2004) J. Biol. Chem. 279, 50630-50638). Furthermore, PCSK9 overexpression results in a severe reduction in hepatic LDLR protein without affecting LDLR mRNA levels, SREBP protein levels, or the ratio of nuclear to cytoplasmic SREBP protein.

[0007] Loss-of-function mutations of PCSK9 have been engineered in mouse models (Rashid et al. (2005) PNAS, 102, 5374-5379) and have also been identified in human individuals (Cohen et al. (2005) Nature Genetics 37: 161-165). In both cases, PCSK9 loss of function leads to a decrease in total LDL cholesterol (LDL-C). The effects of lifetime reductions in plasma LDL-C associated with sequence alterations in the PCSK9 gene have been investigated, and data indicate that a moderate lifetime reduction in plasma LDL-C levels is associated with a significant reduction in the incidence of coronary events and confers protection against coronary heart disease (Cohen et al. (2006) N. Engl. J. Med. 354: 1264-1272).

[0008] Double-stranded RNA molecules (dsRNAs) have been shown to block gene expression through a highly conserved regulatory mechanism known as RNA interference (RNAi). WO 99 / 32619 discloses the use of dsRNAs of at least 25 nucleotides in length to inhibit gene expression in *C. elegans*. dsRNAs have also been shown to degrade target RNAs in other organisms, including plants (see, for example, WO 99 / 53050; WO 99 / 61631), fruit flies (see, for example, Yang, D. et al. (2000) Curr. Biol. 10:1191-1200), and mammals (see, for example, WO 00 / 44895). This natural mechanism has now become a focus of research in developing new classes of agents for treating disorders caused by abnormal or unintended gene regulation.

[0009] Given the importance of PCSK9 in regulating LDL cholesterol and the prevalence of cardiovascular diseases such as hypercholesterolemia, there is an ongoing need to identify inhibitors of PCSK9 expression (such as dsRNA) and to test the efficacy and undesirable side effects (such as cytotoxicity) of such inhibitors.

[0010] All references cited in this article, including patent applications, patent publications, non-patent literature, and UniProtKB / Swiss-Prot accessions, are incorporated herein by reference in their entirety, as if each individual reference were specifically and individually indicated to be incorporated by reference. Summary of the Invention

[0011] To meet these and other needs, this article provides a double-stranded ribonucleic acid (dsRNA) that can be used to inhibit the expression of the proteoproteotransferase Kexin 9 (PCKS9) gene.

[0012] Therefore, in one aspect, this document provides a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first sequence is complementary to the second sequence, and wherein the first sequence comprises a sequence selected from SEQ ID NO:6-11 and 310-321.

[0013] According to another aspect, this disclosure provides a double-stranded ribonucleic acid (dsRNA) comprising a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first sequence is complementary to the second sequence, wherein the first sequence comprises a sequence selected from SEQ ID NO: 6-11 and 310-321, wherein the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and wherein the dsRNA optionally inhibits the expression of the proteoproteotransferase subtilisin Kexin 9 (PCSK9) gene.

[0014] In another embodiment, this disclosure provides a double-stranded ribonucleic acid (dsRNA) comprising a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first sequence is complementary to the second sequence, wherein the first sequence comprises a sequence selected from SEQ ID NO: 6-11 and 310-321, wherein the selected sequence comprises less than 30% GC, wherein the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and wherein the dsRNA optionally inhibits the expression of the proteoproteotransferase subtilisin Kexin 9 (PCSK9) gene.

[0015] In some embodiments, the dsRNA comprises (1) UUUUAUUAAUAUGGUGACU (SEQ ID NO: 6) in the sense strand and AGUCACCAUAUUAAUAAAA (SEQ ID NO: 373) in the antisense strand; (2) UAUUAAUAUGGUGACUUUU (SEQ ID NO: 7) in the sense strand and AAAAGUCACCAUAUUAAUA (SEQ ID NO: 374) in the antisense strand; (3) AUUAAUAUGGUGACUUUUU (SEQ ID NO: 8) in the sense strand and AAAAAGUCACCAUAUUAAU (SEQ ID NO: 375) in the antisense strand; (4) UUAAUAUGGUGACUUUUUA (SEQ ID NO: 9) in the sense strand and UAAAAAGUCACCAUAUUAA (SEQ ID NO: 376) in the antisense strand; (5) UAAUAUGGUGACUUUUUAA (SEQ ID NO: 373) in the sense strand. (6) UUAAAAAGUCACCAUAUUA in the sense chain (SEQ ID NO: 10) and UUAAAAAGUCACCAUAUUA in the antisense chain (SEQ ID NO: 377); (7) UUAUUAAUAUGGUGACUUUUUAAAAU in the sense chain (SEQ ID NO: 11) and AUUUUAAAAAGUCACCAUA in the antisense chain (SEQ ID NO: 378); (8) UUAUUAAUAUGGUGACUUU in the sense chain (SEQ ID NO: 310) and AAAGUCACCAUAUUAAUAA in the antisense chain (SEQ ID NO: 380); (9) AUUUUUAUUAAUAUAUGGUGACU in the sense chain (SEQ ID NO: 312) and AGUCACCAUAUUAAUAAAAAU in the antisense chain (SEQ ID NO: 381); NO:382); (10) UUUUAUUAAUAUGGUGACUUU in the sense chain (SEQ ID NO:313) and AAAGUCACCAUAUUAAUAAAA in the antisense chain (SEQ ID NO:383); (11) UUUAUUAAUAUGGUGACUUUU in the sense chain (SEQ ID NO:314) and AAAAGUCACCAUAUUAAUAAAA in the antisense chain (SEQ ID NO:384);(12) UAUUAAUAUGGUGACUUUUUA in the sense chain (SEQ ID NO: 315) and UAAAAAGUCACCAUAUUAAUA in the antisense chain (SEQ ID NO: 385); (13) AAUAUGGUGACUUUUUAAAAU in the sense chain (SEQ ID NO: 316) and AUUUUAAAAAGUCACCAUAUU in the antisense chain (SEQ ID NO: 386); (14) GCAUUUUUAUUAAUAUGGUGACU in the sense chain (SEQ ID NO: 317) and AGUCACCAUAUUAAUAAAAAUGC in the antisense chain (SEQ ID NO: 387); (15) AUUUUUAUUAAUAUGGUGACUUU in the sense chain (SEQ ID NO: 318) and AAAGUCACCAUAUUAAUAAAAAU in the antisense chain (SEQ ID NO: 318). (16) UUUUUAUUAAUAUGGUGACUUUU in the sense chain (SEQ ID NO: 319) and AAAAGUCACCAUAUUAAUAAAAA in the antisense chain (SEQ ID NO: 389); (17) UUUAUUAAUAUGGUGACUUUUUA in the sense chain (SEQ ID NO: 320) and UAAAAAGUCACCAUAUUAAUAAA in the antisense chain (SEQ ID NO: 390); or (18) UUAUUAAUAUGGUGACUUUUUAA in the sense chain (SEQ ID NO: 321) and UUAAAAAGUCACCAUAUUAAUAA in the antisense chain (SEQ ID NO: 391). In some embodiments, the dsRNA comprises (1) CCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO:176) in the sense strand and AGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO:177) in the antisense strand; (2) CCAUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO:180) in the sense strand and AAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO:181) in the antisense strand; and (3) CCAAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO:182) in the sense strand and AAAAAGUCACCAUAUUAAUdTdT (SEQ ID NO:183) in the antisense strand.(4) CCAUUAAUAUGGUGACUUUUUAinvdT in the sense chain (SEQ ID NO: 184) and UAAAAAGUCACCAUAUUAAdTdT in the antisense chain (SEQ ID NO: 185); (5) CCAUAAUAUGGUGACUUUUUAAinvdT in the sense chain (SEQ ID NO: 186) and UUAAAAAGUCACCAUAUUAdTdT in the antisense chain (SEQ ID NO: 187); (6) CCAUAUGGUGACUUUUUAAAAUinvdT in the sense chain (SEQ ID NO: 188) and AUUUUAAAAAGUCACCAUAdTdT in the antisense chain (SEQ ID NO: 189); (7) CCAUUAUUAAUAUGGUGACUUUinvdT in the sense chain (SEQ ID NO: 189) (8) CCAAUAUGGUGACUUUUUAAAAinvdT in the sense chain (SEQ ID NO:323); (9) CCAAUUUUUAUUAAUAUGGUGACUinvdT in the sense chain (SEQ ID NO:324) and UUUUAAAAAGUCACCAUAUdtdt in the sense chain (SEQ ID NO:325); (10) CCAUUUUUAUUAAUAUGGUGACUinvdT in the sense chain (SEQ ID NO:326) and AGUCACCAUAUUAAUAAAAAUdTdT in the sense chain (SEQ ID NO:327); (11) CCAUUUUAUUAAUAUGGUGACUUUinvdT in the sense chain (SEQ ID NO:328) and AAAGUCACCAUAUUAAUAAAAdTdT in the sense chain (SEQ ID NO:323); NO:329); (11) CCAUUUAUUAAUAUGGUGACUUUUinvdT in the sense chain (SEQ ID NO:330) and AAAAGUCACCAUAUUAAUAAAdTdT in the antisense chain (SEQ ID NO:331); (12) CCAUAUUAAUAUGGUGACUUUUUAinvdT in the sense chain (SEQ ID NO:332) and UAAAAAGUCACCAUAUUAAUAdTdT in the antisense chain (SEQ ID NO:333);(13) CCAAAUAUGGUGACUUUUUAAAAUinvdT in the sense chain (SEQ ID NO: 334) and AUUUUAAAAAGUCACCAUAUUdTdT in the antisense chain (SEQ ID NO: 335); (14) CCAGCAUUUUUAUUAAUAUGGUGACUinvdT in the sense chain (SEQ ID NO: 336) and AGUCACCAUAUUAAUAAAAAUGCdTdT in the antisense chain (SEQ ID NO: 337); (15) CCAAUUUUUAUUAAUAUGGUGACUUUinvdT in the sense chain (SEQ ID NO: 338) and AAAGUCACCAUAUUAAUAAAAAUdTdT in the antisense chain (SEQ ID NO: 339); (16) CCAUUUUUAUUAAUAUGGUGACUUUUinvdT in the sense chain (SEQ ID NO: 339) (17) AAAAGUCACCAUAUUAAUAAAAAdTdT in the sense chain (SEQ ID NO:340); (18) CCAUUUAUUAAUAUGGUGACUUUUUAinvdT in the sense chain (SEQ ID NO:342) and UAAAAAGUCACCAUAUUAAUAAAdTdT in the sense chain (SEQ ID NO:343); or (19) CCAUUAUUAAUAUGGUGACUUUUUAAinvdT in the sense chain (SEQ ID NO:344) and UUAAAAAGUCACCAUAUUAAUAAdTdT in the sense chain (SEQ ID NO:345). In some embodiments, the first sequence is identical to at least 15 consecutive nucleotides of UUGUAGCAUUUUUAUUAAUAUGGUGACUUUUUAAAAUAAAAACAAACA (SEQ ID NO:2) and is not one of GCAUUUUUAUUAAUAUGGU (SEQ ID NO:5), UUUGUAGCAUUUUUAUUAAUAUGGU (SEQ ID NO:576), or AUUUUUAUUAAUAUGGUGA (SEQ ID NO:577).

[0016] In another aspect, this disclosure relates to a double-stranded RNA (dsRNA) comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein only the first sequence is complementary to the second sequence, and wherein the first sequence is one of SEQ ID NO: 3, 4, and 13. In another aspect, this disclosure relates to a double-stranded RNA (dsRNA) comprising a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein only the first sequence is complementary to the second sequence, wherein the first sequence is one of SEQ ID NO: 3, 4, and 13, wherein the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and wherein the dsRNA optionally inhibits the expression of the proteoproteotransferase subtilisin Kexin 9 (PCSK9) gene. In some embodiments, this disclosure provides a dsRNA comprising a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein only the first sequence is complementary to the second sequence, wherein the first sequence is one of SEQ ID NO: 3, 4 and 13, wherein the first sequence contains less than 30% GC, wherein the dsRNA is optionally a small interfering RNA (siRNA) or a short hairpin RNA (shRNA), and wherein the dsRNA optionally inhibits the expression of the proteoproteotransferase subtilisin Kexin 9 (PCSK9) gene. In some embodiments, the dsRNA comprises: (19) UUGUAGCAUUUUUAUUAAU (SEQ ID NO:3) in the sense strand and AUUAAUAAAAAUGCUACAA (SEQ ID NO:370) in the antisense strand; (20) GUAGCAUUUUUAUUAAUAU (SEQ ID NO:4) in the sense strand and AUAUUAAUAAAAAUGCUAC (SEQ ID NO:371) in the antisense strand; or (21) GAGUGUGAAAGGUGCUGAU (SEQ ID NO:13) in the sense strand and AUCAGCCACCUUUCACACUC (SEQ ID NO:379) in the antisense strand.In some embodiments, the dsRNA comprises: (19) CCAUUGUAGCAUUUUUAUUAAUinvdT in the sense strand (SEQ ID NO: 162) and AUUAAUAAAAAUGCUACAAdTdT in the antisense strand (SEQ ID NO: 163); (20) CCAGUAGCAUUUUUAUUAAUAUinvdT in the sense strand (SEQ ID NO: 166) and AUAUUAAUAAAAAUGCUACdTdT in the antisense strand (SEQ ID NO: 167); or (21) CCAGAGUGUGAAAGGUGCUGAUinvdT in the sense strand (SEQ ID NO: 290) and AUCAGCACCUUUCACACUCdTdT in the antisense strand (SEQ ID NO: 291).

[0017] In some embodiments that can be combined with any of the foregoing embodiments, the length of each of the first and second sequences is less than or equal to 30 nucleotides. In some embodiments that can be combined with any of the foregoing embodiments, the length of each of the first and second sequences is at least 19 nucleotides and / or less than or equal to 23 nucleotides. In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).

[0018] In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA comprises one or more modified nucleotides. In some embodiments, at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-thiophosphate nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a lipophilic moiety. In some embodiments, at least one of the one or more modified nucleotides is 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, restricted ethyl (cEt), deoxy, reverse deoxy, reverse dideoxy, locked nucleic acid, debased, 2'-amino, 2'-alkyl, morpholino, aminophosphate, or a nucleotide containing a non-natural base. In some embodiments, the dsRNA comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises two or more 2'-O-methyl nucleotides and two or more 2'-fluoronucleotides in the pattern OMe-F-OMe-F or F-OMe-F-OMe, wherein OMe represents a 2'-O-methyl nucleotide and F represents a 2'-fluoronucleotide. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides, each a 2'-O-methyl nucleotide or up to 10 consecutive nucleotides, each a 2'-fluoronucleotide.

[0019] In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA comprises one or more phosphate thioester groups. In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA does not contain phosphate thioester groups. In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA comprises one or more phosphate triester groups. In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA does not contain phosphate triester groups.

[0020] In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA is attached to one or more GalNAc derivatives via a adapter. In some embodiments, the dsRNA is attached to three GalNAc derivatives via a trivalent branched adapter. In some embodiments, at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

[0021] In some embodiments that can be combined with any of the foregoing embodiments, one or both of the sense strand and the antisense strand further include a 5' overhang containing one or more nucleotides. In some embodiments that can be combined with any of the foregoing embodiments, one or both of the sense strand and the antisense strand further include a 3' overhang containing one or more nucleotides. In some embodiments, the 3' overhang contains two nucleotides. In some embodiments, the overhang contains one or more thymines.

[0022] In some embodiments, one or both strands of the dsRNA comprise one or more compounds having the structure of formula (I):

[0023]

[0024] in:

[0025] -B is a heterocyclic nucleobase;

[0026] One of L1 and L2 is a compound of formula (I) linked to a nucleoside linker group of a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or a compound of formula (I) linked to a nucleoside linker group of a polynucleotide.

[0027] -Y is O, NH, NR1, or NC (=O)-R1, where R1 is:

[0028] (C1-C20)alkyl, optionally surrounded by one or more atoms selected from halogen atoms, (C1-C6)alkyl, (C3-C8)cycloalkyl,

[0029] (C3-C14)heterocyclic, (C6-C14)aryl, (C5-C14)heteroaryl, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN,

[0030] Substitution of groups in -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2) and -N(Z1)-C(=J)-Z2, where J is O or S.

[0031] Z1 and Z2 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl group is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl groups.

[0032] (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups, the group being -[C(=O)]m-R2-(O-CH2-CH2)p-R3, wherein

[0033] m represents an integer that is either 0 or 1.

[0034] p is an integer in the range of 0 to 10.

[0035] R2 is a (C1-C20) alkylene group, optionally prefixed with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN,

[0036] -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4) or -N(Z3)-C(=K)-Z4 are used as substitutes, where

[0037] K is either O or S.

[0038] Z3 and Z4 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl, and

[0039] R3 is selected from hydrogen atom, (C1-C6)alkyl, (C1-C6)alkoxy, (C3-C8)cycloalkyl, (C3-C14) heterocyclic,

[0040] (C6-C14)aryl or (C5-C14)heteroaryl, or R3 is the cell-targeting moiety.

[0041] -X1 and X2 are each independently a hydrogen atom and a (C1-C6) alkyl group, and

[0042] -Ra, Rb, Rc, and Rd are each independently H or (C1-C6) alkyl groups.

[0043] Or it could be a pharmaceutically acceptable salt.

[0044] In some embodiments, the dsRNA comprises one or more compounds of formula (I), wherein Y is:

[0045] a) NR1, where R1 is an unsubstituted (C1-C20) alkyl group;

[0046] b) NR1, where R1 is an unsubstituted (C1-C16) alkyl group, including alkyl groups selected from methyl, isopropyl, butyl, octyl and hexadecyl;

[0047] c) NR1, where R1 is a (C3-C8) cycloalkyl group, which is optionally substituted by one or more groups selected from halogen atoms and (C1-C6) alkyl groups;

[0048] d) NR1, where R1 is cyclohexyl;

[0049] e)NR1, where R1 is a (C1-C20) alkyl group substituted with (C6-C14) aryl;

[0050] f) NR1, where R1 is a methyl group substituted with a phenyl group;

[0051] g)NC(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or

[0052] h)NC(=O)-R1, where R1 is methyl or pentadecyl.

[0053] In some embodiments, the dsRNA comprises one or more compounds of formula (I), wherein B is selected from pyrimidine, substituted pyrimidine, purine and substituted purine, or a pharmaceutically acceptable salt thereof.

[0054] In some implementations, R3 has formula (II).

[0055]

[0056] Where A1, A2, and A3 are OH,

[0057] A4 is OH or NHC(=O)-R5, wherein R5 is an (C1-C6) alkyl group optionally substituted with a halogen atom, or a pharmaceutically acceptable salt thereof.

[0058] In some implementations, R3 is N-acetylgalactosamine, or a pharmaceutically acceptable salt thereof.

[0059] In some implementations, the dsRNA comprises one or more nucleotides from Table A.

[0060] In some embodiments, the dsRNA comprises 2 to 10 compounds of formula (I) or pharmaceutically acceptable salts thereof. In some embodiments, the 2 to 10 compounds of formula (I) are located on the sense strand.

[0061] In some embodiments, the sense chain comprises two to five compounds of formula (I) at the 5' end, and / or one to three compounds of formula (I) at the 3' end.

[0062] In some implementation schemes,

[0063] a) Two to five compounds of formula (I) at the 5' end of the sense strand contain 1gT3, optionally containing three consecutive 1gT3 nucleotides; and / or

[0064] b) One to three compounds of formula (I) at the 3' end of the sense chain contain lT4; optionally, two consecutive lT4.

[0065] In some embodiments, the dsRNA includes one or more internucleotide linking groups, which are independently selected from phosphodiester, phosphotriester, thiophosphate, dithiophosphate, alkyl-phosphonate, and aminophosphate backbone linking groups, or pharmaceutically acceptable salts thereof.

[0066] In some implementations, the dsRNA is selected from the dsRNAs in Tables 2-4.

[0067] In some implementation schemes,

[0068] a) The sense strand comprises a nucleotide sequence selected from SEQ ID NO: 578, 585, 587, 620, 621, 622 and 627; and / or

[0069] b) The antisense strand comprises a nucleotide sequence selected from SEQ ID NO:589, 591, 631, 632, 634, 635 and 639.

