A kit for constructing a 15-gene coding region sequencing library and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-25
- Publication Date
- 2026-03-03
AI Technical Summary
采用传统sanger测序的方式无法满足多基因、多位点、未知位点变异的检测,需要高通量的检测手段实现多位点同时检测,且能发现更多位点与病症的关联信息
[0036]本发明的发明人经研究发现包括:F2、F5、F9、FGA、FGG、HABP2、HRG、LMAN1、MTHFR、PROC、PROS1、PROZ、SERPINC1、SERPIND1、THBD在内的共15个基因与遗传性易栓症高度相关,通过对这些基因进行单独或组合的突变情况检测,可以有效进行遗传性易栓症检测、分类或预测、治疗监测、预后或其它评价。进一步发现,针对这15个基因的所有编码区域设计2轮扩增引物,其中第一轮扩增引物包括2组特异性扩增的引物,从而制备而成的测序文库构建试剂盒,可实现对上述15个基因全部编码区域的同步检测,在500x以上的测序深度有效保障区域内序列的检出,以达到对已知位点的灵敏检测和对未知位点的深度挖掘,从而有效获得更为全面的位点突变信息,进而满足科研和临床检测的需求。
Smart Images

Figure BDA0003662531520000061 
Figure BDA0003662531520000071 
Figure BDA0003662531520000081
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a kit for constructing a 15-gene coding region sequencing library and its application. Background Technology
[0002] In the intergenerational transmission of human genes, offspring inherit some genetic traits from their parents, including single nucleotide polymorphisms (SNPs). Simultaneously, offspring may develop new gene variations, such as point mutations, small insertions, or deletions. Single nucleotide polymorphisms are widespread throughout the genome, and new gene variations are constantly generated during cell proliferation and growth. SNPs and variations in germ cells can be inherited by offspring, which is one of the main reasons why offspring may carry hereditary diseases or develop susceptibility to certain diseases.
[0003] Hereditary thrombophilia is a genetic pathological condition that makes individuals more susceptible to venous thrombosis than the general population. According to early research data from Europe and the United States, the most common causes of hereditary thrombophilia are factor V Leiden mutations (FVL) and prothrombin gene mutations (PGM), accounting for 50%-60% of cases in Caucasian populations. Protein S deficiency, protein C deficiency, and antithrombin (AT) deficiency account for the vast majority of other cases. For these known gene SNP sites, target fragments are typically amplified using polymerase chain reaction (PCR), and then the specific sequence information of the gene site is determined using Sanger sequencing. This traditional method is only suitable for detecting a small number of known sites. With the continuous development of detection technology, more genes associated with hereditary thrombotic susceptibility have been discovered in clinical studies, including: F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD. Traditional Sanger sequencing methods cannot meet the requirements for detecting multiple genes, multiple loci, and unknown loci variants. High-throughput detection methods are needed to simultaneously detect multiple loci and uncover more information linking loci to the disease. Summary of the Invention
[0004] Therefore, one of the objectives of this invention is to provide a gene or combination thereof for detecting hereditary thrombophilia.
[0005] The technical solutions include the following:
[0006] A gene or combination thereof for detecting hereditary thrombophilia, comprising at least one of F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD.
[0007] In some embodiments, the aforementioned genes include F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD.
[0008] One of the objectives of this invention is to provide the application of the above-mentioned genes or combinations thereof in the preparation of kits for the detection, classification or prediction, treatment monitoring, prognosis or other evaluation of hereditary thrombophilia.
[0009] One of the objectives of this invention is to provide a test kit for hereditary thrombophilia.
[0010] The technical solution to achieve the above objectives is as follows:
[0011] A kit for detecting hereditary thrombophilia, comprising reagents for detecting mutations in the aforementioned genes or combinations thereof.
[0012] In some embodiments, the kit is prepared using polymerase chain reaction (PCR), in situ hybridization (ISH), enzyme mutation detection, chemical splicing mismatch, mass spectrometry, gene chip, or gene sequencing, or a combination thereof.