[0070] In some embodiments, the sense and antisense strands of the dsRNA each comprise the following nucleotide sequences:

[0071] a) SEQ ID NO: 578 and 589; [C027.001]

[0072] b) SEQ ID NO: 620 and 631; [C027.003]

[0073] c) SEQ ID NO: 585 and 591; [C027.001#40]

[0074] d) SEQ ID NO: 587 and 591; [C027.001#58]

[0075] e) SEQ ID NO: 621 and 634; [C027.003#03]

[0076] f) SEQ ID NO: 622 and 632; [C027.003#06]

[0077] g) SEQ ID NO: 622 and 635; and [C027.003#08]

[0078] h)SEQ ID NO: 627 and 639. [C027.003#47]

[0079] In some embodiments that can be combined with any of the foregoing embodiments, the dsRNA inhibits the expression of the proteoproteotransferase Kexin 9 (PCSK9) gene. In some embodiments, the PCSK9 gene is a human PCSK9 gene (e.g., containing the polynucleotide sequence of SEQ ID NO:1). In some embodiments, the PCSK9 gene is a non-human PCSK9 gene. In some embodiments, the PCSK9 gene is a non-human primate PCSK9 gene (e.g., cynomolgus monkey PCSK9, as represented by UniprotoKB accession number G7NVZ1).

[0080] In another respect, this disclosure relates to a vector encoding one or more dsRNAs described herein.

[0081] In another aspect, this disclosure relates to an isolated host cell containing one or more dsRNAs and / or vectors described herein.

[0082] In another respect, this disclosure relates to an article or kit containing one or more dsRNAs and / or vectors described herein.

[0083] In another aspect, this disclosure relates to a composition comprising one or more dsRNAs and / or vectors described herein. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a pharmaceutically acceptable vector. In some embodiments, the composition comprises a delivery medium. In some embodiments, the delivery medium is selected from liposomes, liposome complexes, complexes, and nanoparticles.

[0084] In another aspect, this disclosure relates to a method for inhibiting PCSK9 gene expression in a subject, the method comprising administering to the subject an effective amount of one or more dsRNAs described herein and / or one or more compositions described herein. In another aspect, this disclosure relates to the use of one or more dsRNAs described herein and / or one or more compositions described herein in a method for inhibiting PCSK9 gene expression in a subject. In another aspect, this disclosure relates to one or more dsRNAs described herein and / or one or more compositions described herein for manufacturing a medicament for inhibiting PCSK9 gene expression in a subject. In another aspect, this disclosure relates to a method for treating or preventing PCSK9-mediated disease in a subject in need, the method comprising administering to the subject an effective amount of one or more dsRNAs described herein and / or one or more compositions described herein. In another aspect, this disclosure relates to the use of one or more dsRNAs described herein and / or one or more compositions described herein in a method for treating or preventing PCSK9-mediated disease in a subject in need. In another aspect, this disclosure relates to one or more dsRNAs described herein and / or one or more compositions described herein for manufacturing a medicament for treating or preventing PCSK9-mediated disease in a subject in need. In some embodiments that can be combined with any of the foregoing embodiments, expression of the PCSK9 gene in the liver of the subject is inhibited by the dsRNA. In some embodiments that can be combined with any of the foregoing embodiments, the PCSK9-mediated disorder is hypercholesterolemia. In some embodiments that can be combined with any of the foregoing embodiments, the administration is subcutaneous, intravenous, or pulmonary. In some embodiments that can be combined with any of the foregoing embodiments, the subject is a human. In some embodiments that can be combined with any of the foregoing embodiments, the administration results in a reduction in the subject's serum cholesterol. In some embodiments that can be combined with any of the foregoing embodiments, the method further includes administering to the subject an effective amount of one or more additional therapeutic agents for treating or preventing PCSK9-mediated disorders.

[0085] It should be understood that one, some, or all of the features of the various embodiments described herein can be combined to form other embodiments of this disclosure. These and other aspects of this disclosure will become clear to those skilled in the art. Attached Figure Description

[0086] Figure 1This qPCR analysis shows PCSK9 mRNA expression in untransfected human Hep3B cells or in human Hep3B cells transfected with 14 different test siRNAs targeting PCSK9 at increasing concentrations, compared to positive and negative control treatments. *Indicates the siRNA that showed the most effective reduction in PCSK9 expression in this assay.

[0087] Figure 2 This qPCR analysis shows PCSK9 mRNA expression in untransfected human C3A cells or in human C3A cells transfected with 14 different test siRNAs targeting PCSK9 at increasing concentrations, compared to positive and negative control treatments. *Indicates the siRNA that showed the most effective reduction in PCSK9 expression in this assay.

[0088] Figure 3A and Figure 3B The results of a cytotoxicity assay for cells transfected with siRNA targeting PCSK9 are shown. Figure 3A The results of a cytotoxicity assay were shown for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 3B The results of a cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9 are shown.

[0089] Figure 4 This qPCR analysis shows PCSK9 mRNA expression in untransfected human Hep3B cells or in human Hep3B cells transfected with 60 different test siRNAs targeting PCSK9 at increasing concentrations, compared to positive and negative control treatments. *Indicates the siRNA that showed the most effective reduction in PCSK9 expression in this assay.

[0090] Figure 5 This qPCR analysis shows the expression of PCSK9 mRNA in human C3A cells transfected with five different PCSK9-targeting siRNAs at increasing concentrations, compared to positive and negative control treatments. *Indicates the siRNA that showed the most effective reduction in PCSK9 expression in this assay.

[0091] Figure 6A and Figure 6B The results of a cytotoxicity assay for cells transfected with siRNA targeting PCSK9 are shown. Figure 6A The results of a cytotoxicity assay were shown for human Hep3B cells transfected with siRNA targeting PCSK9. Figure 6B The results of a cytotoxicity assay for human C3A cells transfected with siRNA targeting PCSK9 are shown.

[0092] Figure 7 The figure shows the amount of PCSK9 protein secreted into the supernatant of human C3A cell cultures for cells transfected with increasing concentrations of ten test siRNAs targeting PCSK9, as determined by ELISA.

[0093] Figure 8 The amount of PCSK9 protein secreted into the supernatant of human C3A cell cultures transfected with three different concentrations of PCSK9-targeting siRNA, as determined by ELISA, is shown.

[0094] Figure 9 The results show the cytotoxicity assays of PCSK9-targeting siRNA at three different concentrations during free uptake in human primary hepatocytes.

[0095] Figure 10 The amount of interferon α (IFNα) protein released into the supernatant of human peripheral blood mononuclear cells (PBMCs) isolated from three donors and transfected with PCSK9-targeting siRNA, as determined by ELISA, is shown.

[0096] Figure 11 The in vitro serum stability and relative half-life of the PCSK9-targeting siRNA in 50% mouse serum are shown.

[0097] Figure 12 This is a summary of the results of in vitro analysis of siRNAs targeting PCSK9.

[0098] Figure 13A Serum PCSK9 levels over time are shown in human PCSK9 transgenic mice treated with a single subcutaneous dose of the indicated PCSK9-targeting siRNA at day 0, as measured by ELISA. Figure 13B Serum total cholesterol levels in these same mice are shown as measured using the COBAS INTEGRA instrument. Figure 13C The results of acute toxicity measurements in serum samples on day 3, as determined using the COBAS INTEGRA instrument, are shown. Figure 13D The results of acute toxicity measurements in serum samples on day 10, as determined using the COBAS INTEGRA instrument, are shown. AST = aspartate aminotransferase; ALT = alanine aminotransferase; BUN = blood urea nitrogen.

[0099] Figure 14A The qPCR analysis shows the expression of PCSK9 mRNA in untransfected human Hep3B cells or in human Hep3B cells transfected with two different concentrations of PCSK9-targeting test siRNA compared to positive and negative control treatments. Figure 14BThis shows a qPCR analysis of PCSK9 mRNA expression in untransfected human C3A cells or in human C3A cells transfected with two different concentrations of PCSK9-targeting test siRNAs, compared to positive and negative control treatments. Arrows indicate siRNAs showing >50% PCSK9 knockdown at 0.1 nM or >85% PCSK9 knockdown at 1 nM in both Hep3B and C3A cell lines.

[0100] Figure 15 The results of cytotoxicity assays are shown in Hep3B and C3A cells transfected with two different concentrations of additional test siRNA targeting PCSK9. X indicates siRNA with >50% toxicity at 50 nM compared to the LV2 negative control.

[0101] Figure 16A The calculated IC50 value for the tested siRNA in human Hep3B cells is shown. 50 Values ​​and calculated IC50 values ​​in human C3A cells 50 Correlation between values. Figure 16B The diagram shows the calculated Ig for another test siRNA targeting PCSK9 in human Hep3B cells. max Values ​​and calculated I in human C3A cells max Correlation between values.

[0102] Figure 17 The graphs depict the residual PCSK9 mRNA expression levels in human primary hepatocytes treated with 100 nM and 1000 nM GalNAc-siRNA, normalized to the LV2 non-silence control, from an optimized library based on parental sequences C027.001, C027.002, and C027.003.

[0103] Figure 18 The amount of interferon α2a (IFNα2a) protein released into the supernatant of human peripheral blood mononuclear cells (PBMCs) isolated from three donors and transfected with PCSK9-targeting siRNA, as determined by ELISA, is shown in pg / mL.

[0104] Figures 19A-19C This is a graph showing the relative levels of serum PCSK9 in human PCSK9 transgenic mice treated subcutaneously at 6 mg / kg with a single dose of 42 optimized PCSK9 GalNAc-siRNAs and their corresponding parental molecules on day 0. Figures 19A-19CData are presented for optimized PCSK9 GalNAc-siRNAs based on parental sequences C027.001, C027.002, and C027.003, respectively. Protein expression is represented relative to animals treated with PBS media. Human PCSK9 levels were quantified by ELISA, and error bars indicate SEM. Figure 19D and Figure 19E The results, as measured using the COBAS INTEGRA instrument, show the results on day 14 after siRNA administration. Figure 19D ) and the 28th day ( Figure 19E Serum LDL cholesterol levels in these same mice. Detailed Implementation

[0105] The following description illustrates exemplary methods, parameters, etc. However, it should be understood that such description is not intended to be a limitation on the scope of this disclosure, but is intended to be provided as a description of exemplary embodiments.

[0106] 1. Definition

[0107] Unless otherwise expressly stated, the singular forms “a”, “an”, and “described” as used in this specification and the appended claims include plural indicators. Thus, for example, reference to “a molecule” optionally includes combinations of two or more such molecules, etc.

[0108] As used herein, the term "about" refers to the typical range of error for a corresponding value that is readily known to those skilled in the art. References to "about" in this document include (and describe) embodiments relating to said value or parameter itself.

[0109] It should be understood that the aspects and embodiments described in this disclosure include aspects and embodiments that "comprising," "consisting," and "consisting essentially of." It should also be understood that the disclosure of embodiments using the term "comprising" or equivalents also covers embodiments in which "comprising" is replaced by "contains."

[0110] As used herein, the term "ribonucleotide" or "nucleotide" includes naturally occurring or modified nucleotides, as further detailed below, or alternative substituted portions. Those skilled in the art will understand that guanine, cytosine, adenine, uracil, or thymine in a nucleotide can be substituted with other portions without substantially altering the base-pairing properties of the oligonucleotide containing such substituted portions. For example, but not limited to, nucleotides containing inosine as their base can base-pair with nucleotides containing adenine, cytosine, or uracil. Therefore, nucleotides containing uracil, guanine, or adenine can be substituted in the nucleotide sequences of this disclosure with nucleotides containing, for example, inosine. Sequences containing such substituted portions are included as embodiments of this disclosure.

[0111] As used herein, the term "PCSK9" refers to the gene or protein of the proteoproteotransferase subtilisin kexin 9 (also known as FH3, HCHOLA3, NARC-1, and NARC1). As used herein, the term "PCSK9" includes human PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI reference sequence: NM_174936.3; mouse PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI reference sequence: NM_153565.2; and rat PCSK9, whose amino acid and nucleotide sequences can be found, for example, in NCBI reference sequence: NM_199253.2. Further examples of PCSK9 mRNA sequences are readily available, for example, from GenBank.

[0112] As used herein, “target sequence” refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, such as the PCSK9 gene or a portion thereof, including mRNA as a product of RNA processing of a primary transcription product.

[0113] As used herein, the term "chain containing a sequence" refers to an oligonucleotide containing a nucleotide chain described by a sequence referenced using standard nucleotide nomenclature.

[0114] As used herein, and unless otherwise indicated, as will be understood by one of ordinary skill in the art, the term "complementary" when used to describe a first nucleotide sequence in relation to a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence under certain conditions and form a double-stranded structure. This includes base pairing of the oligonucleotide or polynucleotide containing the first nucleotide sequence with the oligonucleotide or polynucleotide containing the second nucleotide sequence over the entire length of either the first or second nucleotide sequence. Such sequences may be referred to herein as "perfectly complementary" relative to each other. When the first sequence is referred to herein as "substantially complementary" relative to the second sequence, the two sequences may be perfectly complementary, or they may form one or more, but no more than four, three, or two mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their final application. However, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches in relation to the determination of complementarity. For example, a double-stranded RNA (dsRNA) containing a first oligonucleotide of length 21 nucleotides and a second oligonucleotide of length 23 nucleotides may still be referred to as “fully complementary” for the purposes of this disclosure, wherein the second oligonucleotide contains a sequence of 21 nucleotides that are fully complementary to the first oligonucleotide. In fulfilling the above requirements regarding its hybridization ability, the “complementary” sequence may also include or consist entirely of non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. As will be understood from the context of their use, the terms “complementary,” “fully complementary,” and “substantially complementary” may be used with respect to base matching between the sense strand and the antisense strand of the dsRNA or between the antisense strand of the dsRNA and the target sequence. As used herein, a polynucleotide “substantially complementary” to at least a portion of mRNA refers to a polynucleotide that is substantially complementary to a continuous portion of the target mRNA (e.g., mRNA encoding PCSK9). For example, if the sequence is substantially complementary to the uninterrupted portion of the mRNA encoding PCSK9, then the polynucleotide is substantially complementary to at least a portion of the PCSK9 mRNA.

[0115] As used herein, the term "double-stranded RNA" or "dsRNA" refers to a complex of one or more ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary (as defined above) nucleic acid strands. These two strands forming the double-stranded structure can be different parts of a larger RNA molecule, or they can be separate RNA molecules. In the case of separate RNA molecules, such dsRNAs are commonly referred to in the literature as short interfering RNA (siRNA). When the two strands are part of a larger molecule and are thus linked by an uninterrupted nucleotide chain between the 3' end of the first strand and the 5' end of the second strand to form the double-stranded structure, this linking RNA strand is called a "hairpin loop," "short hairpin RNA," or "shRNA." When the two strands are covalently linked by means other than an uninterrupted nucleotide chain between the 3'-end of the first strand and the 5'-end of the second strand to form the double-stranded structure, this linking structure is called a "connector." The RNA strands can have the same or different numbers of nucleotides. The maximum number of base pairs is the number of oligonucleotides in the shortest strand of the dsRNA minus any protrusions present in the double-stranded structure. In addition to a double-stranded structure, dsRNA may also contain one or more nucleotide overhangs. Furthermore, as used herein, the term "dsRNA" can include chemical modifications of ribonucleotides, including substantial modifications at multiple nucleotide sites and including all types of modifications disclosed herein or known in the art. For the purposes of this disclosure, any such modifications (as used in siRNA-type molecules) are covered by "dsRNA".

[0116] In some embodiments, the dsRNA comprises a modified ribonucleoside, including deoxyribonucleoside, such as one or more deoxyribonucleoside overhangs, one or more deoxyribonucleoside overhangs within the double-stranded portion of the dsRNA, etc. However, it is self-evident that in any case, it refers to a double-stranded DNA molecule covered by the term "dsRNA".

[0117] As used herein, the term "nucleotide overhang" refers to one or more unpaired nucleotides that protrude from the double-stranded structure of a dsRNA when the 3' end of the first strand extends beyond the 5' end of the second strand, or vice versa. "Blunt-ended" or "flat-ended" means that there are no unpaired nucleotides at this end of the dsRNA, i.e., no nucleotide overhang. A "flat-ended" dsRNA is a double-stranded dsRNA throughout its entire length, i.e., without nucleotide overhangs at either end of the molecule. For clarity, chemical caps or non-nucleotide chemical portions conjugated to the 3' and / or 5' ends of the dsRNA are not considered when determining whether a dsRNA has an overhang or is flat-ended.

[0118] As used herein, the term “antisense strand” refers to a strand of dsRNA that includes a sequence substantially complementary to the target sequence.

[0119] As used herein, the term "sense strand" refers to a strand of dsRNA that includes a sequence substantially complementary to the region of the antisense strand.

[0120] As used herein, and as will be understood by one of ordinary skill in the art, the term “introduced into cells” means to facilitate uptake or absorption into cells. The uptake or absorption of dsRNA can occur through non-assisted diffusion or active cellular processes or through an auxiliary agent or device. The meaning of this term is not limited to in vitro cells; dsRNA can also be “introduced into cells” where the cells are part of a living organism. In this case, introduction into cells will include delivery to the organism. For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be mediated by a β-glucan delivery system (see, for example, Tesz, GJ et al. (2011) Biochem J.436(2):351-62). In vitro introduction into cells includes methods known in the art, such as electroporation and liposome transfection. Other methods are described below or are known in the art.

[0121] As used herein, the term "target gene" refers to a gene whose expression is suppressed by the dsRNA of this disclosure, such as PCSK9.

[0122] As used herein, the term "PCSK9-related disease" is intended to include any disease associated with the PCSK9 gene or protein. Such disease may be caused by, for example, an overproduction of the PCSK9 protein, mutations in the PCSK9 gene, abnormal cleavage of the PCSK9 protein, or abnormal interactions between PCSK9 and other proteins or other endogenous or exogenous substances. Exemplary PCSK9-related diseases include, but are not limited to, lipemias, such as hyperlipidemia, and other forms of lipid imbalances, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases.

[0123] As used herein, when referring to the PCSK9 gene, the terms "inhibit the expression of" or "inhibiting expression of" mean that, compared to a second cell or cell population (control cells), the expression of the PCSK9 gene is at least partially suppressed, as indicated by a reduction in the amount of mRNA transcribed from the PCSK9 gene that can be isolated from a first cell or cell population in which the PCSK9 gene is transcribed and which has been treated to suppress the expression of the PCSK9 gene, and the second cell or cell population is substantially the same as the first cell or cell population but has not been treated in this way. As used herein, the term "suppression" is used interchangeably with "reduction," "silencing," "downregulation," "suppression," and other similar terms, and includes any level of suppression. The degree of suppression is typically expressed as (((mRNA in control cells) - (mRNA in treated cells)) / (mRNA in control cells)) × 100%.

[0124] Alternatively, the degree of repression can be given by a reduction in parameters functionally associated with PCSK9 gene transcription, such as the amount of protein encoded by the PCSK9 gene secreted by the cell, or the number of cells exhibiting a particular phenotype (e.g., apoptosis). In principle, PCSK9 gene silencing in any target-expressing cell can be determined constitutively or by genome engineering and by any suitable assay. However, when reference is needed to determine whether a given dsRNA represses PCSK9 gene expression to a particular extent and is therefore covered by this disclosure, the assays provided in the following examples are used for such reference.

[0125] As used herein, in the context of PCSK9 expression, the terms "treat," "treatment," etc., refer to the relief or reduction of a pathological process mediated by target gene expression. In the context of this disclosure, when referring to any other condition described below (other than a pathological process mediated by target expression), the terms "treat," "treatment," etc., refer to the relief or reduction of one or more symptoms associated with such condition. For example, in the context of hyperlipidemia, treatment would include a reduction in serum lipid levels.

[0126] As used herein, the terms “prevention” or “delay of progression” (and their grammatical variations) relating to a disease or disorder refer to preventive treatment of the disease, such as in individuals suspected of having the disease or at risk of developing it. Prevention may include, but is not limited to, preventing or delaying the onset or progression of the disease and / or maintaining one or more symptoms of the disease at desired or subpathological levels. For example, in the context of hyperlipidemia, prevention may include maintaining serum lipid levels at desired levels in individuals suspected of having hyperlipidemia or at risk of developing it.

[0127] As used herein, the terms "therapeutic effective amount" and "preventive effective amount" refer to the amount that provides therapeutic benefit in treating, preventing, or managing a pathological process mediated by target gene expression (e.g., PCSK9 gene expression) or in managing obvious symptoms of a pathological process mediated by target gene expression (e.g., PCSK9 gene expression). The specific therapeutically effective amount can be readily determined by a physician in ordinary practice and can vary based on factors known in the art, such as the type of pathological process mediated by target gene expression (e.g., PCSK9 gene expression), the patient's medical history and age, the stage of the pathological process mediated by target gene expression (e.g., PCSK9 gene expression), and the administration of other agents that inhibit the process mediated by target gene expression (e.g., PCSK9 gene expression).

[0128] As used herein, the terms "individual" or "subject" refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0129] 2. Double-stranded RNA (dsRNA)

[0130] Certain aspects of this disclosure relate to double-stranded RNA (dsRNA) molecules targeting PCSK9. In some embodiments, the dsRNA comprises two strands: a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first and second strands are sufficiently complementary to hybridize to form a double-stranded structure. In some embodiments, the sense strand contains a first sequence that is substantially or completely complementary to the second sequence in the antisense strand. In some embodiments, the second sequence in the antisense strand is substantially or completely complementary to the target sequence. In some embodiments, the target sequence is derived from a sequence of mRNA formed during target gene expression (e.g., mRNA formed during PCSK9 gene expression). In some embodiments, the PCSK9 gene is the human PCSK9 gene, for example, as described herein. In some embodiments, the PCSK9 gene is a non-human PCSK9 gene. In some embodiments, the PCSK9 gene is a non-human primate PCSK9 gene (e.g., cynomolgus monkey PCSK9 (UniprotKB accession number G7NVZ1)). In some embodiments, the dsRNA represses PCSK9 gene expression. In some embodiments, the dsRNA is a small interfering RNA (siRNA). In some embodiments, the dsRNA is a short hairpin RNA (shRNA).

[0131] In some embodiments, the sense and antisense strands of the dsRNA are in two separate molecules. In some embodiments, a double-stranded region is formed between a first sequence in the sense strand of the two separate molecules and a second sequence in the antisense strand of the two separate molecules. In some embodiments, the dsRNA is siRNA. In some embodiments, the two separate molecules are not covalently linked to each other. In some embodiments, the two separate molecules are covalently linked to each other. In some embodiments, the two separate molecules are covalently linked to each other by means other than hairpin loops. In some embodiments, the two separate molecules are covalently linked to each other via a linker structure (referred to herein as a "covalent linker").

[0132] In some implementations, the lengths of the first sequence (in the sense strand) and the second sequence (in the antisense strand) can each range from 9 to 30 nucleotides. For example, the length of each sequence can be between 12-30 nucleotides, 14-30 nucleotides, 15-30 nucleotides, 25-30 nucleotides, 27-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 17-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-25 nucleotides, 18-23 nucleotides, 18-22 nucleotides... Between 18-21 nucleotides, between 18-20 nucleotides, between 19-30 nucleotides, between 19-25 nucleotides, between 19-24 nucleotides, between 19-23 nucleotides, between 19-22 nucleotides, between 19-21 nucleotides, between 19-20 nucleotides, between 20-30 nucleotides, between 20-26 nucleotides, between 20-25 nucleotides, between 20-24 nucleotides, between 20-23 nucleotides, between 20-22 nucleotides, between 20-21 nucleotides, between 21-30 nucleotides, between 21-26 nucleotides, between 21-25 nucleotides, between 21-24 nucleotides, between 21-23 nucleotides, or between 21-22 nucleotides. In some embodiments, the length of each sequence is greater than or equal to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides. In some embodiments, the length of each sequence is less than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. That is, the length of each sequence can be within any range of nucleotides having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 and a lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29, wherein the lower limit is less than the upper limit.In some embodiments, each sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the length of each of the first and second sequences is less than or equal to 30 nucleotides. In some embodiments, the length of each of the first and second sequences is at least 19 and less than or equal to 23 nucleotides. In some embodiments, the lengths of the first and second sequences are different numbers of nucleotides. In some embodiments, the first sequence is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides longer than the second sequence. In some embodiments, the second sequence is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides longer than the first sequence. In some embodiments, the lengths of the first and second sequences are the same number of nucleotides.

[0133] In some embodiments, the length of each of the sense strand and the antisense strand can be in the range of 9-36 nucleotides. For example, the length of each strand can be between 12-30 nucleotides, 14-30 nucleotides, 15-30 nucleotides, 25-30 nucleotides, 27-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 17-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-25 nucleotides, 18-23 nucleotides, 18-22 nucleotides. Between nucleotides, between 18-21 nucleotides, between 18-20 nucleotides, between 19-30 nucleotides, between 19-25 nucleotides, between 19-24 nucleotides, between 19-23 nucleotides, between 19-22 nucleotides, between 19-21 nucleotides, between 19-20 nucleotides, between 20-30 nucleotides, between 20-26 nucleotides, between 20-25 nucleotides, between 20-24 nucleotides, between 20-23 nucleotides, between 20-22 nucleotides, between 20-21 nucleotides, between 21-30 nucleotides, between 21-26 nucleotides, between 21-25 nucleotides, between 21-24 nucleotides, between 21-23 nucleotides, or between 21-22 nucleotides. In some embodiments, the length of each strand is greater than or equal to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides. In some embodiments, the length of each strand is less than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides.That is, the length of each chain can be within any range of nucleotides having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 and a lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35, wherein the lower limit is less than the upper limit. In some embodiments, each strand is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotides long. In some embodiments, the sense strand and the antisense strand have the same number of nucleotides. In some embodiments, the sense strand and the antisense strand have different numbers of nucleotides.

[0134] In some embodiments, the first sequence (in the sense strand) and the second sequence (in the antisense strand) contain less than 30% GC. "Less than 30% GC" means that less than 30% of the nucleotides in the sequence are G (guanine) or C (cytosine) compared to the total nucleotide content of the first and / or second sequences. The G (guanine) and C (cytosine) nucleotide content also includes modified G and C nucleotides. Such modifications are described below and include, for example, 2'-O-methylguanosine (mG), 2'-O-methylcytidine (mC), 2'-fluoroguanosine (fG), 2'-fluorocytidine (fC), or guanine and cytosine (lG and lC). Without wishing to be bound by any theory, the inventors have noted that the dsRNAs of this disclosure containing less than 30% GC content exhibit higher efficacy in knocking down human PCSK9 expression.

[0135] Protruding end

[0136] In some embodiments, the dsRNA of this disclosure includes one or more overhangs at the 3'-end, 5'-end, or both ends of one or both of the sense and antisense strands. In some embodiments, the one or more overhangs improve the stability and / or repressive activity of the dsRNA.

[0137] In some embodiments, the protrusion comprises one or more, two or more, three or more, four or more, five or more, or six or more nucleotides. For example, the protrusion may comprise 1-6 nucleotides, 2-6 nucleotides, 3-6 nucleotides, 4-6 nucleotides, 5-6 nucleotides, 1-5 nucleotides, 2-5 nucleotides, 3-5 nucleotides, 4-5 nucleotides, 1-4 nucleotides, 2-4 nucleotides, 3-4 nucleotides, 1-3 nucleotides, 2-3 nucleotides, or 1-2 nucleotides. In some embodiments, the length of the protrusion is one, two, three, four, five, or six nucleotides.

[0138] In some embodiments, the overhang of this disclosure comprises one or more ribonucleotides. In some embodiments, the overhang of this disclosure comprises one or more deoxyribonucleotides. In some embodiments, the overhang comprises one or more thymines.

[0139] In some embodiments, the dsRNA includes a protruding end at the 3' end of the antisense strand. In some embodiments, the dsRNA includes a blunt end at the 5' end of the antisense strand. In some embodiments, the dsRNA includes a protruding end at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand. In some embodiments, the dsRNA includes a protruding end at the 3' end of the sense strand. In some embodiments, the dsRNA includes a blunt end at the 5' end of the sense strand. In some embodiments, the dsRNA includes a protruding end at the 3' end of the sense strand and a blunt end at the 5' end of the sense strand. In some embodiments, the dsRNA includes protruding ends at both the 3' end of the sense strand and the 3' end of the antisense strand.

[0140] In some embodiments, the dsRNA includes a protruding end at the 5' end of the antisense strand. In some embodiments, the dsRNA includes a blunt end at the 3' end of the antisense strand. In some embodiments, the dsRNA includes a protruding end at the 5' end of the antisense strand and a blunt end at the 3' end of the antisense strand. In some embodiments, the dsRNA includes a protruding end at the 5' end of the sense strand. In some embodiments, the dsRNA includes a blunt end at the 3' end of the sense strand. In some embodiments, the dsRNA includes a protruding end at the 5' end of the sense strand and a blunt end at the 3' end of the sense strand. In some embodiments, the dsRNA includes protruding ends at both the 5' end of the sense strand and the 3' end of the antisense strand.

[0141] In some embodiments, the overhang is a result of the sense strand being longer than the antisense strand. In some embodiments, the overhang is a result of the antisense strand being longer than the sense strand. In some embodiments, the overhang is a result of sense and antisense strands of equal length interleaved. In some embodiments, the overhang forms a mismatch with the target mRNA. In some embodiments, the overhang is complementary to the target mRNA.

[0142] In some embodiments, the dsRNA of this disclosure comprises a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first and second sequences are substantially complementary or complementary. In some embodiments, the first and second sequences are substantially complementary or complementary and form a double-stranded region of the dsRNA. In some embodiments, the double-stranded region of the dsRNA is 9-36 nucleotide pairs in length. For example, the length of the double-stranded region can be between 12-30 nucleotide pairs, 14-30 nucleotide pairs, 15-30 nucleotide pairs, 15-26 nucleotide pairs, 15-23 nucleotide pairs, 15-22 nucleotide pairs, 15-21 nucleotide pairs, 15-20 nucleotide pairs, 15-19 nucleotide pairs, 15-18 nucleotide pairs, 15-17 nucleotide pairs, 17-30 nucleotide pairs, 27-30 nucleotide pairs, 17-23 nucleotide pairs, 17-21 nucleotide pairs, 17-19 nucleotide pairs, 18-30 nucleotide pairs, 18-26 nucleotide pairs, 18-25 nucleotide pairs, 18-24 nucleotide pairs, 18-23 nucleotide pairs, or 18-22 nuclei. Between nucleotide pairs, between 18-21 nucleotide pairs, between 18-20 nucleotide pairs, between 19-30 nucleotide pairs, between 19-25 nucleotide pairs, between 19-24 nucleotide pairs, between 19-23 nucleotide pairs, between 19-22 nucleotide pairs, between 19-21 nucleotide pairs, between 19-20 nucleotide pairs, between 20-30 nucleotide pairs, between 20-26 nucleotide pairs, between 20-25 nucleotide pairs, between 20-24 nucleotide pairs, between 20-23 nucleotide pairs, between 20-22 nucleotide pairs, between 20-21 nucleotide pairs, between 21-30 nucleotide pairs, between 21-26 nucleotide pairs, between 21-25 nucleotide pairs, between 21-24 nucleotide pairs, between 21-23 nucleotide pairs, or between 21-22 nucleotide pairs. In some embodiments, the length of the double-stranded region of the dsRNA is greater than or equal to 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotide pairs. In some embodiments, the length of the double-stranded region of the dsRNA is less than or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotide pairs.That is, the length of the double-stranded region of the dsRNA can be within any nucleotide pair range having an upper limit of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 and a lower limit of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35, wherein the lower limit is less than the upper limit. In some embodiments, the length of the double-stranded region is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 nucleotide pairs. If more than one dsRNA is used, the double-stranded region of each dsRNA may have the same or different lengths compared to one or more other dsRNAs.

[0143] Target sequence and the first and second sequences in dsRNA

[0144]

[0145] In some implementations, the dsRNA antisense strand contains a sequence substantially complementary or complementary to 12 to 30 nucleotides of the target sequence. For example, the sequence in the antisense strand may be complementary to 12-30 nucleotides, 14-30 nucleotides, 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 17-30 nucleotides, 27-30 nucleotides, 17-23 nucleotides, 17-21 nucleotides, 17-19 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-25 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18... Nucleotides with 21-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-25 nucleotides, 19-24 nucleotides, 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides are substantially complementary or complementary. In some embodiments, the sequence in the antisense strand may be substantially complementary or complementary to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides of the target sequence. In some embodiments, the sequence in the antisense strand may be substantially complementary or complementary to 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the target sequence. In other words, the sequence in the antisense strand can be substantially complementary or complementary to any range of nucleotides of the target sequence having an upper limit of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 and a lower limit of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29, wherein the lower limit is smaller than the upper limit.In some implementations, the sequence in the antisense strand may be substantially complementary or complementary to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. If more than one dsRNA is used, the complementary region of each dsRNA may have the same or different lengths compared to one or more other dsRNAs.

[0146] In some embodiments, the target sequence comprises UUGUAGCAUUUUUAUUAAUAUGGUGACUUUUUAAAAUAAAAACAAACA (SEQ ID NO:2). In some embodiments, the target sequence comprises GAGUGUGAAAGGUGCUGAUGGCCCUCAUCU (SEQ ID NO:12). In some embodiments, the target sequence (e.g., the first sequence of the sense strand of the dsRNA of this disclosure) is the sequence described in Table 1A.

[0147] Table 1A: siRNA sequence information.

[0148]

[0149]

[0150] In some embodiments, the dsRNA of this disclosure comprises a sense strand containing a first sequence. In some embodiments, the first sequence comprises a target sequence shown in Table 1A. In some embodiments, the first sequence is a target sequence shown in Table 1A. In some embodiments, the first sequence comprises a sequence selected from SEQ ID NO:3-11, 13, and 310-321. In some embodiments, the first sequence comprises a sequence selected from SEQ ID NO:6-11 and 310-321. In some embodiments, the first sequence is a sequence selected from SEQ ID NO:3-11, 13, and 310-321. In some embodiments, the first sequence is a sequence selected from SEQ ID NO:3, 4, and 13. In some embodiments, the first sequence is not one of GCAUUUUUAUUAAUAUGGU (SEQ ID NO:5), UUUGUAGCAUUUUUAUUAAUAUGGU (SEQ ID NO:576), or AUUUUUAUUAAUAUGGUGA (SEQ ID NO:577).

[0151] In some embodiments, the dsRNA of this disclosure comprises a first sequence comprising a sequence selected from SEQ ID NO:6-11 and 310-321, wherein the sequence selected from SEQ ID NO:6-11 and 310-321 comprises less than 30% GC. In some embodiments, the dsRNA of this disclosure comprises a first sequence comprising a sequence selected from SEQ ID NO:6-11 and 310-321, wherein the first sequence comprises less than 30% GC. In some embodiments, the dsRNA of this disclosure comprises a first sequence that is one of SEQ ID NO:3, 4, and 13, wherein the first sequence comprises less than 30% GC.

[0152] In some embodiments, the dsRNA of this disclosure includes an antisense strand comprising a second sequence. In some embodiments, the second sequence is substantially complementary or fully complementary to the first sequence (i.e., in the sense strand). In some embodiments, the second sequence is substantially complementary to the first sequence (i.e., in the sense strand), and the second strand contains at least one mismatch with the first strand (e.g., one mismatch, two mismatches, three mismatches, or four mismatches). In some embodiments, the second sequence is substantially complementary to the first sequence (i.e., in the sense strand), and the second strand contains one or two mismatches with the first strand. In some embodiments, the second sequence is substantially complementary to a sequence selected from SEQ ID NO: 3-11, 13, and 310-321, wherein the second strand contains at least one mismatch with a sequence selected from SEQ ID NO: 3-11, 13, and 310-321 (e.g., one mismatch, two mismatches, three mismatches, or four mismatches). In some embodiments, the second sequence is substantially complementary to sequences selected from SEQ ID NO:3-11, 13, and 310-321, wherein the second strand contains one or both mismatches with sequences selected from SEQ ID NO:3-11, 13, and 310-321. In some embodiments, the second sequence is completely complementary to the first sequence (i.e., in the sense strand). In some embodiments, the second sequence is completely complementary to sequences selected from SEQ ID NO:3-11, 13, and 310-321.

[0153] In some embodiments, the dsRNA of this disclosure comprises a second sequence substantially complementary to a sequence selected from SEQ ID NO:3-11 and 310-321, wherein said second sequence contains less than 30% GC. In some embodiments, the dsRNA of this disclosure comprises a second sequence completely complementary to a sequence selected from SEQ ID NO:3-11 and 310-321, wherein said second sequence contains less than 30% GC.

[0154] In some embodiments, the second sequence is substantially complementary or completely complementary to the sequence in SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or completely complementary to at least 15 consecutive nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or completely complementary to at least 19 consecutive nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or completely complementary to less than or equal to 30 consecutive nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is substantially complementary or completely complementary to at least 19 and less than or equal to 23 consecutive nucleotides of SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence is the sequence shown in Table 1B.

[0155] Table 1B: siRNA second sequence information.

[0156] siRNA Second sequence (5'→3') B001 AUUAAUAAAAAUGCUACAA(SEQ ID NO:370) B003 AUAUUAAUAAAAAAUGCUAC(SEQ ID NO:371) B006 ACCAUAUUAAUAAAAAUGC(SEQ ID NO:372) B008 AGUCACCAUAUUAAUAAAA(SEQ ID NO:373) B010 AAAAGUCACCAUAUUAAUA(SEQ ID NO:374) B011 AAAAAGUCACCAUAUUAAU(SEQ ID NO:375) B012 UAAAAAGUCACCAUAUUAA(SEQ ID NO:376) B013 UUAAAAAGUCACCAUAUUA(SEQ ID NO:377) B014 AUUUUAAAAAGUCACCAUA(SEQ ID NO:378) C051 AUCAGCACCUUUCACACUC(SEQ ID NO:379) C209.016 AAAGUCACCAUAUUAAUAA(SEQ ID NO:380) C217.013 UUUUAAAAAGUCACCAUAU(SEQ ID NO:381) C218.003 AGUCACCAUAUUAAUAAAAAU(SEQ ID NO:382) C218.005 AAAGUCACCAUAUUAAUAAAA(SEQ ID NO:383) C218.006 AAAAGUCACCAUAUUAAUAAA(SEQ ID NO:384) C218.008 UAAAAAGUCACCAUAUUAAUA(SEQ ID NO:385) C218.012 AUUUUAAAAAGUCACCAUAUU(SEQ ID NO:386) C219.001 AGUCACCAUAUUAAUAAAAAUGC(SEQ ID NO:387) C219.003 AAAGUCACCAUAUUAAUAAAAAU(SEQ ID NO:388) C219.004 AAAAGUCACCAUAUUAAUAAAAA(SEQ ID NO:389) C219.006 UAAAAAGUCACCAUAUUAAUAAA(SEQ ID NO:390) C219.007 UUAAAAAGUCACCAUAUUAAUAA(SEQ ID NO:391)

[0157] In some embodiments, the second sequence in the antisense strand of the dsRNA or the dsRNA of this disclosure contains one or more mismatches with the target sequence. In some embodiments, the target sequence is SEQ ID NO:2 or SEQ ID NO:12. In some embodiments, the second sequence in the antisense strand of the dsRNA contains no more than 4, 3, or 2 mismatches with the target sequence. In some embodiments, the second sequence in the antisense strand of the dsRNA contains no more than 1 mismatch with the target sequence. In some embodiments, the one or more mismatches are not located in the center of the complementary region. In some embodiments, the one or more mismatches are located within five, four, three, two, or one nucleotide from the 5' end and / or 3' end of the complementary region. For example, for a 23-nucleotide dsRNA strand complementary to a region of the PCSK9 gene, the dsRNA typically does not contain any mismatches within the central 13 nucleotides of the complementary region between the dsRNA strand and the PCSK9 mRNA.

[0158] In some embodiments, the dsRNA of this disclosure comprises the sense strand and / or antisense strand described in Table 2 or Table 3. Although the exemplary siRNAs shown in Table 2 include modifications, siRNAs with the same sequence but different numbers / patterns / types of modifications are also considered. siRNAs having the same sequence but without 2'-O-Me and 2'-fluorine modifications are shown in Table 3. In some embodiments, the dsRNA comprises the sense strand shown in Table 3 but lacks 5'CCA and / or 3'invdT. In some embodiments, the dsRNA comprises the antisense strand shown in Table 3 but lacks 3'dTdT.

[0159] Table 2: siRNA sequences (with modifications).

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167] mX = 2'-O-Me nucleotide

[0168] fX = 2'-F nucleotide

[0169] dX = DNA nucleotides

[0170] invdX = reversedX

[0171] Table 3: siRNA sequences (without O-Me and F modifications).

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178] invdX = reversedX nucleotide

[0179] In some embodiments, the dsRNA comprises one or more modified nucleotides as described in PCT Publication WO 2019 / 170731, the disclosure of which is incorporated herein by reference in its entirety. In such modified nucleotides, the ribose ring is replaced by a six-membered heterocycle. This modified nucleotide has the structure of formula (I):

[0180]

[0181] in:

[0182] -B is a heterocyclic nucleobase;

[0183] One of L1 and L2 is a compound of formula (I) linked to a nucleoside linker group of a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or a compound of formula (I) linked to a nucleoside linker group of a polynucleotide.