[0013] In some embodiments, the kit includes primers for amplifying the hereditary thrombophilia gene, said primers including a first-round specific primer and a second-round universal primer; the nucleotide sequence of the second-round universal primer is shown in SEQ ID NO.417-SEQ ID NO.418; nucleotide sequences for the F2 gene include group A amplification primers as shown in SEQ ID NO.1-SEQ ID NO.16 and / or group B amplification primers as shown in SEQ ID NO.211-SEQ ID NO.224.
[0014] Amplification primers of group A (SEQ ID NO. 17-SEQ ID NO. 60) and / or amplification primers of group B (SEQ ID NO. 225-SEQ ID NO. 270) targeting the F5 gene nucleotide sequence,
[0015] Amplification primers of group A (SEQ ID NO. 61-SEQ ID NO. 70) and / or amplification primers of group B (SEQ ID NO. 271-SEQ ID NO. 280) targeting the F9 gene nucleotide sequence,
[0016] Amplification primers of group A (SEQ ID NO. 71-SEQ ID NO. 86) and / or amplification primers of group B (SEQ ID NO. 281-SEQ ID NO. 294) targeting the nucleotide sequence of the FGA gene.
[0017] Amplification primers of group A (SEQ ID NO. 87-SEQ ID NO. 96) and / or amplification primers of group B (SEQ ID NO. 295-SEQ ID NO. 306) targeting the nucleotide sequence of the FGG gene.
[0018] Amplification primers of group A (SEQ ID NO. 97-SEQ ID NO. 110) and / or amplification primers of group B (SEQ ID NO. 307-SEQ ID NO. 318) targeting the HABP2 gene nucleotide sequence,
[0019] Amplification primers of group A (SEQ ID NO. 111-SEQ ID NO. 120) and / or amplification primers of group B (SEQ ID NO. 319-SEQ ID NO. 330) targeting the HRG gene nucleotide sequence,
[0020] Amplification primers of group A (SEQ ID NO. 121-SEQ ID NO. 134) and / or amplification primers of group B (SEQ ID NO. 331-SEQ ID NO. 342) targeting the LMAN1 gene nucleotide sequence,
[0021] Amplification primers of group A (SEQ ID NO. 135-SEQ ID NO. 146) and / or amplification primers of group B (SEQ ID NO. 343-SEQ ID NO. 356) targeting the MTHFR gene nucleotide sequence,
[0022] Amplification primers of group A (SEQ ID NO. 147-SEQ ID NO. 156) and / or amplification primers of group B (SEQ ID NO. 357-SEQ ID NO. 368) targeting the PROZ gene nucleotide sequence,
[0023] Amplification primers of group A (SEQ ID NO. 157-SEQ ID NO. 166) and / or amplification primers of group B (SEQ ID NO. 369-SEQ ID NO. 378) targeting the nucleotide sequence of the PROC gene.
[0024] Amplification primers of group A (SEQ ID NO. 167-SEQ ID NO. 184) and / or amplification primers of group B (SEQ ID NO. 379-SEQ ID NO. 394) targeting the PROS1 gene nucleotide sequence,
[0025] Amplification primers of group A (SEQ ID NO. 185-SEQ ID NO. 194) and / or amplification primers of group B (SEQ ID NO. 395-SEQ ID NO. 402) targeting the SERPINC1 gene nucleotide sequence,
[0026] Amplification primers of group A (SEQ ID NO. 195-SEQ ID NO. 202) and / or amplification primers of group B (SEQ ID NO. 403-SEQ ID NO. 410) targeting the nucleotide sequence of the SERPIND1 gene,
[0027] Amplification primers of group A with nucleotide sequences of SEQ ID NO.203-SEQ ID NO.210 and / or amplification primers of group B with nucleotide sequences of SEQ ID NO.411-SEQ ID NO.416 targeting the THBD gene.
[0028] One of the objectives of this invention is to provide a method for constructing sequencing libraries.
[0029] The technical solution to achieve the above objectives is as follows:
[0030] A method for constructing a sequencing library, comprising the following steps:
[0031] Obtain DNA from the biological sample to be tested;
[0032] Using the DNA of the biological sample to be tested as a template, PCR amplification was performed using the first round of specific primers and the second round of universal primers to obtain a multi-gene sequencing library of hereditary thrombotic susceptibility.