[0184] -Y is O, NH, NR1, or NC (=O)-R1, where R1 is:

[0185] (C1-C20)alkyl, optionally surrounded by one or more atoms selected from halogen atoms, (C1-C6)alkyl, (C3-C8)cycloalkyl, (C3-C14)heterocyclic, (C6-C14)aryl, (C5-C14)heteroaryl, -O-Z1, -N(Z1)(Z2), -S-Z1,

[0186] Substitution of groups with -CN, -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2) and -N(Z1)-C(=J)-Z2, wherein

[0187] J is either O or S.

[0188] Z1 and Z2 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl group is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl groups.

[0189] (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups, the group being -[C(=O)]m-R2-(O-CH2-CH2)p-R3, wherein

[0190] m represents an integer that is either 0 or 1.

[0191] p is an integer in the range of 0 to 10.

[0192] R2 is a (C1-C20) alkylene group, optionally prefixed with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, ...

[0193] -CN, -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4) or -N(Z3)-C(=K)-Z4 are used as substitutes, where

[0194] K is either O or S.

[0195] Z3 and Z4 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl, and

[0196] R3 is selected from hydrogen atom, (C1-C6)alkyl, (C1-C6)alkoxy, (C3-C8)cycloalkyl, (C3-C14) heterocyclic,

[0197] (C6-C14)aryl or (C5-C14)heteroaryl, or R3 is the cell-targeting moiety.

[0198] -X1 and X2 are each independently a hydrogen atom and a (C1-C6) alkyl group, and

[0199] -Ra, Rb, Rc, and Rd are each independently H or (C1-C6) alkyl groups.

[0200] Or it could be a pharmaceutically acceptable salt.

[0201] In some embodiments, Y is NR1, R1 is an unsubstituted (C1-C20) alkyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3 and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0202] In some embodiments, Y is NR1, R1 is an unsubstituted (C1-C16) alkyl group comprising alkyl groups selected from methyl, isopropyl, butyl, octyl, and hexadecyl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0203] In some embodiments, Y is NR1, R1 is a (C3-C8) cycloalkyl group, which is optionally substituted by one or more groups selected from halogen atoms and (C1-C6) alkyl groups, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3 and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0204] In some implementations, Y is NR1, R1 is cyclohexyl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0205] In some embodiments, Y is NR1, R1 is a (C1-C20) alkyl group substituted with (C6-C14) aryl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3 and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0206] In some embodiments, Y is NR1, R1 is a methyl group substituted with a phenyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3, and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0207] In some embodiments, Y is NC(=O)-R1, R1 is an optionally substituted (C1-C20) alkyl group, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3 and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0208] In some embodiments, Y is NC(=O)-R1, R1 is selected from methyl and pentadecyl, and L1, L2, Ra, Rb, Rc, Rd, X1, X2, R2, R3 and B have the same meaning as defined for general formula (I) or its pharmaceutically acceptable salts.

[0209] In some embodiments, the dsRNA comprises one or more compounds of formula (I), wherein Y is

[0210] a) NR1, wherein R1 is an unsubstituted (C1-C20) alkyl group;

[0211] b) NR1, wherein R1 is an unsubstituted (C1-C16) alkyl group, including alkyl groups selected from methyl, isopropyl, butyl, octyl and hexadecyl;

[0212] c) NR1, wherein R1 is a (C3-C8) cycloalkyl group, which is optionally substituted by one or more groups selected from halogen atoms and (C1-C6) alkyl groups;

[0213] d) NR1, where R1 is cyclohexyl;

[0214] e)NR1, wherein R1 is a (C1-C20) alkyl group substituted with (C6-C14) aryl;

[0215] f)NR1, where R1 is a methyl group substituted with a phenyl group;

[0216] g)NC(=O)-R1, wherein R1 is an optionally substituted (C1-C20) alkyl group; or

[0217] h)NC(=O)-R1, where R1 is methyl or pentadecyl.

[0218] In some embodiments, B is selected from pyrimidines, substituted pyrimidines, purines and substituted purines, or pharmaceutically acceptable salts thereof.

[0219] In some embodiments, the internucleotide linker in the dsRNA is independently selected from phosphodiester, phosphotriester, thiophosphate, dithiophosphate, alkyl-phosphonate, and aminophosphate backbone linkers, or pharmaceutically acceptable salts thereof. In some embodiments, the dsRNA comprises one or more internucleotide linkers, which are independently selected from phosphodiester, phosphotriester, thiophosphate, dithiophosphate, alkyl-phosphonate, and aminophosphate backbone linkers, or pharmaceutically acceptable salts thereof.

[0220] In some embodiments, the dsRNA comprises 2 to 10 compounds of formula (I) or pharmaceutically acceptable salts thereof. In one embodiment, the 2 to 10 compounds of formula (I) are located on the sense strand.

[0221] In another embodiment, the dsRNA comprises one or more target nucleotides or pharmaceutically acceptable salts thereof.

[0222] In some implementations, R3 has equation (II):

[0223]

[0224] Where A1, A2, and A3 are OH,

[0225] A4 is OH or NHC(=O)-R5, wherein R5 is an (C1-C6) alkyl group optionally substituted with a halogen atom, or a pharmaceutically acceptable salt thereof.

[0226] In some implementations, R3 is N-acetylgalactosamine, or a pharmaceutically acceptable salt thereof.

[0227] Precursors for the preparation of modified siRNAs having nucleotides of formula (I) are illustrated in Table A below. Table A shows examples of phosphoramidine nucleotide analogs used for oligonucleotide synthesis. In the (2S,6R) diastereomer series, phosphoramidine as a nucleotide precursor is abbreviated as "pre-l", and nucleotide analog is abbreviated as "l", followed by a nucleobase and a number that designates the group Y in formula (I). To distinguish the two stereochemicals, the analog (2R,6R)-diastereomer is indicated by an additional "b". Target nucleotide precursors, target nucleotide analogs, and solid supports are abbreviated as described above, but "l" is replaced by "lg".

[0228] Table A

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236] The modified nucleotide of formula (I) may be incorporated into the 5' end, 3' end, or both ends of the sense strand and / or antisense strand of the dsRNA. For example, one or more (e.g., 1, 2, 3, 4, or 5 or more) modified nucleotides may be incorporated into the 5' end of the sense strand of the dsRNA. In some embodiments, one or more (e.g., 1, 2, 3 or more) modified nucleotides are located at the 5' end of the sense strand, wherein the modified nucleotides are not complementary to the antisense sequence, but may optionally pair with an equal or fewer number of complementary nucleotides at the corresponding 3' end of the antisense strand.

[0237] In some embodiments, the dsRNA may comprise a sense strand having a sense sequence of 17, 18, or 19 nucleotides in length, wherein three to five nucleotides of formula (I) (e.g., three consecutive lgT3 or lgT7, with or without additional nucleotides of formula (I)) are positioned at the 5' end of the sense sequence, such that the sense strand is 20, 21, or 22 nucleotides in length. In such embodiments, the sense strand may further include two consecutive nucleotides of formula (I) (e.g., 1T4 or 1T3) at the 3' end of the sense sequence, such that the sense strand is 22, 23, or 24 nucleotides in length. The dsRNA may comprise an antisense sequence of 19 nucleotides in length, wherein the antisense sequence may be further linked to two modified nucleotides or deoxyribonucleotides (e.g., dT) at its 3' end, such that the antisense strand is 21 nucleotides in length. In another embodiment, the sense strand of the dsRNA contains only naturally occurring internucleotide bonds (phosphodiester bonds), while the antisense strand may optionally contain non-naturally occurring internucleotide bonds. For example, the antisense strand may contain phosphate thioester bonds in the backbone near its 5' end and / or 3' end, or at its 5' end and / or 3' end.

[0238] In some implementations, using the modified nucleotide of formula (I) avoids the need for other RNA modifications (such as the use of non-naturally occurring nucleotide internucleotide bonds), thereby simplifying the chemical synthesis of dsRNA. Furthermore, the modified nucleotide of formula (I) can be readily prepared to contain cell-targeting moieties, such as GalNAc derivatives (which include GalNAc itself), enhancing the delivery efficiency of dsRNAs incorporating such nucleotides. Additionally, it has been shown that dsRNAs incorporating, for example, the sense strand of the modified nucleotide of formula (I) significantly improve dsRNA stability and therapeutic efficacy.

[0239] In some embodiments, the dsRNA of this disclosure comprises a sense strand and / or an antisense strand as described in double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence, wherein the first sequence is complementary to the second sequence, wherein the first sequence comprises a sequence selected from SEQ ID NO: 6-11 and 310-321. The siRNA in Table 4 may comprise any one or more of the following modifications: mX = 2'-O-methyl-nucleotide, fX = 2'-fluoronucleotide, lX = locked nucleotide, dT = deoxythymidine, lgT3 = lgT3 nucleotide analog, lT4 = lT4 nucleotide analog, PO = phosphodiester linker; and PS = phosphate thioester linker.

[0240] Table 4: Optimized PCSK9 GalNAc siRNA

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263] In some implementations, the dsRNA of this disclosure includes:

[0264] a) a sense strand comprising a nucleotide sequence selected from SEQ ID NO: 578, 585, 587, 620, 621, 622 and 627; and / or

[0265] b) An antisense strand containing nucleotide sequences selected from SEQ ID NO:589, 591, 631, 632, 634, 635 and 639.

[0266] In some embodiments, the sense and antisense strands of the dsRNA each comprise the following nucleotide sequences:

[0267] a) SEQ ID NO: 578 and 589; [C027.001]

[0268] b) SEQ ID NO: 620 and 631; [C027.003]

[0269] c) SEQ ID NO: 585 and 591; [C027.001#40]

[0270] d) SEQ ID NO: 587 and 591; [C027.001#58]

[0271] e) SEQ ID NO: 621 and 634; [C027.003#03]

[0272] f) SEQ ID NO: 622 and 632; [C027.003#06]

[0273] g) SEQ ID NO: 622 and 635; and [C027.003#08]

[0274] h)SEQ ID NO: 627 and 639; [C027.003#47]

[0275] In some embodiments, the dsRNA of this disclosure (e.g., a first dsRNA) is used in a method or composition (e.g., a pharmaceutical composition) along with one or more additional dsRNAs (e.g., at least a second dsRNA). In some embodiments, the second dsRNA also targets PCSK9. In some embodiments, the second dsRNA targets a region of PCSK9 different from the region targeted by the first dsRNA. In some embodiments, the second dsRNA targets a sequence derived from an mRNA sequence formed during the expression of a target gene other than the PCSK9 gene. In some embodiments, the second dsRNA targets genes that interact with PCSK9 and / or genes involved in lipid metabolism or cholesterol metabolism.

[0276] dsRNA modification

[0277] In some embodiments, the dsRNA of this disclosure includes one or more modifications. Modifications may include any modifications known in the art, including, for example, terminal modifications, base modifications, sugar modifications / substitutions, and backbone modifications. Terminal modifications may include, for example, 5' terminal modifications (such as phosphorylation, conjugation, reverse linkage, etc.) and 3' terminal modifications (such as conjugates, DNA nucleotides, reverse linkage, etc.). Base modifications may include, for example, the substitution of a stabilizing base, a destabilizing base, a base that pairs with an extended mate library, base removal (debaseted nucleotide), or conjugated base substitution. Sugar modifications / substitutions may include, for example, modifications or sugar substitutions at the 2' or 4' position. Backbone modifications may include, for example, modifications or substitutions involving phosphodiester linkages.

[0278] The dsRNA disclosed herein may include one or more modified nucleotides known in the art, including 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, 2'-O-methoxyethyl modified nucleotides, modified nucleotides containing alternating internucleotide linkages (such as thiophosphate and phosphorothioate (e.g., 5'-thiophosphate)), phosphotriester modified nucleotides, modified nucleotides terminally linked to cholesterol derivatives or lipophilic moieties, and peptide nucleic acids (PNAs; see Nielsen et al. (1991) Science). 254, 1497-1500), restricted ethyl (cEt) modified nucleotides, reverse deoxy modified nucleotides, reverse dideoxy modified nucleotides, locked nucleic acid modified nucleotides, debase modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino modified nucleotides, aminophosphate modified nucleotides, modified nucleotides containing modifications at other sites of the sugar or base of the oligonucleotide, and modified nucleotides containing non-natural bases. In some embodiments, at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-thiophosphate nucleotide, or a terminal nucleotide linked to a cholesterol derivative or lipophilic moiety. Incorporation of a 2'-O-methyl, 2'-O-ethyl, 2'-O-propyl, 2'-O-allyl, 2'-O-aminoalkyl, or 2'-deoxy-2'-fluoro group into the nucleoside of the oligonucleotide can confer enhanced hybridization properties and / or enhanced nuclease stability to the oligonucleotide. In addition, oligonucleotides containing a thiophosphate backbone can have enhanced nuclease stability.

[0279] In some embodiments, the dsRNA of this disclosure comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises two or more 2'-O-methyl nucleotides and two or more 2'-fluoro nucleotides. In some embodiments, the dsRNA comprises alternating patterns of two or more 2'-O-methyl nucleotides (OMe) and two or more 2'-fluoro nucleotides (F), such alternating patterns are, for example, OMe-F-OMe-F or F-OMe-F-OMe. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides, each of which is a 2'-O-methyl nucleotide. In some embodiments, the dsRNA comprises up to 10 consecutive nucleotides, each of which is a 2'-fluoro nucleotide.

[0280] In some embodiments, the dsRNA of this disclosure comprises one or more phosphate thioester groups. In some embodiments, the dsRNA of this disclosure comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more phosphate thioester groups. In some embodiments, the dsRNA does not contain phosphate thioester groups.

[0281] In some embodiments, the dsRNA comprises one or more phosphotriester groups. In some embodiments, the dsRNA comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more phosphotriester groups. In some embodiments, the dsRNA does not contain phosphotriester groups.

[0282] In some embodiments, the dsRNA comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different modified nucleotides as described herein. In some embodiments, the dsRNA comprises up to two consecutive modified nucleotides, up to three consecutive modified nucleotides, up to four consecutive modified nucleotides, up to five consecutive modified nucleotides, up to six consecutive modified nucleotides, up to seven consecutive modified nucleotides, up to eight consecutive modified nucleotides, up to nine consecutive modified nucleotides, or up to ten consecutive modified nucleotides. In some embodiments, the consecutive modified nucleotides are the same modified nucleotide. In some embodiments, the consecutive modified nucleotides are two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more different modified nucleotides.

[0283] dsRNA conjugates

[0284] The dsRNA of this disclosure can be chemically / physically linked to one or more ligands, portions, or conjugates. In some embodiments, the dsRNA is conjugated / attached to one or more ligands via a linker. Any linker known in the art can be used, including, for example, a trivalent branched linker. Conjugating a ligand to the dsRNA can alter its distribution, enhance its cellular uptake and / or target specific tissues and / or be taken up by one or more specific cell types (e.g., hepatocytes), and / or enhance the lifetime of the dsRNA agent. In some embodiments, hydrophobic ligands are conjugated to the dsRNA to facilitate direct penetration of the cell membrane and / or transcellular uptake (e.g., hepatocytes).

[0285] In some embodiments, the dsRNA attaches to one or more N-acetylgalactosamine (GalNAc) derivatives via a adapter. In some embodiments, the dsRNA attaches to three or more GalNAc derivatives via a adapter. In some embodiments, the adapter is a trivalent branched adapter. In some embodiments, the dsRNA attaches to three or more GalNAc derivatives via a trivalent branched adapter. In some embodiments, the one or more GalNAc derivatives are attached to the 3' end of the sense strand, the 3' end of the antisense strand, the 5' end of the sense strand, and / or the 5' end of the antisense strand of the dsRNA.

[0286] Exemplary and non-limiting conjugates and connectors are described in, for example, Biessen et al., Bioconjugate Chem. 13(2):295-302 (2002); Cedillo et al., Molecules 22(8):E1356 (2017); Grijalvo et al., Genes 9(2):E74 (2018); Huang et al., Molecular Therapy: Nucleic Acids 6:116-132 (2017); Nair et al., J. Am. Chem. Soc. 136:16958-16961 (2014); Ostergaard et al., Bioconjugate Chem. 26:1451-1455 (2015); Springer et al., Nucleic Acids Therapeutics 28(3):109-118 (2018); and U.S. Patents 8,106,022, 9,127,276, and 8,927,705. GalNAc conjugation can be readily performed by methods well known in the art (e.g., as described in the above-mentioned documents).

[0287] In some embodiments, the dsRNA of this disclosure is attached to the following compounds.

[0288]

[0289] In some embodiments, the ligand is one or more targeting groups (e.g., cell or tissue targets), such as one or more proteins, glycoproteins, peptides, or molecules that have a specific affinity for the co-ligand. Such ligands may include, but are not limited to, lectins, glycoproteins, lipids, or proteins, such as antibodies, that bind to a specific cell type (e.g., hepatocytes). Targeting groups may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, or biotin.

[0290] Ligands may include, for example, naturally occurring substances such as proteins, carbohydrates (e.g., N-acetyl-glucosamine or N-acetyl-galactosamine), lipopolysaccharides, lipids, recombinant or synthetic molecules (e.g., synthetic polymers), polyamines, α-helical peptides, lectins, vitamins, and cofactors. In some embodiments, the ligand is one or more dyes, cross-linking agents, polycyclic aromatic hydrocarbons, peptide conjugates (e.g., antennal foot peptides, Tat peptides), polyethylene glycol (PEG), enzymes, haptens, transport / absorption promoters, synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, or imidazole clusters), human serum albumin (HSA), or LDL.

[0291] In some embodiments, the dsRNA is conjugated to one or more cholesterol derivatives or lipophilic moieties. Any lipophilic compound known in the art can be conjugated to the dsRNA, including, but not limited to, cholesterol or cholesterol derivatives; bile acids; vitamins (such as folic acid, vitamin A, vitamin E (tocopherol), biotin, pyridoxal); bile acids or fatty acid conjugates, including both saturated and unsaturated ones (such as lauroyl (C...)). 12 ), myristoyl (C 14 ) and palmitoyl (C 16 ), stearyl (C 18 ) and docosanoyl (C 22 ), lithocholic acid and / or lithocholic acid oleylamine conjugate (lithocholic acid-oleylene, C 43Polymer backbones or scaffolds (such as PEG, triethylene glycol (TEG), hexaethylene glycol (HEG), poly(lactic-co-glycolic acid) (PLGA), poly(lactide-co-glycolic acid) (PLG), hydrodynamic polymers); steroids (such as dihydrotestosterone); terpenes (such as triterpenes); cationic lipids or peptides; and / or lipids or lipid-based molecules. Such lipids or lipid-based molecules can bind serum proteins, such as human serum albumin (HSA). Lipid-based ligands can be used to modulate (e.g., control) the binding of the conjugate to the target tissue. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to target the kidney and therefore less likely to be cleared from the body. The target tissue can be the liver, including the parenchymal cells of the liver.

[0292] I. Composition

[0293] Certain aspects of this disclosure relate to compositions (e.g., pharmaceutical compositions) comprising dsRNA as described herein. In one embodiment, the composition (e.g., pharmaceutical composition) further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition (e.g., pharmaceutical composition) is used to treat diseases or disorders associated with the expression or activity of the PCSK9 gene. In some embodiments, the diseases or disorders associated with the expression of the PCSK9 gene are lipemia (e.g., hyperlipidemia) and / or other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases. The compositions (e.g., pharmaceutical compositions) of this disclosure are formulated based on delivery modes, including, for example, compositions formulated for delivery to the liver via parenteral administration.

[0294] The compositions of this disclosure (e.g., pharmaceutical compositions) can be administered at a dose sufficient to inhibit the expression of the PCSK9 gene. In some embodiments, a suitable dose of dsRNA is in the range of 0.01 mg / kg to 200 mg / kg of the recipient's body weight.

[0295] Those skilled in the art will understand that certain factors may influence the dosage and timing required for effective treatment of a subject. These factors include, but are not limited to, the severity of the disease or disorder, prior treatment, the subject's overall health and / or age, and the presence of one or more other diseases. Furthermore, treatment of a subject with a therapeutically effective amount of the pharmaceutical composition may comprise a single treatment or a series of treatments. The effective dose and in vivo half-life of dsRNA as disclosed herein can be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0296] The dsRNA molecules disclosed herein can be formulated in pharmaceutically acceptable carriers or diluents. Pharmaceutically acceptable carriers can be liquids or solids and can be selected based on the intended mode of administration to provide the desired volume, consistency, and other relevant transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent can be used, including, for example, water, saline solutions, binders (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose), fillers (e.g., lactose and other sugars, gelatin or calcium sulfate), lubricants (e.g., starch, polyethylene glycol, or sodium acetate), disintegrants (e.g., starch or sodium starch-hydroxyacetate), calcium salts (e.g., calcium sulfate, calcium chloride, calcium phosphate, etc.), and wetting agents (e.g., sodium dodecyl sulfate).