[0033] In some embodiments, the source of the DNA in the biological sample to be tested includes, but is not limited to, fresh tissue, paraffin-embedded tissue blocks or sections, and plasma. Preferably, the DNA in the biological sample to be tested is obtained directly from the above-mentioned fresh tissue, paraffin-embedded tissue blocks or sections, or plasma, and / or obtained by reverse transcription of RNA extracted from the above-mentioned fresh tissue, paraffin-embedded tissue blocks or sections, or plasma.
[0034] In some embodiments, the PCR amplification is performed as follows: primers A and B from the first-round amplification primers in the above-mentioned hereditary thrombotic susceptibility detection kit are used to amplify the genomic DNA of the sample to be tested, respectively, to obtain two amplification products, A and B; the two amplification products are mixed and purified and used as templates for the second-round amplification, and amplified using the second-round universal primers.
[0035] In some embodiments, the mixing ratio of the amplification products from groups A and B is 1:1 to 3. This ratio is determined by the proportion of the target regions amplified by the two sets of primers.
[0036] The inventors of this invention have discovered that 15 genes, including F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD, are highly associated with hereditary thrombophilia. By detecting mutations in these genes individually or in combination, hereditary thrombophilia can be effectively detected, classified, predicted, monitored for treatment, and evaluated for prognosis or other aspects. Furthermore, a sequencing library construction kit was developed using primers designed for all coding regions of these 15 genes in two rounds. The first round of primers includes two sets of primers for specific amplification. This kit enables simultaneous detection of all coding regions of these 15 genes, effectively ensuring sequence detection within the regions at sequencing depths of 500x or higher. This allows for sensitive detection of known sites and in-depth analysis of unknown sites, thereby obtaining more comprehensive information on site mutations and meeting the needs of scientific research and clinical testing. Attached Figure Description
[0037] Figure 1 This is a schematic diagram of the sequencing library construction process in Example 1.
[0038] Figure 2 These are the sequencing results of the five libraries in Example 2.
[0039] Figure 3 The results are statistical results of the five variant interpretations in Example 2.
[0040] Figure 4 The results are for the 28 samples tested in Example 3. Detailed Implementation
[0041] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0042] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0043] Throughout the specification and claims, the following terms have the meaning explicitly relevant to this document unless the context clearly specifies otherwise. The phrase "in one embodiment" as used in this invention does not necessarily refer to the same embodiment, although it may. Furthermore, the phrase "in another embodiment" as used in this invention does not necessarily refer to different embodiments, although it may. Therefore, as described below, various embodiments of the invention can be readily combined without departing from the scope or spirit of the invention.
[0044] Furthermore, as used herein, the term "or" is an inclusive "or" sign and is equivalent to the term "and / or," unless the context clearly specifies otherwise. The term "based on" is not exclusive and allows for basing on other factors not described, unless the context clearly specifies otherwise. Additionally, throughout the specification, the meanings of "an," "a," and "the" include plural indicators.
[0045] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0046] The present invention will be further described in detail below with reference to specific embodiments.
[0047] Example 1: Preparation and Detection of the Reagent Kit
[0048] 1. Components of the reagent kit
[0049] The inventors discovered that when mutations in 15 genes—F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD—are simultaneously detected, the results can effectively aid in the detection of hereditary thrombophilia. This kit covers 15 genes: F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD. The inventors designed primers specifically for amplifying all coding regions of these genes. A first round of polymerase chain reaction (PCR) yields amplicons containing sequences from these target regions, and a second round of amplification introduces the sequences required for sequencing at both ends of these amplicons.
[0050] This kit detects gene coding regions containing 149 exons. For large fragment regions (exons greater than 250 bp), the inventors, through in-depth research, divided them into specific numbers of amplicones for amplification, ensuring that the amplification products of the designed primers completely cover all target fragments. Within large target regions, the amplicons overlap in a shingled manner, completely covering the entire region from the first to the last amplicon. Furthermore, for regions where primers are designed internally, the downstream primer binding region of the previous amplicon will be covered by the next amplicon. Adjacent amplicons are amplified in two separate amplification tubes. (See diagram below.) Figure 1 This ensures that every primer-binding region within the target area can be effectively detected by other amplicones. Because primer binding would cause the amplification products in that region to consist entirely of the primer sequence itself, the genetic information in the primer-binding region could be masked, leading to false negatives and false positives. The shingled amplicon design described above can also avoid these false negative and false positive results.