[0297] The dsRNA molecules of this disclosure can be formulated into compositions (e.g., pharmaceutical compositions) containing dsRNA that is mixed, encapsulated, conjugated, or otherwise associated with other molecules, molecular structures, or nucleic acid mixtures. For example, compositions containing one or more dsRNAs as described herein may contain other therapeutic agents, such as other lipid-lowering agents (e.g., statins). In some embodiments, the compositions (e.g., pharmaceutical compositions) also contain a delivery medium (as described herein).

[0298] II. Methods for preparing dsRNA

[0299] The dsRNA disclosed herein can be synthesized by any method known in the art. For example, dsRNA can be synthesized by using an automated synthesizer, by in vitro transcription and purification (e.g., using a commercially available in vitro RNA synthesis kit), by transcription and purification from cells (e.g., cells containing an expression cassette / vector encoding dsRNA).

[0300] Preparation of modified dsRNA

[0301] The dsRNA and ligand-molecules with ligands of sequence-specific nucleosides linked in this disclosure can be assembled by any method known in the art, including, for example, by using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors already with linker portions, ligand-nucleotide or nucleoside-conjugate precursors already with ligand molecules, or building blocks with non-nucleoside ligands on a suitable DNA synthesizer.

[0302] The ligand-conjugated dsRNAs of this disclosure can be synthesized by any method known in the art, including, for example, by using dsRNAs with lateral reactive functional groups (such as lateral reactive functional groups obtained by attaching a linker molecule to the dsRNA). In some embodiments, this reactive oligonucleotide can react directly with a commercially available ligand, a synthetic ligand with any of a variety of protecting groups, or a ligand having an attached linker portion. In some embodiments, the method facilitates the synthesis of ligand-conjugated dsRNAs by using nucleoside monomers that have been appropriately conjugated to a ligand and can be further attached to a solid support material. In some embodiments, dsRNAs with an aralkyl ligand attached to the 3' end of the dsRNA are prepared by first covalently attaching a monomer building block to a controlled-pore glass support via a long-chain aminoalkyl group; then, by binding the nucleotide to the monomer building block attached to the solid support via standard solid-phase synthesis techniques. The monomer building block can be a nucleoside or other organic compound compatible with solid-phase synthesis.

[0303] In some embodiments, a functionalized nucleoside sequence of this disclosure having an amino group at the 5' end is prepared using a DNA synthesizer and then reacted with an active ester derivative of a selected ligand. The active ester derivative is well known to those skilled in the art. The reaction of the amino group with the active ester yields an oligonucleotide, wherein the selected ligand is attached to the 5' position via a linker group. The 5'-terminal amino group can be prepared using a 5'-amino-modifying agent, C6 reagent. In some embodiments, the ligand molecule is conjugated to the oligonucleotide at the 5' position using a ligand-nucleoside phosphoramidite, wherein the ligand is directly or indirectly linked to the 5'-hydroxyl group via a linker. Such ligand-nucleoside phosphoramidites are typically used at the end of an automated synthesis procedure to provide a ligand-conjugated oligonucleotide with a ligand at the 5' end.

[0304] III. Vector and dsRNA Delivery

[0305] The dsRNA disclosed herein can be delivered directly or indirectly. In some embodiments, the dsRNA is delivered directly by administering to a subject a composition containing the dsRNA (e.g., a pharmaceutical composition). In some embodiments, the dsRNA is delivered indirectly by administering one or more of the vectors described herein.

[0306] deliver

[0307] The dsRNA of this disclosure can be delivered by any method known in the art, including, for example, by adapting a method for delivering nucleic acid molecules to deliver dsRNA (see, for example, Akhtar, S. et al. (1992) Trends Cell. Biol. 2(5):139-144; WO 94 / 02595), or by other methods known in the art (see, for example, Kanasty, R. et al. (2013) Nature Materials 12:967-977; Wittrup, A. and Lieberman, J. (2015) Nature Reviews Genetics 16:543-552; Whitehead, K. et al. (2009) Nature Reviews Drug Discovery 8:129-138; Gary, D. et al. (2007) 121(1-2):64-73; Wang, J. et al. (2010) AAPS J. 12(4):492-503; Draz, M. et al. (2014) Theranostics 4(9):872-892; Wan, C. et al. (2013) Drug Deliv. And Transl. Res. 4(1):74-83; Erdmann, VA and Barciszewski, J. (edited) (2010) "RNA Technologies and Their Applications", Springer-Verlag Berlin Heidelberg, DOI 10.1007 / 978-3-642-12168-5; Xu, C. and Wang, J. (2015) Asian Journal of Pharmaceutical Sciences 10(1):1-12.

[0308] In some embodiments, the dsRNA of this disclosure is delivered via a delivery medium containing the dsRNA. In some embodiments, the delivery medium is a liposome, a liposome complex, a complex, or nanoparticles.

[0309] Liposome formulations

[0310] Liposomes are monolayered and multilayered vesicles having a membrane formed of a lipophilic material and an aqueous interior. In some embodiments, liposomes are vesicles composed of amphiphilic lipids arranged in one or more spherical bilayers. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with cell walls. Advantages of liposomes include, for example, that liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can be incorporated into a wide range of water-soluble and lipid-soluble drugs; and liposomes can protect the encapsulated drug in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (eds.), 1988, Marcel Dekker, Inc., New York, NY, Vol. 1, p. 245). In the preparation of liposome formulations, important considerations are lipid surface charge, vesicle size, and the aqueous volume of the liposome. For example, engineered cationic liposomes and spatially stable liposomes can be used to deliver the dsRNA. See, for example, Podesta et al. (2009) Methods Enzymol. 464,343-54; U.S. Patent No. 5,665,710.

[0311] Nucleic acid-lipid particles

[0312] In some embodiments, the dsRNA of this disclosure is completely encapsulated in a lipid formulation, for example, forming nucleic acid-lipid particles, such as SPLP, pSPLP, or SNALP. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle containing plasmid DNA encapsulated within lipid vesicles. Nucleic acid-lipid particles (e.g., SNALP) typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALP and SPLP can be used for systemic application because they exhibit prolonged circulation life after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically separate from the application site). SPLP includes "pSPLP," which comprises an encapsulated condenser-nucleic acid complex as shown in PCT Publication No. WO 00 / 03683.

[0313] In some embodiments, dsRNA is resistant to nuclease degradation in aqueous solutions when present in nucleic acid-lipid particles. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Patent Nos. 5,976,567; 6,534,484; 6,815,432; and PCT Application No. WO 96 / 40964.

[0314] In some embodiments, the nucleic acid-lipid particles comprise cationic lipids. Any cationic lipid or mixture thereof known in the art can be used. In some embodiments, the nucleic acid-lipid particles comprise non-cationic lipids. Any non-cationic lipid or mixture thereof known in the art can be used. In some embodiments, the nucleic acid-lipid particles comprise conjugated lipids (e.g., to prevent aggregation). Any conjugated lipid known in the art can be used.

[0315] Other ingredients

[0316] Important factors to consider for successful in vivo delivery of dsRNA molecules include: (1) the biostability of the delivered molecule, (2) prevention of nonspecific effects, and (3) accumulation of the delivered molecule in the target tissue. Nonspecific effects of dsRNA can be minimized by local administration, such as by direct injection or implantation into tissues, or by local application of the formulation. For systemic administration of dsRNA to treat disease, the dsRNA can be modified or delivered using alternative drug delivery systems; both methods are intended to prevent rapid degradation of the dsRNA by endonucleases and exonucleases in vivo. Modification of the RNA or drug carrier can also allow the dsRNA composition to target the target tissue and avoid undesirable off-target effects. As mentioned above, dsRNA molecules can be modified by chemically conjugating with lipophilic groups (such as cholesterol) to enhance cellular uptake and prevent degradation. In some embodiments, the dsRNA is delivered using a drug delivery system such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems. Positively charged cationic delivery systems facilitate the binding of dsRNA molecules (which are negatively charged) and also enhance interactions at negatively charged cell membranes to allow for efficient cellular uptake of dsRNA. Cationic lipids, dendritic polymers, or polymers can bind to dsRNA or be induced to form vesicles or micelles encapsulating dsRNA (see, for example, Kim SH et al. (2008) Journal of Controlled Release 129(2):107-116). The formation of vesicles or micelles further prevents the degradation of dsRNA during systemic administration. Methods for preparing and administering cationic-dsRNA complexes are known in the art. In some embodiments, dsRNA forms a complex with cyclodextrin for systemic administration.

[0317] Vectors encoding dsRNA

[0318] The dsRNA of this disclosure can be encoded by a recombinant vector. In some embodiments, the vector is a DNA vector or an RNA vector. In some embodiments, the vector is a plasmid, granulosome, or viral vector. In some embodiments, the vector is compatible with expression in prokaryotic cells. In some embodiments, the vector is compatible with expression in *E. coli*. In some embodiments, the vector is compatible with expression in eukaryotic cells. In some embodiments, the vector is compatible with expression in yeast cells. In some embodiments, the vector is compatible with expression in vertebrate cells. Any expression vector known in the art capable of encoding the dsRNA can be used, including, for example, vectors derived from adenovirus (AV), adeno-associated virus (AAV), retroviruses (e.g., lentivirus (LV), rhabdovirus, murine leukemia virus, etc.), herpesviruses, SV40 viruses, polyomaviruses, papillomaviruses, piconemaviruses, poxviruses (e.g., orthopox or fowlpox), etc. The tropism of a viral vector or viral source vector can be modified by pseudotyping the vector with envelope proteins or other surface antigens from one or more other viruses, or by replacing different viral capsid proteins (as the case may be). For example, a lentiviral vector can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mokola virus, etc. AAV vectors can be prepared to target different cells by engineering vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on the serotype 2 genome is called AAV 2 / 2. This serotype 2 capsid gene in the AAV 2 / 2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2 / 5 vector. Techniques for constructing AAV vectors expressing different capsid protein serotypes have been previously described, for example, Rabinowitz et al. (2002) J.Virol. 76:791-801.

[0319] The selection of recombinant vectors, methods for inserting nucleic acid sequences into vectors to express dsRNA, and methods for delivering vectors to one or more target cells are known in the art. See, for example, Domburg (1995) Gene Therap. 2:301-310; Eglitis (1998) Biotechniques 6:608-614; Miller (1990) Hum. Gene Therap. 1:5-14; Anderson (1998) Nature. 392:25-30; Xia et al. (2002) Nat. Biotech. 20:1006-1010; Robinson et al. (2003) Nat. Genet. 33:401-406; Samulski et al. (1987) J. Virol. 61:3096-3101; Fisher et al. (1996) J. Virol. 70:520-532; Samulski et al. (1989) J. Virol. 63-3822-3826; U.S. Patent No. 5,252,479; U.S. Patent No. 5,139,941; WO 94 / 13788; and WO 93 / 24641.

[0320] Vectors that can be used to deliver dsRNA as described herein may include regulatory elements (e.g., heterologous promoters, enhancers, etc.) sufficient to express the dsRNA in desired target cells or tissues. In some embodiments, the vector comprises one or more sequences encoding the dsRNA linked to one or more heterologous promoters. Any heterologous promoter known in the art capable of expressing dsRNA may be used, including, for example, the U6 or H1 RNApol III promoter, the T7 promoter, and cytomegalovirus promoters. The one or more heterologous promoters may be inducible promoters, repressive promoters, regulatory promoters, and / or tissue-specific promoters. The selection of additional promoters is within the capabilities of those skilled in the art. In some embodiments, the regulatory element is selected to provide constitutive expression. In some embodiments, the regulatory element is selected to provide regulatory / inducible / repressive expression. In some embodiments, the regulatory element is selected to provide tissue-specific expression. In some embodiments, the regulatory element and the sequence encoding the dsRNA form a transcription unit.

[0321] The dsRNAs of this disclosure can be expressed from transcriptional units inserted into DNA or RNA vectors (see, for example, Couture, A et al. (1996) TIG 12:5-10; WO 00 / 22113; WO 00 / 22114; and U.S. Patent No. 6,054,299). Expression can be transient (on the order of hours to weeks) or persistent (weeks to months or longer), depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative. The transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann et al. (1995) PNAS 92:1292).

[0322] In some embodiments, the sense and antisense strands of the dsRNA are encoded on separate expression vectors. In some embodiments, the sense and antisense strands are expressed on two separate expression vectors co-introduced (e.g., by transfection or infection) into the same target cells. In some embodiments, the sense and antisense strands are encoded on the same expression vector. In some embodiments, the sense and antisense strands are transcribed from separate promoters located on the same expression vector. In some embodiments, the sense and antisense strands are transcribed from the same promoter on the same expression vector. In some embodiments, the sense and antisense strands are transcribed from the same promoter into inverted repeat sequences linked by a linker polynucleotide sequence, such that the dsRNA has a stem-loop structure.

[0323] IV. Cells

[0324] Certain aspects of this disclosure relate to one or more isolated cells containing dsRNA as described herein, or one or more cells containing a vector encoding dsRNA as described herein. In some embodiments, the one or more cells are prokaryotic cells. In some embodiments, the one or more cells are *E. coli* cells. In some embodiments, the one or more cells are eukaryotic cells. Any eukaryotic cell known in the art may contain the dsRNA or vector described herein, including, for example, yeast cells; SV40-transformed monkey kidney CV1 cell line (COS-7, ATCC CRL1651); human embryonic kidney cell line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)); juvenile hamster kidney cells (BHK, ATCC CCL 10); mouse sciutto cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical cancer cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL34); Buffalo rat hepatocytes (BRL 3A, ATCC CRL 1651). 1442); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); Hep3B cells; C3A cells; mouse mammary tumors (MMT 060562, ATCC CCL51); CHO cells (e.g., DHFR-CHO cells, such as ATCC CRL-9096); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; myeloma cell lines (e.g., NSO and Sp2 / 0); and primary cells from the subjects (e.g., primary cells isolated from humans or non-human primates).

[0325] V. Using dsRNA methods

[0326] Certain aspects of this disclosure relate to methods for inhibiting the expression of the PCSK9 gene in mammals, the methods comprising administering an effective amount of one or more dsRNAs of this disclosure, one or more vectors of this disclosure, or a composition of this disclosure containing one or more dsRNAs of this disclosure (e.g., a pharmaceutical composition). Certain aspects of this disclosure relate to methods for treating and / or preventing one or more PCSK9-mediated diseases or disorders, the methods comprising administering one or more dsRNAs of this disclosure and / or one or more vectors of this disclosure and / or a composition containing one or more dsRNAs of this disclosure (e.g., a pharmaceutical composition). In some embodiments, downregulating PCSK9 expression in a subject alleviates one or more symptoms of the subject's PCSK9-mediated disease or disorder. Examples of dsRNAs are described in Part II.

[0327] In some implementations, compared with pre-treatment levels, the expression of the PCSK9 gene in the subject was suppressed by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or about 100%. In some embodiments, PCSK9 gene expression is suppressed by at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 4.5-fold, at least about 5-fold, at least about 5.5-fold, at least about 6-fold, at least about 6.5-fold, at least about 7-fold, at least about 7.5-fold, at least about 8-fold, at least about 8.5-fold, at least about 9-fold, at least about 9.5-fold, at least about 10-fold, at least about 25-fold, at least about 50-fold, at least about 75-fold, or at least about 100-fold after treatment compared to pre-treatment levels. In some embodiments, the PCSK9 gene is suppressed in the liver of the subject.

[0328] In some embodiments, the subject is a human being. In some embodiments, the subject has or has been diagnosed with a PCSK9-mediated disorder or disease. In some embodiments, the subject is suspected of having a PCSK9-mediated disorder or disease. In some embodiments, the subject is at risk of developing a PCSK9-mediated disorder or disease.

[0329] The dsRNA and compositions (e.g., pharmaceutical compositions) described herein can be used to treat lipemia (e.g., hyperlipidemia) and / or other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases. In some embodiments, the method includes administering an effective amount of the dsRNA to a subject having a heterozygous LDLR genotype.

[0330] In some embodiments, the effect of inhibiting PCSK9 gene expression by any of the methods described herein results in a decrease in cholesterol levels in the subject. In some embodiments, the effect of inhibiting PCSK9 gene expression results in a decrease in blood cholesterol in the subject. In some embodiments, the effect of inhibiting PCSK9 gene expression results in a decrease in serum cholesterol in the subject. In some embodiments, cholesterol levels are reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, or more compared to pre-treatment levels. In some implementations, cholesterol levels are reduced by at least approximately 1.1 times, at least approximately 1.5 times, at least approximately 2 times, at least approximately 2.5 times, at least approximately 3 times, at least approximately 3.5 times, at least approximately 4 times, at least approximately 4.5 times, at least approximately 5 times, at least approximately 5.5 times, at least approximately 6 times, at least approximately 6.5 times, at least approximately 7 times, at least approximately 7.5 times, at least approximately 8 times, at least approximately 8.5 times, at least approximately 9 times, at least approximately 9.5 times, at least approximately 10 times, at least approximately 25 times, at least approximately 50 times, at least approximately 75 times, at least approximately 100 times or more compared to pre-treatment levels.

[0331] The dsRNA or composition (e.g., pharmaceutical composition) described herein can be administered by any means known in the art, including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, pulmonary, transdermal, and airway (aerosol) administration. Typically, when treating mammals with hyperlipidemia, dsRNA molecules are administered systemically via parenteral means. In some embodiments, the dsRNA and / or composition is administered subcutaneously. In some embodiments, the dsRNA and / or composition is administered intravenously. In some embodiments, the dsRNA and / or composition is administered pulmonaryly.

[0332] The therapeutic or preventative effect of dsRNA is evident when one or more parameters of a disease state show statistically significant improvement, or when the previously expected symptoms do not worsen or develop. For example, a favorable change of at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more in a measurable parameter of the disease can indicate effective treatment. The efficacy of a given dsRNA or a composition containing said dsRNA can also be determined using experimental animal models of a given disease or disorder known in the art. When using experimental animal models, efficacy of treatment is demonstrated when a statistically significant reduction in markers or symptoms is observed.

[0333] Other medicines

[0334] In some embodiments, the dsRNA of this disclosure is administered in combination with one or more additional therapeutic agents. In some embodiments, the dsRNA and additional therapeutic agents are administered in combination in the same composition. In some embodiments, the dsRNA and additional therapeutic agents are administered as part of a separate composition. In some embodiments, the separate compositions are administered in parallel. In some embodiments, the composition containing the dsRNA is first administered to the subject, and then the additional therapeutic agent is administered to the subject. In some embodiments, the composition containing the additional therapeutic agent is first administered to the subject, and then the composition containing the dsRNA is administered to the subject.

[0335] Examples of other therapeutic agents include any known therapeutic agents for treating lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia. For example, these other agents may be one or more of the following: HMG-CoA reductase inhibitors (e.g., statins), fibrates, bile acid sequestrants, niacin, antiplatelet agents, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists (e.g., losartan potassium), acyl-CoA cholesterol acyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesterol ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol regulators, bile acid regulators, or peroxisome proliferator-activated receptor (PPAR) agonists. Specific examples include, but are not limited to, atorvastatin, pravastatin, simvastatin, lovastatin, fluvastatin, cerivastatin, rosuvastatin, ezetimibe, bezafibrate, clofibrate, fenofibrate, gemfibrozil, ciprofibrate, cholestyramine, colestipol, colesvelam, and niacin. Exemplary combination therapies suitable for administration with dsRNAs targeting PCSK9 include, for example, niacin / lovastatin, amlodipine / atorvastatin, and ezetimibe / simvastatin.

[0336] In some embodiments, this disclosure provides a method for instructing an end user (e.g., a caregiver or subject) on how to administer the dsRNA described herein. The method includes optionally providing the end user with one or more doses of the dsRNA, and instructing the end user to administer the dsRNA according to the protocol described herein, thereby instructing the end user.

[0337] Patient identification

[0338] In some embodiments, this disclosure provides a method for treating a subject by selecting the subject based on whether the subject requires a reduction in LDL, a reduction in LDL without a reduction in HDL, a reduction in ApoB, or a reduction in total cholesterol. In some embodiments, the method includes administering to the subject an amount of dsRNA sufficient to reduce the subject's LDL or ApoB levels (e.g., without substantially reducing HDL levels).

[0339] Genetic predisposition plays a role in the development of target gene-related diseases, such as hyperlipidemia. Therefore, subjects requiring dsRNA can be identified by obtaining a family history, or by screening for one or more genetic markers or variants, for example. Examples of genes involved in hyperlipidemia may include, but are not limited to, LDL receptor (LDLR), apolipoproteins (ApoA1, ApoB, ApoE, etc.), cholesterol ester transfer protein (CETP), lipoprotein lipase (LPL), hepatic lipase (LIPC), endothelial lipase (EL), and lecithin:cholesterol acyltransferase (LCAT).

[0340] Healthcare providers (such as doctors, nurses, or family members) can obtain family history before prescribing or administering dsRNA. Additionally, tests can be performed to determine genotype or phenotype. For example, a sample (e.g., a blood sample) from the subject can be DNA tested to identify the PCSK9 genotype and / or phenotype before PCSK9 dsRNA is administered to the subject. In some embodiments, tests are performed to identify associated genotypes and / or phenotypes, such as the LDLR genotype. Examples of genetic variants of the LDLR gene known in the art are (Costanza et al. (2005) Am. J. Epidemiol. 15; 161(8): 714-24; Yamada et al. (2008) J. Med. Genet. Jan; 45(1): 22-8; and Boes et al. (2009) Exp. Gerontol. 44: 136-160).

[0341] VI. Reagent kits and products

[0342] Certain aspects of this disclosure relate to articles or kits that can be used to treat and / or prevent PCSK9-mediated disorders or diseases as described above, comprising one or more dsRNAs, one or more vectors, or one or more compositions (e.g., one or more pharmaceutical compositions) as described herein. The articles or kits may also include a container and a label or packaging insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be made of a variety of materials, such as glass or plastic. The container contains the composition itself or in combination with another composition that is effective in treating or preventing the disease, and may have a sterile inlet (e.g., the container may be an intravenous infusion bag or a vial with a stopper that can be punctured by a hypodermic needle). At least one active agent in the composition is a dsRNA as described herein. The label or packaging insert indicates that the composition is intended for the treatment of PCSK9-mediated disorders or diseases. In some embodiments, the disease is lipemia (e.g., hyperlipidemia) and / or other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart and circulatory system diseases. Furthermore, the article or kit may comprise (a) a first container containing a composition comprising the dsRNA described herein; and (b) a second container containing a composition comprising a second therapeutic agent. The article or kit in this embodiment of the present disclosure may also include a packaging insert indicating that the composition can be used to treat a specific disease. Alternatively or additionally, the article or kit may further include a second (or third) container containing a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and glucose solution. The article or kit may also include other materials required from a commercial and user perspective, including additional buffers, diluents, filters, needles, and syringes.

[0343] Without limiting this disclosure, several embodiments of this disclosure are described below for illustrative purposes.

[0344] Item 1: A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first sequence is complementary to the second sequence, and wherein the first sequence comprises a sequence selected from SEQ ID NO: 6-11 and 310-321.

[0345] Item 2: The dsRNA according to Item 1, wherein the dsRNA comprises:

[0346] (1) CCAUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO:176) in the sense chain and AGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO:177) in the antisense chain,

[0347] (2) CCAUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO:180) in the sense chain and AAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO:181) in the antisense chain,

[0348] (3) CCAAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO:182) in the sense chain and AAAAAGUCACCAUAUUAAUdTdT (SEQ ID NO:183) in the antisense chain,

[0349] (4) CCAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO:184) in the sense chain and UAAAAAGUCACCAUAUUAAdTdT (SEQ ID NO:185) in the antisense chain,

[0350] (5) CCAUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO:186) in the sense chain and UUAAAAAGUCACCAUAUUAdTdT (SEQ ID NO:187) in the antisense chain,

[0351] (6) CCAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO:188) in the sense chain and AUUUUAAAAAGUCACCAUAdTdT (SEQ ID NO:189) in the antisense chain,

[0352] (7) CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO:322) in the sense chain and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO:323) in the antisense chain,

[0353] (8) CCAAUAUGGUGACUUUUUAAAAinvdT (SEQ ID NO:324) in the sense chain and UUUUAAAAAGUCACCAUAUdtdt (SEQ ID NO:325) in the antisense chain,

[0354] (9) CCAAUUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO:326) in the sense chain and AGUCACCAUAUUAAUAAAAAUdTdT (SEQ ID NO:327) in the antisense chain,

[0355] (10) CCAUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO:328) in the sense chain and AAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO:329) in the antisense chain,

[0356] (11) CCAUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO:330) in the sense chain and AAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO:331) in the antisense chain,

[0357] (12) CCAUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO:332) in the sense chain and UAAAAAGUCACCAUAUUAAUAdTdT (SEQ ID NO:333) in the antisense chain,

[0358] (13) CCAAAUAUGGUGACUUUUUAAAAUinvdT (SEQ ID NO:334) in the sense chain and AUUUUAAAAAGUCACCAUAUUdTdT (SEQ ID NO:335) in the antisense chain,

[0359] (14) CCAGCAUUUUUAUUAAUAUGGUGACUinvdT (SEQ ID NO:336) in the sense chain and AGUCACCAUAUUAAUAAAAAUGCdTdT (SEQ ID NO:337) in the antisense chain,

[0360] (15) CCAAUUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO:338) in the sense chain and AAAGUCACCAUAUUAAUAAAAAUdTdT (SEQ ID NO:339) in the antisense chain,

[0361] (16) CCAUUUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO:340) in the sense chain and AAAAGUCACCAUAUUAAUAAAAAdTdT (SEQ ID NO:341) in the antisense chain,

[0362] (17) CCAUUUAUUAAUAUGGUGACUUUUUAinvdT (SEQ ID NO:342) in the sense chain and UAAAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO:343) in the antisense chain, or

[0363] (18) CCAUUAUUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO:344) in the sense chain and UUAAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO:345) in the antisense chain.

[0364] Item 3: A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein only the first sequence is complementary to the second sequence, and wherein the first sequence is one of SEQ ID NO: 3, 4 and 13.

[0365] Item 4: The dsRNA according to Item 3, wherein the dsRNA comprises:

[0366] (19) CCAUUGUAGCAUUUUUAUUAAUinvdT (SEQ ID NO:162) in the sense chain and AUUAAUAAAAAUGCUACAAdTdT (SEQ ID NO:163) in the antisense chain,

[0367] (20) CCAGUAGCAUUUUUAUUAAUAUinvdT (SEQ ID NO:166) in the sense chain and AUAUUAAUAAAAAUGCUACdTdT (SEQ ID NO:167) in the antisense chain, or

[0368] (21) CCAGAGUGUGAAAGGUGCUGAUinvdT in the sense chain (SEQ ID NO:290) and AUCAGGCACCUUUCACACUCdTdT in the antisense chain (SEQ ID NO:291).

[0369] Item 5: dsRNA according to any one of items 1-4, wherein the length of each of the first sequence and the second sequence is less than or equal to 30 nucleotides.

[0370] Item 6: dsRNA according to any one of items 1-5, wherein the length of each of the first sequence and the second sequence is at least 19 and less than or equal to 23 nucleotides.

[0371] Item 7: dsRNA according to any one of items 1-6, wherein the dsRNA is small interfering RNA (siRNA) or short hairpin RNA (shRNA).

[0372] Item 8: dsRNA according to any one of items 1-7, wherein the dsRNA comprises one or more modified nucleotides.

[0373] Item 9: The dsRNA according to Item 8, wherein at least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-phosphothioester nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a lipophilic moiety.

[0374] Item 10: The dsRNA according to Item 8, wherein at least one of the one or more modified nucleotides is 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, restricted ethyl (cEt), reverse deoxy, reverse dideoxy, locked nucleic acid, debased, 2'-amino, 2'-alkyl, morpholino, aminophosphate or a nucleotide containing a non-natural base.

[0375] Item 11: The dsRNA according to Item 10, wherein the dsRNA comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoronucleotides.

[0376] Item 12: The dsRNA according to Item 11, wherein the dsRNA comprises two or more 2'-O-methyl nucleotides in the pattern OMe-F-OMe-F or F-OMe-F-OMe and two or more 2'-

[0377] Fluorinated nucleotides,

[0378] Where OMe represents 2'-O-methyl nucleotide, and F represents 2'-fluoronucleotide.

[0379] Item 13: The dsRNA according to Item 11, wherein the dsRNA comprises up to 10 consecutive nucleotides, each being a 2'-O-methyl nucleotide or up to 10 consecutive nucleotides, each being a 2'-fluoro nucleotide.

[0380] Item 14: dsRNA according to any one of items 1-13, wherein the dsRNA comprises one or more phosphate thioester groups.

[0381] Item 15: dsRNA according to any one of items 1-13, wherein the dsRNA does not contain a phosphate thioester group.

[0382] Item 16: dsRNA according to any one of items 1-15, wherein the dsRNA comprises one or more phosphotriester groups.

[0383] Item 17: dsRNA according to any one of items 1-15, wherein the dsRNA does not contain a phosphotriester group.

[0384] Item 18: dsRNA according to any one of items 1-17, wherein the dsRNA is attached to one or more GalNAc derivatives via a adapter.

[0385] Item 19: The dsRNA according to Item 18, wherein the dsRNA is attached to three GalNAc derivatives via a trivalent branched adapter.

[0386] Item 20: The dsRNA according to Item 18 or Item 19, wherein at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

[0387] Item 21: The dsRNA according to any one of items 1, 3 and 5-20, wherein one or both of the sense strand and the antisense strand further include a 5' overhang containing one or more nucleotides.

[0388] Item 22: The dsRNA according to any one of items 1, 3 and 5-21, wherein one or both of the sense strand and the antisense strand further include a 3' overhang containing one or more nucleotides.

[0389] Item 23: The dsRNA according to Item 22, wherein the 3' overhang contains two nucleotides.

[0390] Item 24: dsRNA according to any one of items 21-23, wherein the overhang contains one or more thymines.

[0391] Item 25: dsRNA according to any one of items 1-24, wherein the dsRNA inhibits the expression of the gene for the proteoproteotransferase Kexin 9 (PCSK9).

[0392] Item 26: The dsRNA according to Item 1, wherein one or both strands of the dsRNA comprise one or more compounds having the structure of formula (I):

[0393]

[0394] in:

[0395] -B is a heterocyclic nucleobase;

[0396] One of L1 and L2 is a compound of formula (I) linked to a nucleoside linker group of a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or a compound of formula (I) linked to a nucleoside linker group of a polynucleotide.

[0397] -Y is O, NH, NR1, or NC (=O)-R1, where R1 is:

[0398] (C1-C20)alkyl, optionally surrounded by one or more atoms selected from halogen atoms, (C1-C6)alkyl, (C3-C8)cycloalkyl,

[0399] (C3-C14)heterocyclic, (C6-C14)aryl, (C5-C14)heteroaryl, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN,

[0400] Substitution of groups in -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2) and -N(Z1)-C(=J)-Z2, where J is O or S.

[0401] Z1 and Z2 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl group is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl groups.

[0402] (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6)alkyl groups, the group being -[C(=O)]m-R2-(O-CH2-CH2)p-R3, wherein

[0403] m represents an integer that is either 0 or 1.

[0404] p is an integer in the range of 0 to 10.

[0405] R2 is a (C1-C20) alkylene group, optionally prefixed with a (C1-C6) alkyl group, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN,

[0406] -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4) or -N(Z3)-C(=K)-Z4 are used as substitutes, where

[0407] K is either O or S.

[0408] Z3 and Z4 are each independently H, (C1-C6)alkyl, wherein the (C1-C6)alkyl is optionally substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl, and

[0409] R3 is selected from hydrogen atom, (C1-C6)alkyl, (C1-C6)alkoxy, (C3-C8)cycloalkyl, (C3-C14) heterocyclic,

[0410] (C6-C14)aryl or (C5-C14)heteroaryl, or R3 is the cell-targeting moiety.

[0411] -X1 and X2 are each independently a hydrogen atom and a (C1-C6) alkyl group, and

[0412] -Ra, Rb, Rc, and Rd are each independently H or (C1-C6) alkyl groups.

[0413] Or it could be a pharmaceutically acceptable salt.

[0414] Item 27: The dsRNA according to Item 26 comprises one or more compounds of formula (I), wherein Y is:

[0415] a) NR1, R1 is an unsubstituted (C1-C20) alkyl group;

[0416] b) NR1, R1 is an unsubstituted (C1-C16) alkyl group, which includes alkyl groups selected from methyl, isopropyl, butyl, octyl and hexadecyl;

[0417] c) NR1, where R1 is a (C3-C8) cycloalkyl group, which is optionally substituted by one or more groups selected from halogen atoms and (C1-C6) alkyl groups;

[0418] d) NR1, R1 is cyclohexyl;

[0419] e)NR1, where R1 is a (C1-C20) alkyl group substituted with (C6-C14) aryl groups;

[0420] f) NR1, R1 is a methyl group substituted with a phenyl group;

[0421] g)NC(=O)-R1, where R1 is an optionally substituted (C1-C20) alkyl group; or

[0422] h)NC(=O)-R1, where R1 is methyl or pentadecyl.

[0423] Item 28: The dsRNA according to Item 26 or 27 comprises one or more compounds of formula (I), wherein B is selected from pyrimidine, substituted pyrimidine, purine and substituted purine, or a pharmaceutically acceptable salt thereof.

[0424] Item 29: dsRNA according to any one of items 26 to 28, wherein R3 has formula (II)

[0425]

[0426] Where A1, A2, and A3 are OH,

[0427] A4 is OH or NHC(=O)-R5, wherein R5 is an (C1-C6) alkyl group optionally substituted with a halogen atom, or a pharmaceutically acceptable salt thereof.

[0428] Item 30: dsRNA according to any one of items 26 to 29, wherein R3 is N-acetylgalactosamine, or a pharmaceutically acceptable salt thereof.

[0429] Item 31: The dsRNA according to any one of items 26 to 30, comprising one or more nucleotides from Table A.

[0430] Item 32: dsRNA according to any one of items 26 to 31, comprising 2 to 10 compounds of formula (I) or pharmaceutically acceptable salts thereof.

[0431] Item 33: The dsRNA according to Item 32, wherein the 2 to 10 compounds of formula (I) are on the sense strand.

[0432] Item 34: The dsRNA according to items 26 to 33, wherein the sense strand comprises two to five compounds of formula (I) at the 5' end and / or one to three compounds of formula (I) at the 3' end.

[0433] Item 35: dsRNA according to any one of items 26 to 34, wherein

[0434] a) Two to five compounds of formula (I) at the 5' end of the sense strand contain 1gT3, optionally containing three consecutive 1gT3 nucleotides; and / or

[0435] b) One to three compounds of formula (I) at the 3' end of the sense chain contain lT4; optionally, two consecutive lT4.

[0436] Item 36: The dsRNA according to any one of items 26 to 35 comprises one or more internucleotide linking groups, said internucleotide linking groups being independently selected from phosphodiester, phosphotriester, thiophosphate, dithiophosphate, alkyl-phosphonate and aminophosphate backbone linking groups, or pharmaceutically acceptable salts thereof.

[0437] Item 37: The dsRNA according to any one of items 26 to 36, which is selected from the dsRNAs in Table 2-4.

[0438] Item 38: dsRNA according to any one of items 26 to 37, wherein:

[0439] a) The sense strand comprises a nucleotide sequence selected from SEQ ID NO: 578, 585, 587, 620, 621, 622 and 627; and / or

[0440] b) The antisense strand comprises a nucleotide sequence selected from SEQ ID NO:589, 591, 631, 632, 634, 635 and 639.

[0441] Item 39: The dsRNA according to Item 38, wherein the sense strand and antisense strand of said dsRNA each comprise the following nucleotide sequences:

[0442] a) SEQ ID NO: 578 and 589; [C027.001]

[0443] b) SEQ ID NO: 620 and 631; [C027.003]

[0444] c) SEQ ID NO: 585 and 591; [C027.001#40]

[0445] d) SEQ ID NO: 587 and 591; [C027.001#58]

[0446] e) SEQ ID NO: 621 and 634; [C027.003#03]

[0447] f) SEQ ID NO: 622 and 632; [C027.003#06]

[0448] g) SEQ ID NO: 622 and 635; and [C027.003#08]

[0449] h)SEQ ID NO: 627 and 639. [C027.003#47]

[0450] Item 40: A vector encoding dsRNA according to any one of items 1-39.

[0451] Item 41: An isolated host cell comprising dsRNA according to any one of items 1-39 or the vector according to item 40.

[0452] Item 42: A kit comprising dsRNA according to any one of items 1-39.

[0453] Item 43: A composition comprising dsRNA according to any one of items 1-39.

[0454] Item 44: The composition according to item 43 further comprises a pharmaceutically acceptable carrier.

[0455] Item 45: The composition according to item 43 or 44 further comprises a delivery medium.

[0456] Item 46: The composition according to Item 31, wherein the delivery medium is selected from liposomes, liposome complexes, complexes and nanoparticles.

[0457] Item 47: A method for inhibiting PCSK9 gene expression in a subject, the method comprising administering to the subject an effective amount of dsRNA according to any one of items 1-39 or the composition according to item 44.

[0458] Item 48: A method for treating or preventing PCSK9-mediated disease in a subject of need, the method comprising administering to the subject an effective amount of dsRNA according to any one of items 1-39 or a composition according to item 44.

[0459] Item 49: The method according to Item 48, wherein the PCSK9-mediated disorder is hypercholesterolemia.

[0460] Item 50: The method according to any one of items 48-49, wherein the expression of the PCSK9 gene in the liver of the subject is inhibited by the dsRNA.

[0461] Item 51: The method according to any one of items 48-50, wherein the administration is subcutaneous, intravenous, or pulmonary.

[0462] Item 52: The method according to any one of items 48-51, wherein the subject is a human being.

[0463] Item 53: The method according to any one of items 48-52, wherein the administration results in a reduction of serum cholesterol in the subject.

[0464] Item 54: The method according to any one of items 48-53, the method further comprising administering to the subject an effective amount of one or more additional therapeutic agents for treating or preventing PCSK9-mediated diseases.

[0465] Although the foregoing disclosure has been described in detail by way of illustration and examples for purposes of clarity, such description and examples should not be construed as limiting the scope of this disclosure.

[0466] Example

[0467] This disclosure will be more fully understood by referring to the following embodiments. However, they should not be construed as limiting the scope of this disclosure. It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or changes made to them should be known to those skilled in the art and should be included within the spirit and scope of this application and the appended claims.

[0468] Example 1: Identification of siRNA for inhibiting human PCSK9 expression

[0469] method

[0470] siRNA production

[0471] siRNAs were produced using solid-phase oligonucleotide synthesis, including negative control siRNAs (“LV2 Negative Control” and “LV2 Negative Control 2”). Positive control siRNA s48694 was purchased from Ambion. The sequence of each siRNA (including nucleotide modifications) is shown in Table 2 above.

[0472] Cell and tissue cultures

[0473] Human Hep3B cells and human C3A cells were cultured as follows. Human Hep3B cells were grown at 37°C, 5% CO2, and 95% RH in EMEM medium (ATCC, catalog number 30-2003) supplemented with 10% FBS. Human C3A cells were grown at 37°C, 5% CO2, and 95% RH in MEM medium (ThermoFisher, catalog number 41090) supplemented with 10% FBS.

[0474] transfection

[0475] For the knockdown experiment, use 20,000 Hep3B or C3A cells per well in a 96-well plate. Use 0.2 μl / well in the reverse transfection device according to the manufacturer's protocol. Cells were transfected with the RNAiMAX transfection reagent (ThermoFisher) at the indicated concentration of siRNA and incubated for 48 h without changing the culture medium. Typically, N=4 technical replicates were performed for each test sample. To test siRNA-related toxicity, 15,000 Hep3B or C3A cells were transfected as described above and incubated for 72 h.

[0476] mRNA expression analysis

[0477] 48 hours after siRNA transfection, cellular RNA was harvested using Promega’s SV96 Total RNA Isolation System (catalog number Z3500), following the manufacturer’s protocol, including the DNase step in the procedure.