[0051]
[0052]
[0053]
[0054]
[0055] This kit contains first-round amplification primers, second-round amplification primers, 2x PCR amplification premix, and water.
[0056] The 2x PCR amplification premix already contains the hot-start high-fidelity DNA polymerase and Mg required for amplification. 2+dNTPs, etc. The water in the kit is PCR-grade, DNase / RNase-free sterile water.
[0057] The kit includes two sets of primers for the first round of amplification: set A and set B, with their specific sequences shown in Tables 1-1 and 1-2, respectively. Each set of primers is used for amplification in a separate reaction system. The resulting amplification products are then mixed, purified, and used as templates for the second round of amplification. This separate amplification method avoids the large number of ultra-short, invalid fragments that could be generated by mixing upstream and downstream primers of adjacent amplicons, thus preventing disruption to the overall amplification efficiency.
[0058] 5'-cactctttccctacacgacgctcttccgatct-3' (SEQ ID NO.419) and 5'-tgactggagttcagacgtgtgctcttccgatct-3' (SEQ ID NO.420) are universal adapter sequences used in Illumina sequencing procedures.
[0059] Table 1-1 Primers for Group A in the first round of amplification
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067] Table 1-2 Primers for the second round of amplification (Group B)
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075] The second-round amplification primers in the kit are adapter sequences carrying sample tags. The specific sequences are shown in Table 1-3 below. After the second-round amplification product of each sample is purified and quality controlled to be qualified, it can be mixed with other qualified libraries carrying different sample tags in proportion and then used for sequencing analysis.
[0076] Table 1-3 Primers for the second round of amplification
[0077]
[0078] Note: N8 in the primer PC2 sequence is a tag sequence, which is a known sequence corresponding to different samples and is used to distinguish sample sequencing data.
[0079]
[0080]
[0081] 2. Sequencing library construction
[0082] The specific steps for using the kit are as follows:
[0083] 2.1 First round of amplification reaction:
[0084] The first round of reactions will be conducted in two reaction systems, each containing 30 μl. Add 15 μl of 2x PCR amplification premix to each tube, followed by 3 μl of amplification primers from group A and group B, respectively. Then, add an equal volume of sample genomic DNA (20-100 ng) to each system. Finally, bring the total volume to 30 μl with water. The two reaction systems are shown in Table 1-4.
[0085] Table 1-4. First-round amplification reaction system
[0086]
[0087] After configuring the above reaction system, amplification was carried out according to the first round of amplification reaction cycle conditions. The reaction conditions for the two systems were the same. The specific amplification cycle conditions are shown in Table 1-5.
[0088] Table 1-5. Cyclic conditions for the first round of amplification reaction
[0089]
[0090] The amplification products from the two systems were directly mixed (1:1). Fragments in the range of 200bp-500bp were recovered according to the instructions of the commercial magnetic bead purification and recovery kit. The final volume of the recovered product after elution was 15μl. 13μl was used for the second round of amplification, and 2μl was reserved for product quality control analysis.
[0091] 2.2 Second round of amplification reaction
[0092] The first-round amplification product is used as a template for the second-round amplicon amplicon amplification reaction. This step introduces the sequencing sample tag sequence onto the first-round amplicon. The reaction system for this step is shown in Table 1-6.
[0093] Table 1-6. Second-round amplification reaction system
[0094]
[0095] After configuring the above reaction system, amplification was carried out according to the second round of amplification reaction cycle conditions. The specific amplification cycle conditions are shown in Table 1-7.
[0096] Table 1-7 Cyclic Conditions for the Second Round of Amplification Reactions
[0097]
[0098] After amplification, fragments in the range of 250bp-550bp were recovered according to the instructions of the commercial magnetic bead purification and recovery kit. The final volume of the recovered product after elution was 20μl, which was used for subsequent quality control and sequencing.
[0099] After the above experimental procedures are completed, libraries that pass quality control can be mixed with other libraries carrying different sample tags for sequencing.
[0100] Example 2
[0101] Five commercially available reference materials, consisting of leukocyte genomic DNA, were analyzed using the kit described in Example 1 of this invention. The samples were numbered Bg1, Bg2, Bg3, Bg4, and Bg5. No significant degradation was observed in the genomic DNA of any of the samples, and the DNA concentration was adjusted to 5 ng / μl.
[0102] According to the implementation plan of this kit, the first round of PCR system is configured as shown in Table 2-1 below:
[0103] Table 2-1
[0104] Group A amplification system Group B amplification system reagents Dosage reagents Dosage 2x PCR amplification premix 15μl 2x PCR amplification premix 15μl Group A amplification primers 3μl Group B amplification primers 3μl Sample genomic DNA 8 μl Sample genomic DNA 8 μl water 4 μl water 4 μl total 30μl total 30μl
[0105] A total of 10 tubes were prepared, and the PCR reaction was carried out according to the reaction program shown in Table 2-2 below:
[0106] Table 2-2
[0107]
[0108] The amplification products from the two systems for each sample were directly mixed into 5 tubes. Fragments in the range of 200bp-500bp were recovered according to the instructions of the commercial magnetic bead purification and recovery kit. The final volume of the recovered product after elution was 15μl. 13μl was used for the second round of amplification, and 2μl was reserved for product quality control analysis.
[0109] Configure the second-round amplification reaction system according to the implementation plan of this kit. Use the first-round amplification product as a template and configure the system as shown in Table 2-3 below:
[0110] Table 2-3
[0111]
[0112]
[0113] After configuring the above reaction system, amplification was carried out according to the second round of amplification reaction cycle conditions. The specific amplification cycle conditions are shown in Table 2-4 below:
[0114] Table 2-4
[0115]
[0116] After amplification, fragments in the range of 250bp-550bp were recovered according to the instructions of the commercial magnetic bead purification and recovery kit. The final volume of the recovered product after elution was 20μl, which was used for subsequent quality control and sequencing.
[0117] All five documents met the requirements for computer-based testing after fragment analysis.
[0118] Sequencing was performed on the Illumina NextSeq500 platform, and the sequencing results were statistically analyzed as follows: Figure 2 As shown, the average capture efficiency of the target region was 84.4%, with a low proportion of wasted sequencing data. The coverage of the target region was 100%, detecting all coding sequences of all 15 genes, with an average sequencing depth of 649x. This batch of sequencing results can effectively analyze the coding sequence information of these 15 genes and be used for variant interpretation and statistics. The partial detection results of the above sample are shown below. Figure 3 As shown, the results detected by this kit are consistent with the gene variations stated in the instructions for use of the commercial standard reference material.
[0119] Example 3
[0120] Using the kit described in Example 1 and following the method described in Example 1, peripheral blood samples from 145 patients clinically suspected of having hereditary thrombophilia were tested and analyzed. According to the kit implementation plan, detection and result analysis were performed, and mutations in one of 15 genes were found in 28 samples. The results are as follows: Figure 4As shown in the image. This kit has a detection rate of approximately 20% for risk gene variants associated with hereditary thrombophilia, and can effectively assist in the risk assessment and clinical diagnosis of hereditary thrombophilia.