[0478] For cDNA synthesis, a reverse transcriptase kit from ThermoFisher (catalog number N8080234) was used. cDNA was synthesized from 30 ng RNA in a total volume of 12 μl using 1.2 μl 10xRT buffer, 2.64 μl MgCl2 (25 mM), 2.4 μl dNTP (10 mM), 0.6 μl random hexamer (50 μM), 0.6 μl Oligo(dT)16 (50 μM), 0.24 μl RNase inhibitor (20 U / μl), and 0.3 μl Multiscribe (50 U / μl). The sample was incubated at 25 °C for 10 min and then at 42 °C for 60 min. The reaction was stopped by heating to 95 °C and holding for 5 min.

[0479] The TaqMan Universal PCR Master Mixture (catalog number 4305719) from Thermo Fisher was used via qPCR. Gene expression assays were performed using Hs00545399_m1 to quantify PCSK9 mRNA levels. PCR was repeated using an ABI Piperism 7900 under the following conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. PCR was set up as a simplex PCR, detecting the target gene (PCSK9) in one reaction and the housekeeping gene (RPL37A) for normalization in a second reaction. The final volume used for PCR reactions in the 1x PCR master mix was 12.5 μl, using 50 nM RPL37A primers and 200 nM probe. The relative expression level of the target transcript was calculated using the ΔΔCt method. The percentage of PCSK9 expression was calculated by normalization based on the level of the LV2 non-silenced siRNA control sequence.

[0480] IC 50 Measurement

[0481] Hep3B or C3A cells were transfected with the indicated siRNA at concentrations ranging from 10 nM to 0.01 pM using a 10-fold dilution procedure. The half-maximum inhibitory concentration (IC50) for each siRNA was calculated using the Biostat-Speed ​​statistical tool. 50 The results were obtained using a 4-parameter logistic model, based on the work of Ratkovsky and Reedy (1986). Adjustments were obtained through nonlinear regression using the Levenberg-Marquardt algorithm in SAS v9.1.3 software.

[0482] ELISA assay

[0483] The concentration of PCSK9 protein in the supernatant of 25,000 C3A cell cultures was quantified 48 hours after transfection with the indicated concentration of siRNA using the R&D Systems Human PCSK9 Quantikine ELISA Kit (catalog number DPC900). ELISA assays were performed using 50 μl of undiluted cell culture supernatant, according to the manufacturer's protocol. The percentage of PCSK9 expression was calculated by normalization based on the average of the non-silenced siRNA control sequence.

[0484] Cytotoxicity

[0485] 72 hours after transfection of cultures of 15,000 Hep3B or C3A cells, the cytotoxicity of each siRNA was measured by determining the cell viability / cytotoxicity ratio in each sample. This was done according to the manufacturer's protocol using... (Promega, catalog number G7570) This assay determines intracellular ATP levels to measure cell viability. ToxiLight was used according to the manufacturer's protocol. TM Assay (Lonza, catalog number LT07-217) measures cytotoxicity in the supernatant.

[0486] result

[0487] To identify siRNAs that can be used to target human PCSK9, the following criteria were applied. First, a computer identified 19-mers from the human PCSK9 mRNA sequence shown in NM_174936.3 (SEQ ID NO:1), using 18-nucleotide overlaps. After the first round of filtering, 715 potential target siRNAs were identified. Next, all 19-mers overlapping with known SNPs (identified as occurring in greater than 10% of Caucasian populations) were excluded, leaving a pool of 692 19-mer sequences. All 692 19-mers were then aligned with the PCSK9 mRNA sequence of cynomolgus monkeys (Macaca fascicularis), and all sequences with more than one mismatch with cynomolgus monkey PCSK9 were excluded, leaving 130 siRNA sequences with 0 mismatches and another 267 siRNA sequences with 1 mismatch.

[0488] Computer analysis was then performed to identify any potential off-target transcripts in the human transcriptome (RefSeq RNA version 2015-10-20). Human off-target sequences with FPKM < 0.5 expressed in liver tissue using RNAseq (Illumina Body Atlas) were not considered. All target siRNA sequences had more than two mismatches with any human transcript other than PCSK9, or two mismatches with four or fewer human genes; sequences that did not meet either of these criteria were filtered out. After filtering, 229 potential siRNAs remained. A final filtering step was performed to identify siRNA sequences with a GC content of less than 30%, and 14 siRNAs were identified for functional characterization. All 14 such siRNAs recognized target sequences in the 3' untranslated region (UTR) of human PCSK9.

[0489] As described above, these 14 siRNAs were generated using nucleotides with 2'O-methyl and 2'-fluorinated groups but without additional modifications (such as GalNAc ligands or thiophosphates). To test the ability of these 14 siRNAs to reduce PCSK9 expression, human Hep3B cells were transfected with 0.1 nM or 1.0 nM of each siRNA and incubated for 48 hours. After incubation, the mRNA expression of PCSK9 in each sample was measured and compared with positive and negative controls. Figure 1 Nine of these 14 siRNAs showed the most effective hPCSK9 inhibition, reducing PCSK9 mRNA expression by at least 80% at a concentration of 1.0 nM and by at least 50% at a concentration of 0.1 nM.

[0490] The activity of these 14 target siRNAs was further tested in human C3A cells, characterized by higher PCSK9 expression levels compared to Hep3B cells. Figure 2 The siRNAs were tested at the following concentrations: 0.5 nM, 0.05 nM, and 0.005 nM. In this more stringent assay, five of the 14 siRNAs showed the most potent inhibition of hPCSK9 expression (B001, B003, B006, B013, and B014). These siRNAs reduced PCSK9 mRNA expression by at least 80% at a concentration of 0.5 nM and by at least 50% at a concentration of 0.05 nM.

[0491] Next, cytotoxicity in Hep3B and C3A cells was measured 72 hours after transfection with these 14 target siRNAs. Surprisingly, no significant cytotoxicity was observed in Hep3B or C3A cells for any of the siRNAs tested, even at concentrations up to 50 nM. Figure 3A and Figure 3B ).

[0492] In summary, these results confirm the identification of siRNAs that can effectively inhibit PCSK9 expression in a variety of human cell lines without significant cytotoxicity.

[0493] Example 2: Characterization of additional siRNAs for inhibiting human PCSK9 expression

[0494] Additional siRNA sequences were selected as described above, except that sequences with a G+C content of 30%–65% were filtered. Sixty siRNAs were generated as described in Example 1. These siRNAs recognize targets distributed throughout the 5'UTR, 3'UTR, and open reading frame (ORF) of human PCSK9.

[0495] To test the ability of these 60 siRNAs to reduce PCSK9 expression, human Hep3B cells were transfected with 0.1 nM or 1.0 nM of each siRNA and incubated for 48 hours. After incubation, the mRNA expression of PCSK9 in each sample was measured and compared with positive and negative controls. Figure 4 Five of these 60 siRNAs showed effective inhibition of hPCSK9 expression, reducing PCSK9 mRNA expression by at least 86% at a concentration of 1.0 nM.

[0496] The activity of five of the 60 most potent siRNAs was further tested in human C3A cells. Figure 5The siRNAs were tested at the following concentrations: 0.5 nM, 0.05 nM, and 0.005 nM. Three of the tested siRNAs showed effective inhibition of hPCSK9 expression, reducing PCSK9 mRNA expression by at least 75% at a concentration of 0.5 nM.

[0497] Next, 72 hours after siRNA transfection, cytotoxicity in Hep3B and C3A cells was measured. Figure 6A and Figure 6B One siRNA (C060) induced significant cytotoxicity in both cell lines, while another siRNA (C052) induced significant cytotoxicity in C3A cells. Based on the above activity and cytotoxicity data in C3A and Hep3B cells, 10 siRNAs were selected for IC50 treatment. 50 Measurements were taken of (B001, B003, B006, B008, B010, B013, B014, and C051). These ten siRNAs all exhibited similar potency. Further analysis by ELISA assays, particularly at the higher concentrations tested, revealed that these ten siRNAs reduced hPCSK9 protein in C3A cells. Figure 7 ).

[0498] The results of these experiments are summarized in Table A. The portion of each siRNA containing its hPCSK9 target sequence is shown in Table B.

[0499] Table A: Functional activity of siRNA.

[0500]

[0501]

[0502] Table B: siRNA sequence information.

[0503]

[0504] Compared to the 14 siRNAs described in Example 1, these 60 siRNAs exhibited a significantly lower proportion of siRNAs that effectively knocked down hPCSK9 expression (5 / 60 were effective in Hep3B cells compared to 9 / 14 from Example 1). It is not intended to be theoretically sound, but it is believed that the siRNAs from Example 1 could exhibit higher efficacy, attributed to their lower G+C content and / or targeting specific regions of PCSK9 (e.g., the 3'UTR). In summary, these results further illustrate the unpredictability of effective siRNA knockdown of human PCSK9 expression. Furthermore, the results obtained using these 60 siRNA sequences further underscore the efficacy and low levels of cytotoxicity of the siRNAs described in Example 1.

[0505] Example 3: In vitro and in vivo evaluation of PCSK9 siRNA molecules

[0506] method

[0507] siRNA production

[0508] siRNA (including negative control siRNA) is produced using solid-phase oligonucleotide synthesis.

[0509] Cell and tissue cultures

[0510] Human C3A cells were grown at 37°C, 5% CO2 and 95% RH and cultured in MEM medium (ThermoFisher, catalog number 41090) supplemented with 10% FBS.

[0511] Human peripheral blood mononuclear cells (PBMCs) were isolated from approximately 16 mL of blood from three healthy donors and collected in a vacuum blood collection tube (BD, Heidelberg, Germany) coated with sodium heparin, according to the manufacturer’s instructions.

[0512] Human primary hepatocytes and cynomolgus monkey primary hepatocytes were cultured as follows: Frozen cells were thawed and plated using a plating and thawing kit (PTK-1, Primacyt), and incubated at 37°C, 5% CO2, and 95% RH. Six hours after plating, the culture medium was replaced with maintenance medium (KLC-MM, KaLy-Cell) supplemented with 1% FBS.

[0513] transfection

[0514] For the knockdown experiment in C3A cells, 25,000 cells / well were used in 96-well plates. Following the manufacturer's protocol, 0.2 μl / well was used in the reverse transfection apparatus. The RNAiMAX transfection reagent (ThermoFisher) is used to transfect cells with the indicated concentration of siRNA, and the cells are incubated for 48 hours without changing the culture medium. Typically, N=4 technical replicates are performed for each test sample.

[0515] For transfection of human PBMCs, 100 nM siRNA was reverse-transfected into 150 μL of serum-free RPMI medium with 0.3 μL of Lipofectamine 2000 per 96-well (n=2) at a concentration of 1 x 10⁻⁶ mcg. 5In PBMC, the duration was 24 hours. Single-stranded RNA (“R-0006”) and DNA (“CpG ODN”) oligonucleotides, as well as double-stranded unmodified siRNA and 2'-O-methyl modified siRNA (“132 / 161”) were used as controls.

[0516] mRNA expression analysis

[0517] Cellular RNA was harvested 48 hours after siRNA transfection or 72 hours after free siRNA uptake, according to the manufacturer’s protocol, including the DNase step in the procedure, using Promega’s SV96 total RNA isolation system (catalog number Z3500).

[0518] For cDNA synthesis, a reverse transcriptase kit from ThermoFisher (catalog number N8080234) was used. cDNA was synthesized from 30 ng RNA in a total volume of 12 μl using 1.2 μl 10xRT buffer, 2.64 μl MgCl2 (25 mM), 2.4 μl dNTP (10 mM), 0.6 μl random hexamer (50 μM), 0.6 μl Oligo(dT)16 (50 μM), 0.24 μl RNase inhibitor (20 U / μl), and 0.3 μl Multiscribe (50 U / μl). The sample was incubated at 25 °C for 10 min and then at 42 °C for 60 min. The reaction was stopped by heating to 95 °C and holding for 5 min.

[0519] ThermoFisher TaqMan Universal PCR Master Mixture (catalog number 4305719) was used for qPCR and Gene expression assays were performed using Hs00545399_m1 and Mf03418189_m1 (human and cynomolgus monkey samples, respectively) to quantify PCSK9 mRNA levels. PCR was performed repeatedly using an ABI Prism 7900 under the following conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. PCR was set up as a simplex PCR, detecting the target gene (PCSK9) in one reaction and the housekeeping gene (RPL37A) for normalization in a second reaction. The final volume of the 1x PCR master mix used for PCR was 12.5 μl, using 50 nM RPL37A primers and 200 nM probe. The relative expression levels of the target transcripts were calculated using the ΔΔCt method. The percentage of PCSK9 expression was calculated by normalization based on the levels of the LV2 non-silenced siRNA control sequence.

[0520] IC 50Measurement

[0521] C3A cells were transfected with the indicated siRNA at concentrations ranging from 25 nM to 0.1 pM using an 8-fold dilution procedure. The half-maximum inhibitory concentration (IC50) for each siRNA was calculated using the Biostat-Speed ​​statistical tool. 50 The results were obtained using a 4-parameter logistic model, based on the work of Ratkovsky and Reedy (1986). Adjustments were obtained through nonlinear regression using the Levenberg-Marquardt algorithm in SAS v9.1.3 software.

[0522] IC50 in human primary hepatocytes and cynomolgus monkey primary hepatocytes 50 Measurements were performed using a 5-fold dilution procedure, with 70,000 cells in 96-well plates incubated for 72 hours under free-up conditions with siRNA at concentrations ranging from 10 μM to 0.005 nM.

[0523] ELISA assay

[0524] The concentration of PCSK9 protein in the supernatant of C3A cells was quantified 48 hours after transfection with the indicated concentration of siRNA using the R&D Systems Human PCSK9 Quantikine ELISA Kit (catalog number DPC900). ELISA assays were performed using 50 μl of undiluted cell culture supernatant, according to the manufacturer's protocol. The percentage of PCSK9 expression was calculated by normalization based on the average of the non-silenced siRNA control sequence.

[0525] The concentration of IFNα protein in PBMC supernatant was quantified as follows: A self-built electrochemiluminescence assay based on MesoScale Discovery technology was used, and a pan-IFNα monoclonal capture antibody (MT1 / 3 / 5, Mabtech) was used to measure the IFNα concentration in 25 μL of cell culture supernatant.

[0526] Cytotoxicity

[0527] After incubation for 72 hours with 50,000 human primary hepatocytes under free-intake conditions, the cytotoxicity of each siRNA was measured by determining the cell viability / cytotoxicity ratio in each sample. This was done according to the manufacturer's protocol using... (Promega, catalog number G7570) This assay determines intracellular ATP levels to measure cell viability. ToxiLight was used according to the manufacturer's protocol. TM Assay (Lonza, catalog number LT07-217) measures cytotoxicity in the supernatant.

[0528] Nuclease stability

[0529] The nuclease stability of siRNA in 50% mouse serum was tested. For this purpose, 160 μL of mouse serum (Sigma, catalog number M5905) was incubated at 37 °C for 0, 8, 24, 32, 48, 56, and 72 hours. At each time point, 21 μL of the reaction mixture was removed and quenched at 65 °C for 30 minutes with 23 μL of stop solution (for 3,000 μL stop solution: 1123 μL of tissue & cell lysate solution (Epicentre, catalog number MTC096H), 183 μL of 20 mg / mL proteinase K (Sigma, catalog number P2308), and 1694 μL of water). 33 μL of RNase-free water was added to each sample before HPLC analysis on a Waters 2695 separation module and a 2487 dual absorbance detector. 50 μL of solution was analyzed by HPLC using a DNApac PA200 analytical column (Thermo Scientific, catalog number 063000) and the following gradient:

[0530] Time (min) Flow rate (mL / min) Buffer A%* Buffer B%** 0 1 75 25 20 1 35 65

[0531] *Buffer A: 20mM sodium phosphate (Sigma, catalog number 342483), pH 11;

[0532] **Buffer B: 20mM sodium phosphate (Sigma, catalog number 342483), 1M sodium bromide (Sigma, catalog number 02119), pH 11.

[0533] mouse model

[0534] The female mice used in the following experiments carried the transgene encoding full-length human PCSK9, with the corresponding mouse PCSK9 knocked out. The transgene model (strain "hTg-mKO #2") was licensed from IRCM (Institut de Recherches Cliniques do Montréal) through Univalor Inc.

[0535] In vivo measurement

[0536] Serum PCSK9 levels in mice treated with siRNA were determined using the same R&D Systems Human PCSK9 Quantikine ELISA Kit (catalog number DPC900) at a pre-dilution of 1:40. Relative serum PCSK9 levels were calculated for pre-drug values.

[0537] Serum total cholesterol and LDL cholesterol levels in transgenic mice treated with PCSK9 siRNA were determined using the COBAS INTEGRA instrument and Roche's LDLC3 assay or Horiba's ABX Pentra LDL direct CP assay.

[0538] Serum AST, ALT, and BUN levels were measured using the COBAS INTEGRA instrument, a standard clinical chemistry assay.

[0539] result

[0540] Ten PCSK9 siRNA sequences were concatenated and characterized in vitro, as shown in Tables A and B. The siRNAs were subjected to IC50 assays using human C3A cells. 50 Measurements (Table C). IC50 in human C3A cells transfected with the indicated siRNA. 50 The value is in the range of 9.7pM-125.0pM.

[0541] Table C: IC50 of 10 siRNAs in human C3A cells 50 active

[0542] siRNA: <![CDATA[IC 50 (pM):]]> <![CDATA[I max %:]]> C032.001 114.0 79.6 C032.004 76.3 86.1 C032.005 23.7 88.4 C032.006 70.9 87.4 C032.007 - 84.6 C032.008 88.1 83.2 C032.009 125.0 86.3 C032.010 9.7 86.7 C032.011 15.4 89.6 C032.012 12.7 90.3

[0543] PCSK9 protein knockdown was confirmed by quantifying the PCSK9 level in the supernatant of C3A cells transfected with three different concentrations (25 nM, 0.39 nM, and 0.0061 nM). Figure 8 ).

[0544] The IC50 of each siRNA was also measured using free uptake in primary cells. 50 Primary hepatocytes of cynomolgus monkeys were treated with siRNA, and the IC50 of each siRNA was calculated. 50 (Table D). IC 50 The values ​​ranged from 94.2 nM to 486.0 nM. siRNA sequences C032.004 and C032.005 (with no mismatch with PCSK9 in cynomolgus monkeys) showed good dose-dependent knockdown activity, while sequence C032.012 (with one mismatch with a rhesus monkey species) showed a lower degree of dose-dependent knockdown activity.

[0545] Table D: IC50 of 10 siRNAs in primary hepatocytes of cynomolgus monkeys under free-intake conditions 50 active

[0546] siRNA: <![CDATA[IC 50 (nM):]]> <![CDATA[I max %:]]> Note: C032.001 na na 1MM cyno C032.004 94.2 55.8 0MM cyno C032.005 117.0 66.7 0MM cyno C032.006 na na 1MM cyno C032.007 na na 1MM cyno C032.008 na na 1MM cyno C032.009 na na 1MM cyno C032.010 na na 1MM cyno C032.011 na na 1MM cyno C032.012 486.0 30.9 1MM cyno

[0547] na = inactive

[0548] MM = Mismatch

[0549] Human primary hepatocytes were also treated with siRNA, and the IC50 of each siRNA in this human primary cell type was calculated. 50 (Table E). IC 50 The values ​​ranged from 9.4 nM to 189.0 nM. Under free uptake conditions, the cytotoxicity of siRNA in this human primary cell type was also examined. Figure 9 No dose-dependent cytotoxic effects were observed for any of the siRNAs tested.

[0550] Table E: IC50 of 10 siRNAs in human primary hepatocytes under free uptake conditions 50 active

[0551] siRNA: <![CDATA[IC 50 (nM):]]> <![CDATA[I max %:]]> C032.001 36.3 70.9 C032.004 14.6 56.7 C032.005 16.7 64.4 C032.006 17.2 61.4 C032.007 27.7 72.6 C032.008 9.4 54.1 C032.009 189.0 35.4 C032.010 34.7 50.6 C032.011 17.6 61.6 C032.012 11.7 72.3

[0552] By examining the production of interferon-α in response to siRNA transfection in human primary PMBC isolated from three different healthy donors ( Figure 10 The immune response of siRNA in human primary cells was measured. No signs of immune stimulation were observed in human PBMCs for any of the siRNAs tested.

[0553] The in vitro nuclease stability of 10 PCSK9 siRNAs in 50% mouse serum was also tested, and the relative stability and half-life were determined. Figure 11 Although all siRNAs were stable for at least 24 hours, compound C032.005 was identified as the most stable, showing little or no degradation at the latest measurement time point (72 hours).