[0121] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims. sequence list <110> Shanghai KingMed Diagnostics Co., Ltd. Hainan KingMed Diagnostics Center Co., Ltd. <120> A kit for constructing 15-gene coding region sequencing libraries and its application. <160> 420 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 ggggtcagga cagacaattc c 21 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 ccagtcctcc agcctgttc 19 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 cccctcatcc tcagctcc 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 gactcagacc cctgccagac 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <400> 5 ggggttggct ctcactagg 19 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 gccccactgt tccctcag 18 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <400> 7 tgatgtgacc ttgaacttga ctc 23 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ttctttcacg ggattggttc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 aggagctgcc gtagcctcac 20 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <400> 10 ccaggcctcc cttcctg 17 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence <400> 11 aataagtccc caggctccaa g 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ctgttctcag cccatggtgg 20 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 tgtggtctca ctcactctgc tg 22 <210> 14 <211> twenty two <212> DNA <213> Artificial Sequence <400> 14 cagctgagtt gaagtcctgg tg 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 gatctagggg atgggtgagg 20 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 cagtgagggg caagtcctg 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 taattggttc cagcgaaagc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 ctattagccc agaggcgatg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 tccctattgc ttgcttttgt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 gaagtgagga ttggaggtgc 20 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <400> twenty one ctgtccagtg gcacttctgt 20 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two gcttcctctg tgagtgtcca 20 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three tcagccacac gactctctct 20 <210> twenty four <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty four tcatatggct gagttctgga g 21 <210> 25 <211> twenty two <212> DNA <213> Artificial Sequence <400> 25 ccctttctct agacttcagc ca 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 ggaaagggac atctgaccaa 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 atcacctcct ccagaccttg 20 <210> 28 <211> twenty two <212> DNA <213> Artificial Sequence <400> 28 ttttgtaggg gtcatcatag gg 22 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <400> 29 cggaaaatgc atgatcgtt 19 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <400> 30 gaaggggctt tctgaggtt 19 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <400> 31 gcattccagc ccatattctg 20 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <400> 32 cagggcctca ttctggaag 19 <210> 33 <211> 27 <212> DNA <213> Artificial Sequence <400> 33 gagaaaggta gctatgaaat aatccaa 27 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 ggtgaaaggt cctcggagat 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <400> 35 tcccacagac ctcaatcaga 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <400> 36 ttcatgttct gaggaagggg 20 <210> 37 <211> twenty three <212> DNA <213> Artificial Sequence <400> 37 tttcctaaat tctgggaaca gtc 23 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <400> 38 cttgtggaaa ttcctccgaa 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 ccgtattctc tacatgccca 20 <210> 40 <211> twenty one <212> DNA <213> Artificial Sequence <400> 40 tccatttggt ggacttcaga t 21 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <400> 41 cataaggaca gcaacatgcc 20 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <400> 42 ccagtgtgatttaattaggagattaga 27 <210> 43 <211> 26 <212> DNA <213> Artificial Sequence <400> 43 aagcaggaattttaggattcttagag 26 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <400> 44 tcctgccaaa ccaaatatca 20 <210> 45 <211> 29 <212> DNA <213> Artificial Sequence <400> 45 gaagtctgaa gatatgagag atctacttt 29 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 tgtgaatgcc aaattaccca 20 <210> 47 <211> twenty one <212> DNA <213> Artificial Sequence <400> 47 ctcacttgag aaattgctgg g 21 <210> 48 <211> twenty two <212> DNA <213> Artificial Sequence <400> 48 cattgcaaga acaataacaa gg 22 <210> 49 <211> twenty one <212> DNA <213> Artificial Sequence <400> 49 tggaccccat gaaaatgtag t 21 <210> 50 <211> twenty two <212> DNA <213> Artificial Sequence <400> 50 cctcccaaat cttgattctt tg 22 <210> 51 <211> twenty one <212> DNA <213> Artificial Sequence <400> 51 tccttttgag ctctgtgctt t 21 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 gattgctttc tctttgccca 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 ccacatgtct tgatggctgt 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <400> 54 tcgatcagat tttcatggga 20 <210> 55 <211> twenty one <212> DNA <213> Artificial Sequence <400> 55 tctgcagtgc tactgaaaac a 21 <210> 56 <211> twenty one <212> DNA <213> Artificial Sequence <400> 56 tgaagaaaac aggaccgaaa a 21 <210> 57 <211> 18 <212> DNA <213> Artificial Sequence <400> 57 agctcggggc cagaatta 18 <210> 58 <211> twenty two <212> DNA <213> Artificial Sequence <400> 58 ttgagaagca agactgtcag ga 22 <210> 59 <211> 27 <212> DNA <213> Artificial Sequence <400> 59 gagatctcta tttgagaaag tggttta 27 <210> 60 <211> twenty three <212> DNA <213> Artificial Sequence <400> 60 tttctcccat gattctgtat ttg 23 <210> 61 <211> twenty two <212> DNA <213> Artificial Sequence <400> 61 ccttaccact ttcacaatct gc 22 <210> 62 <211> twenty one <212> DNA <213> Artificial Sequence <400> 62 aaaaggcaag catactcaat g 21 <210> 63 <211> 25 <212> DNA <213> Artificial Sequence <400> 63 tgagtatttc cacataatac ccttc 25 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <400> 64 accagcgata gttcccacac 20 <210> 65 <211> twenty two <212> DNA <213> Artificial Sequence <400> 65 tgtaatacat gttccatttg cc 22 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <400> 66 ccaacaaccc gagtgaagtc 20 <210> 67 <211> twenty one <212> DNA <213> Artificial Sequence <400> 67 ttgcctattc ctgtaaccag c 21 <210> 68 <211> twenty one <212> DNA <213> Artificial Sequence <400> 68 ttaaagagct agtggtgctg c 21 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <400> 69 actggacgaa cccttagtgc 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <400> 70 actggtccct tccacttcag 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <400> 71 tttcagctgg agtgctcctc 20 <210> 72 <211> twenty two <212> DNA <213> Artificial Sequence <400> 72 ggctctttgt ggaataaaca cc 22 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <400> 73 agggtaggaa gaaatgggg 19 <210> 74 <211> 26 <212> DNA <213> Artificial Sequence <400> 74 ggatgaaatt gtcatagata taagcg 26 <210> 75 <211> 25 <212> DNA <213> Artificial Sequence <400> 75 aaggaaaatt aactaccagg aactc 25 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <400> 76 ttaatgcctt ccactctggg 20 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <400> 77 gatcagagac ggaaagccc 19 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <400> 78 ttcagagtgc cattgtccag 20 <210> 79 <211> twenty one <212> DNA <213> Artificial Sequence <400> 79 tcaggaaatg taagtccagg g 21 <210> 80 <211> 17 <212> DNA <213> Artificial Sequence <400> 80 ggtgcctatg gcggaac 17 <210> 81 <211> 19 <212> DNA <213> Artificial Sequence <400> 81 gggctcagaa tctggcatc 19 <210> 82 <211> 17 <212> DNA <213> Artificial Sequence <400> 82 gaaggcttcc ccaaagg 17 <210> 83 <211> 18 <212> DNA <213> Artificial Sequence <400> 83 ccagcaaaga atggatgg 18 <210> 84 <211> 19 <212> DNA <213> Artificial Sequence <400> 84 acccgcagtg ccttcatag 19 <210> 85 <211> 19 <212> DNA <213> Artificial Sequence <400> 85 tgcagaccag tgggaagag 19 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <400> 86 agacagagtg ctcccattcc 20 <210> 87 <211> twenty four <212> DNA <213> Artificial Sequence <400> 87 aaaacgttgt ttaaaatgga aagc 24 <210> 88 <211> twenty two <212> DNA <213> Artificial Sequence <400> 88 gttcacacac aaagggagaa ac 22 <210> 89 <211> 25 <212> DNA <213> Artificial Sequence <400> 89 ttaaggatttttatgtctctgatcc 25 <210> 90 <211> 25 <212> DNA <213> Artificial Sequence <400> 90 aaaaactaaa tcagtcttgc agagc 25 <210> 91 <211> twenty two <212> DNA <213> Artificial Sequence <400> 91 ttacctgcat ttcaaaccac ag 22 <210> 92 <211> twenty three <212> DNA <213> Artificial Sequence <400> 92 tttattaaat acacatggtg ggg 23 <210> 93 <211> twenty three <212> DNA <213> Artificial