[0554] A summary of the results from the in vitro analysis is shown in Figure 12 Next, compared with the non-silencing control siRNA, the effects of a single subcutaneous injection of 10 mg / kg of 10 conjugated siRNAs on serum PCSK9 protein levels were examined. Figure 13A ) and serum total cholesterol levels ( Figure 13BThe in vivo effects were investigated. Mice used in the in vivo efficacy studies carried a transgene encoding full-length human PCSK9, with the corresponding mouse PCSK9 knocked out. siRNAs C032.005, C032.007, and C032.012 exhibited nearly identical patterns in PCSK9 reduction, with maximum PCSK9 knockdown of approximately 49%–52% between days 3 and 7, returning to baseline between days 17 and 21. siRNA C032.006 showed the greatest activity against PCSK9 levels, with a maximum knockdown of 65% on day 10, returning to baseline levels on day 52. ​​The highest reductions in total cholesterol levels were obtained using siRNAs C032.005 and C032.012, with maximum reductions of 19% and 22%, respectively. Interestingly, no significant effect on cholesterol levels was observed with siRNA C032.006, despite its greatest effect on PCSK9 levels.

[0555] Day 3 of the same in vivo study in human PCSK9 transgenic mice ( Figure 13C ) and the 10th day ( Figure 13D Acute toxicological parameters in serum samples were measured. No significant hepatotoxicity (as determined by AST and ALT levels) or nephrotoxicity (as determined by BUN levels) was detected with any of the compounds tested. In summary, the favorable in vitro profile of PCSK9 siRNA C032.012 translated into in vivo profiles in relevant transgenic mouse models. Furthermore, siRNA C032.005 exhibited favorable in vivo profiles for PCSK9 and total cholesterol inhibition. Two additional siRNAs (C032.006 and C032.007) were identified in vivo as having potent PCSK9 inhibition; however, interestingly, neither siRNA had a significant effect on reducing cholesterol levels.

[0556] Example 4: Further in vitro evaluation of PCSK9 siRNA molecules

[0557] method

[0558] Unless otherwise instructed, all experiments were conducted as described in the above embodiments.

[0559] result

[0560] Another set of siRNAs targeting PCSK9 was designed using looser off-target filtering criteria and allowing greater variation in siRNA length (19-mer, 21-mer, and 23-mer), and these additional siRNAs were synthesized. Next, they were transfected into human Hep3B cells using 0.1 nM and 1 nM siRNA to test their effectiveness. Figure 14A ) and human C3A cells ( Figure 14B The ability to knock down PCSK9 mRNA expression was also tested in both human cell types at concentrations of 5 nM and 50 nM. Figure 15 When treated with siRNA C209.021, toxic effects were observed in both human cell types. The IC50 of the siRNA was calculated for the 15 most active and non-toxic sequences using human Hep3B cells (Table F) and human C3A cells (Table G). 50 Value. IC50 in human Hep3B cells. 50 The values ​​ranged from 3.3 pM to 45.2 pM, while the IC50 in human C3A cells was... 50 Values ​​ranged from 14.1 pM to 102.0 pM. Optimal maximum knockdown was achieved using siRNA C209.016 in both cell types.

[0561] Table F: IC50 of additional PCSK9 siRNA in Hep3B cells 50 active

[0562]

[0563]

[0564] Table G: IC50 of additional PCSK9 siRNA in C3A cells 50 active

[0565] siRNA: <![CDATA[IC 50 (pM):]]> <![CDATA[I max %:]]> C217.001 102.0 94.4 C217.011 50.7 93.4 C217.013 31.0 92.0 C217.014 17.4 93.4 C218.003 40.8 92.2 C218.005 46.7 95.7 C218.006 49.7 90.3 C218.008 51.4 91.9 C218.012 33.2 94.4 C219.001 33.8 88.9 C219.003 86.3 95.3 C219.004 66.1 93.5 C219.006 73.4 93.1 C219.007 65.4 94.2 C209.016 14.1 96.8 S48694 (Ambion) 41.5 91.4

[0566] Finally, comparisons were made to understand the IC calculated in Hep3B cells. 50 Values ​​and IC calculated in C3A cells 50 Correlation between values ​​( Figure 16A ), and I in these two cell types max Correlation between values ​​( Figure 16B ).

[0567] In summary, the data provided in this example demonstrate that the two additional PCSK9 siRNA sequences (C209.016 and C218.012) exhibit good activity profiles in all in vitro assays used. C218.012 represents a nucleotide extension sequence compared to C032.012.

[0568] Example 5: Leader optimization of GalNAc-conjugated PCSK9 siRNA sequences

[0569] method

[0570] Unless otherwise instructed, all experiments were performed as described in the examples above. GalNAc-siRNA (including those containing the above nucleotide analogs) were generated based on the indicated sequence as described in WO 2019 / 170731 (see the sequence listing above).

[0571] result

[0572] Based on the results from Examples 3 and 4, three parental PCSK9 siRNA sequences (siRNA IDB014 / C032.012 / C217.014, B006 / C032.006 / C217.001, and C209.016 / C217.007) were selected, and each molecule had three consecutive GalNAc-conjugated nucleotide analogs (siRNA IDC027.001, C027.002, and C027.003; Table 4 above) synthesized at the 5' end of the sense strand of the corresponding siRNA. The parental sequences of siRNAs C027.001, C027.002, and C027.003 were then used for optimization activities, which included 66 different chemical modifications for each siRNA sequence. The resulting sequences and modification patterns are shown in Table 4 above.

[0573] In cryopreserved human primary hepatocytes, the in vitro activity of these optimized libraries was tested under free uptake conditions using PCSK9 GalNAc-siRNA concentrations of 10 nM, 100 nM, and 1000 nM. Figure 17 As illustrated, optimized libraries based on parental sequences C027.001 and C027.003 were identified as exhibiting higher overall in vitro activity compared to the parental sequence C027.002. Notably, numerous modification patterns that strongly attenuated the siRNA activity of the molecules were identified, particularly for the parental sequence C027.002. Furthermore, a large number of sequence modifications leading to improved knockdown activity compared to the corresponding parental molecules were identified.

[0574] To evaluate the improved stability characteristics of the optimized PCSK9 GalNAc-siRNA, the in vitro half-life of the optimized library in 50% mouse serum was determined. As confirmed in Table H, numerous modifications with improved nuclease stability compared to the corresponding parental molecule were identified, most notably for the optimized library of parental siRNA ID C027.001.

[0575] Table H: Nuclease stability of the optimized PCSK9 GalNAc-siRNA construct in 50% mouse serum.

[0576]

[0577]

[0578] Prior to in vivo activity assays, based on siRNA activity, stability, and chemical considerations, 14 siRNAs were selected for modification of each of the three different parental sequences of siRNAs IDC027.001, C027.002, and C027.003. Immunostimulatory potential was measured in human PBMC assays using IFNα2a secreted into the supernatant as a reading. Figure 18 No signs of immune stimulation were observed in human PBMCs for any of the PCSK9 GalNAc-siRNAs tested.

[0579] Next, 42 of the 198 optimized PCSK9 GalNAc-siRNAs based on three different parental sequences were used for in vivo pharmacological testing in human PCSK9 transgenic mice, and compared with the corresponding parental molecules C027.001, C027.002, and C027.003. Figures 19A-19C When compared with control animals treated with PBS, for the three corresponding optimized libraries, maximal target PCSK9 protein knockdown (KD) was achieved between day 7 and day 14 at 86% (C027.001#58), 62% (C027.002#19), and 82% (C027.003#08) respectively after subcutaneous administration of the selected compound at a single dose of 6 mg / kg. max (For KD, which showed 32% and 31% respectively) max The parental sequence libraries C027.001 and C027.003, whose values ​​returned to baseline 3 weeks after administration, showed the most significant increase in in vivo activity. Interestingly, the parental sequence library C027.002 (KD) showed the most significant increase. max The increase in efficacy (52%) was not significant. This is also reflected in KD. 50 Regarding the level (50% maximum knockdown), the optimal molecule for library C027.002 (C027.002#19) reached KD around day 20. 50 For molecules C027.001#40 and C027.003#08, libraries C027.001 and C027.003 reached KD on approximately day 26 and day 30, respectively. 50 In this study, at the PCSK9 level (KD max and KD 50 The molecules identified as having the best overall in vivo pharmacological profile are C027.001#40, C027.001#58, C027.003#03, C027.003#06, C027.003#08 and C027.003#47.

[0580] In the same study, serum LDL cholesterol (LDL-c) was measured on days 14 and 28 after siRNA administration. Figure 19D and Figure 19E This analysis confirmed the identification of a large number of optimized molecules with improved in vivo pharmacological profiles compared to their corresponding parental sequences. siRNA ID C027.003#06 achieved a maximum LDL-c reduction of 32% on day 14 post-dose.

[0581] A summary of the selected siRNAs used in the examples is shown in Table I below.

[0582] Table I: siRNAs used in the examples.

[0583]

[0584] Although the foregoing disclosure has been described in detail by way of illustration and examples for purposes of clarity, such description and examples should not be construed as limiting the scope of this disclosure.

Claims

1. A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand containing a first sequence and an antisense strand containing a second sequence, wherein the first sequence is complementary to the second sequence, and wherein the dsRNA inhibits the expression of the proteoproteolytic enzyme subtilisin Kexin 9 (PCSK9) gene. The dsRNA is shown below: (1) CCAUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 322) in the sense chain and AAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 323) in the antisense chain. (2) CCAUUUUAUUAAUAUGGUGACUUUinvdT (SEQ ID NO: 328) in the sense chain and AAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 329) in the antisense chain. (3) CCAUUUAUUAAUAUGGUGACUUUUinvdT (SEQ ID NO: 330) in the sense chain and AAAAGUCACCAUAUUAAUAAAdTdT (SEQ ID NO: 331) in the antisense chain. (4) CCAAUUUUUAUUAAUAUGGUGACUUUinvdT in the sense chain (SEQ ID NO: 338) and AAAGUCACCAUAUUAAUAAAAAUdTdT in the antisense chain (SEQ ID NO: 339). (5) CCAUUUUUAUUAAUAUGGUGACUUUUinvdT in the sense chain (SEQ ID NO: 340) and AAAAGUCACCAUAUUAAUAAAAAdTdT in the antisense chain (SEQ ID NO: 341). (6) CCAUUUAUUAAUAUGGUGACUUUUUAinvdT in the sense chain (SEQ ID NO: 342) and UAAAAAGUCACCAUAUUAAUAAAdTdT in the antisense chain (SEQ ID NO: 343). (7) CCAUUAUUAAUAUGGUGACUUUUUAAinvdT (SEQ ID NO: 344) in the sense chain and UUAAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 345) in the antisense chain. (8) CCAUUAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO: 466) in the sense chain and AAAAAGUCACCAUAUUAAUAAdTdT (SEQ ID NO: 467) in the antisense chain, or (9) CCAUUUUAUUAAUAUGGUGACUUUUUinvdT (SEQ ID NO: 476) in the sense chain and AAAAAGUCACCAUAUUAAUAAAAdTdT (SEQ ID NO: 477) in the antisense chain.

2. The dsRNA according to claim 1, wherein the dsRNA comprises one or more modified nucleotides; At least one of the one or more modified nucleotides is a 2'-O-methyl nucleotide, a 5'-phosphothioester nucleotide, or a terminal nucleotide linked to a cholesterol derivative or a lipophilic moiety; or At least one of the one or more modified nucleotides is 2'-fluoro, 2'-deoxy, 2'-O-methoxyethyl, restricted ethyl (cEt), deoxy, reverse deoxy, reverse dideoxy, locked nucleic acid, debased, 2'-amino, 2'-alkyl, morpholino, aminophosphate, or a nucleotide containing a non-natural base; or The dsRNA comprises one or more 2'-O-methyl nucleotides and one or more 2'-fluoronucleotides; or The dsRNA comprises two or more 2'-O-methyl nucleotides and two or more 2'-fluoro nucleotides in the pattern OMe-F-OMe-F or F-OMe-F-OMe. Where OMe represents 2'-O-methyl nucleotide, and F represents 2'-fluoronucleotide; or The dsRNA comprises up to 10 consecutive nucleotides, each being a 2'-O-methyl nucleotide or up to 10 consecutive nucleotides, each being a 2'-fluoro nucleotide.

3. The dsRNA according to claim 1 or 2, wherein: (a) The dsRNA contains one or more phosphate thioester groups, or (b) The dsRNA does not contain thiophosphate groups.

4. The dsRNA according to claim 1 or 2, wherein: (a) The dsRNA contains one or more phosphotriester groups, or (b) The dsRNA does not contain a phosphotriester group.

5. The dsRNA according to claim 1 or 2, wherein the dsRNA is attached to one or more GalNAc derivatives via a adapter.

6. The dsRNA of claim 5, wherein the dsRNA is attached to three GalNAc derivatives via a trivalent branching adapter.

7. The dsRNA of claim 5, wherein at least one of the one or more GalNAc derivatives is attached to the 3' end of the sense strand, the 3' end of the antisense strand, or the 5' end of the sense strand of the dsRNA.

8. The dsRNA according to claim 1 or 2, wherein one or both of the sense strand and the antisense strand further comprise: (a) A 5' overhang containing one or more nucleotides; and / or (b) Contains a 3' overhang of one or more nucleotides.

9. The dsRNA of claim 8, wherein the 5' protrusion comprises one or more thymines.

10. The dsRNA of claim 8, wherein the 3' overhang comprises two nucleotides.

11. The dsRNA of claim 8, wherein the 3' protrusion comprises one or more thymines.

12. The dsRNA according to claim 1 or 2, wherein one or both strands of the dsRNA comprise one or more compounds having the structure of formula (I): (I) in: -B is a heterocyclic nucleobase; One of L1 and L2 is a compound of formula (I) linked to an internucleotide linker of a polynucleotide, and the other of L1 and L2 is H, a protecting group, a phosphorus moiety, or a compound of formula (I) linked to an internucleotide linker of a polynucleotide. -Y is O, NH, NR1, or NC (=O)-R1, where R1 is: (C1-C20)alkyl, (C3-C8)cycloalkyl groups, optionally substituted with one or more groups selected from halogen atoms and (C1-C6) alkyl groups, The group is -[C(=O)]m-R2-(O-CH2-CH2)p-R3, where m represents an integer that is either 0 or 1. p is an integer in the range of 0 to 10. R2 is a (C1-C20) alkylene group, and R3 is selected from hydrogen atom, (C1-C6)alkyl, (C1-C6)alkoxy, (C3-C8)cycloalkyl, (C3-C14)heterocyclic, (C6-C14)aryl, or (C5-C14)heteroaryl, or R3 is a cell-targeting moiety. -X1 and X2 are each independently a hydrogen atom and a (C1-C6) alkyl group, and -Ra, Rb, Rc, and Rd are each independently H or (C1-C6) alkyl groups. Or it could be a pharmaceutically acceptable salt.

13. The dsRNA according to claim 12, wherein R1 is a (C1-C20) alkyl group substituted with one or more groups selected from halogen atoms, (C1-C6) alkyl, (C3-C8) cycloalkyl, (C3-C14) heterocyclic, (C6-C14) aryl, (C5-C14) heteroaryl, -O-Z1, -N(Z1)(Z2), -S-Z1, -CN, -C(=J)-O-Z1, -OC(=J)-Z1, -C(=J)-N(Z1)(Z2) and -N(Z1)-C(=J)-Z2, wherein J is O or S, and Z1 and Z2 are each independently H or (C1-C6) alkyl.

14. The dsRNA of claim 13, wherein Z1 and Z2 are each (C1-C6)alkyl groups, said (C1-C6)alkyl groups being substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl groups.

15. The dsRNA according to claim 12, wherein R1 is a (C3-C8) cycloalkyl group substituted with one or more groups selected from halogen atoms and (C1-C6) alkyl groups.

16. The dsRNA according to claim 12, wherein R2 is a (C1-C20) alkylene substituted with (C1-C6) alkyl, -O-Z3, -N(Z3)(Z4), -S-Z3, -CN, -C(=K)-O-Z3, -OC(=K)-Z3, -C(=K)-N(Z3)(Z4) or -N(Z3)-C(=K)-Z4, wherein K is O or S, and Z3 and Z4 are each independently H or (C1-C6) alkyl.

17. The dsRNA of claim 16, wherein Z3 and Z4 are each independently (C1-C6)alkyl groups, said (C1-C6)alkyl groups being substituted by one or more groups selected from halogen atoms and (C1-C6)alkyl groups.

18. The dsRNA according to claim 12, comprising one or more compounds of formula (I), wherein Y is: a) NR1 and R1 are unsubstituted (C1-C20) alkyl groups; b) NR1, R1 is an unsubstituted (C1-C16) alkyl group, which includes alkyl groups selected from methyl, isopropyl, butyl, octyl and hexadecyl; c) NR1, R1 are (C3-C8) cycloalkyl groups; d) NR1 and R1 are cyclohexyl groups; e) NR1, R1 is a (C1-C20) alkyl group substituted with (C6-C14) aryl groups; f) NR1, R1 is a methyl group substituted with a phenyl group; g) NC(=O)-R1, where R1 is a substituted (C1-C20) alkyl group; or h) NC(=O)-R1, where R1 is methyl or pentadecyl.

19. The dsRNA of claim 18, wherein R1 is a (C3-C8) cycloalkyl group substituted with one or more groups selected from halogen atoms and (C1-C6) alkyl groups.

20. The dsRNA of claim 12, comprising one or more compounds of formula (I), wherein B is selected from pyrimidine, substituted pyrimidine, purine and substituted purine, or a pharmaceutically acceptable salt thereof.

21. The dsRNA according to claim 12, wherein R3 has formula (II). (II) Where A1, A2, and A3 are OH, A4 is OH or NHC(=O)-R5, wherein R5 is an (C1-C6) alkyl group optionally substituted with a halogen atom, or a pharmaceutically acceptable salt thereof.

22. The dsRNA according to claim 21, wherein R5 is a (C1-C6) alkyl group substituted with a halogen atom.

23. The dsRNA of claim 12, wherein R3 is N-acetylgalactosamine, or a pharmaceutically acceptable salt thereof.

24. The dsRNA of claim 12, comprising one or more of the following nucleotides: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , or .

25. The dsRNA according to claim 12, comprising 2 to 10 compounds of formula (I) or pharmaceutically acceptable salts thereof.

26. The dsRNA according to claim 25, wherein the 2 to 10 compounds of formula (I) are on the sense strand.

27. The dsRNA of claim 12, wherein the sense strand comprises two to five compounds of formula (I) at the 5' end and / or one to three compounds of formula (I) at the 3' end.

28. The dsRNA according to claim 12, wherein a) Two to five compounds of formula (I) at the 5' end of the sense chain contain 1gT3; and / or b) One to three compounds of formula (I) at the 3' end of the sense chain contain lT4.

29. The dsRNA of claim 28, wherein two to five compounds of formula (I) at the 5' end of the sense strand comprise three consecutive 1gT3 nucleotides; and / or one to three compounds of formula (I) at the 3' end of the sense strand comprise two consecutive 1T4 nucleotides.

30. The dsRNA of claim 12, comprising one or more internucleotide linking groups, said internucleotide linking groups being independently selected from phosphodiester, phosphotriester, thiophosphate, dithiophosphate, alkyl-phosphonate, and aminophosphate backbone linking groups, or pharmaceutically acceptable salts thereof.

31. The dsRNA according to claim 1 or 2, wherein the sense strand and antisense strand of the dsRNA are respectively as follows: a) SEQ ID NO: 346 and 347; b) SEQ ID NO: 352 and 353; c) SEQ ID NO: 354 and 355; d) SEQ ID NO: 362 and 363; e) SEQ ID NO: 364 and 365; f) SEQ ID NO: 366 and 367; g) SEQ ID NO: 368 and 369; h) SEQ ID NO: 548 and 549; j) SEQ ID NO: 558 and 559; or i) SEQ ID NO: 568 and 569.

32. A vector encoding dsRNA according to any one of claims 1-31.

33. An isolated host cell comprising dsRNA according to any one of claims 1-31.

34. A composition comprising dsRNA according to any one of claims 1-31.

35. The composition of claim 34, wherein the composition further comprises a pharmaceutically acceptable carrier.

36. The composition of claim 34, wherein the composition further comprises a delivery medium.

37. The composition of claim 36, wherein the delivery medium is a liposome.

38. Use of the dsRNA according to any one of claims 1-31, the cell according to claim 33, or the composition according to any one of claims 34-37 in the preparation of a medicament for treating or preventing PCSK9-mediated disorders or diseases in a subject of need, wherein the PCSK9-mediated disorder or disease is hypercholesterolemia.

39. The use according to claim 38, wherein the expression of the PCSK9 gene in the liver of the subject is inhibited by the dsRNA.

40. The use according to claim 38, wherein the subject is a human.

Images