Sequence <400> 93 tcagcatgtg atggttgtat ttc 23 <210> 94 <211> twenty two <212> DNA <213> Artificial Sequence <400> 94 ttatcattgt cattgtccca gg 22 <210> 95 <211> twenty three <212> DNA <213> Artificial Sequence <400> 95 ttgcagaggt aaaaagattc cag 23 <210> 96 <211> 18 <212> DNA <213> Artificial Sequence <400> 96 ttctgtttcc gcagggtg 18 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <400> 97 aaagaggtga catcgcatcc 20 <210> 98 <211> twenty three <212> DNA <213> Artificial Sequence <400> 98 agttcaccta agtcatggga gag 23 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <400> 99 aggatgagct tatgcctctg 20 <210> 100 <211> 19 <212> DNA <213> Artificial Sequence <400> 100 agtgggctct gaggtccag 19 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <400> 101 aacgctgatc tgctgtgttg 20 <210> 102 <211> 18 <212> DNA <213> Artificial Sequence <400> 102 cctgggattg gtgggaag 18 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <400> 103 ccaacattgc cttcttcctg 20 <210> 104 <211> twenty one <212> DNA <213> Artificial Sequence <400> 104 aactcagagg gaagagtgga c 21 <210> 105 <211> 17 <212> DNA <213> Artificial Sequence <400> 105 cttcctggcc ccattcc 17 <210> 106 <211> 17 <212> DNA <213> Artificial Sequence <400> 106 ttgtggccct gatggtg 17 <210> 107 <211> twenty two <212> DNA <213> Artificial Sequence <400> 107 gccttgactc tgagttgttt tg 22 <210> 108 <211> 18 <212> DNA <213> Artificial Sequence <400> 108 cctgggcttc tgaacagc 18 <210> 109 <211> twenty two <212> DNA <213> Artificial Sequence <400> 109 cctgtggaaa gactgagata gc 22 <210> 110 <211> 17 <212> DNA <213> Artificial Sequence <400> 110 ctggtccctg ctcccag 17 <210> 111 <211> 19 <212> DNA <213> Artificial Sequence <400> 111 ccgctaggtt tccatgtgc 19 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <400> 112 agagcagagt gaaggtgccc 20 <210> 113 <211> twenty two <212> DNA <213> Artificial Sequence <400> 113 cagcccttta ctgtgacact gc 22 <210> 114 <211> 19 <212> DNA <213> Artificial Sequence <400> 114 ggccttcaga ctccaaccg 19 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <400> 115 cacaccacct ggacacacac 20 <210> 116 <211> twenty one <212> DNA <213> Artificial Sequence <400> 116 cactgccatg acaaagtctg c 21 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <400> 117 atcatcccca caagccacac 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <400> 118 catggggatg ctgtctatgg 20 <210> 119 <211> 18 <212> DNA <213> Artificial Sequence <400> 119 accatcccca tggacacc 18 <210> 120 <211> 17 <212> DNA <213> Artificial Sequence <400> 120 gtgcggcaat gggaagc 17 <210> 121 <211> 17 <212> DNA <213> Artificial Sequence <400> 121 ctgttggcca tccgcag 17 <210> 122 <211> 19 <212> DNA <213> Artificial Sequence <400> 122 atgaaaggcg aagaggcag 19 <210> 123 <211> twenty three <212> DNA <213> Artificial Sequence <400> 123 ttttccaatt ttgaacacaa ctc 23 <210> 124 <211> twenty two <212> DNA <213> Artificial Sequence <400> 124 tctgcaataa atgggacaat tc 22 <210> 125 <211> twenty two <212> DNA <213> Artificial Sequence <400> 125 tgtttctttc caaagttaag cg 22 <210> 126 <211> twenty one <212> DNA <213> Artificial Sequence <400> 126 aaattccctc aaaacgacat c 21 <210> 127 <211> twenty two <212> DNA <213> Artificial Sequence <400> 127 ccactagcct ctaactgttc cc 22 <210> 128 <211> 30 <212> DNA <213> Artificial Sequence <400> 128 tctgttgata gatgtattaa agtggataac 30 <210> 129 <211> 20 <212> DNA <213> Artificial Sequence <400> 129 cttgtctgtt ttcctccccc 20 <210> 130 <211> 20 <212> DNA <213> Artificial Sequence <400> 130 gtgaagccac ctccgttctc 20 <210> 131 <211> twenty four <212> DNA <213> Artificial Sequence <400> 131 atctcctatg gaactttttc agac 24 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <400> 132 agtcttccaa aacgttcagc 20 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <400> 133 tgaatgttgg cactttggtc 20 <210> 134 <211> 20 <212> DNA <213> Artificial Sequence <400> 134 ttccagcaaa gggtaaatgg 20 <210> 135 <211> 19 <212> DNA <213> Artificial Sequence <400> 135 tcttggccca ggtcttacc 19 <210> 136 <211> 19 <212> DNA <213> Artificial Sequence <400> 136 gacttggtcc caatccctc 19 <210> 137 <211> 17 <212> DNA <213> Artificial Sequence <400> 137 ctgatgctcc ctgcccc 17 <210> 138 <211> 19 <212> DNA <213> Artificial Sequence <400> 138 cctcccacct taaccttgc 19 <210> 139 <211> 19 <212> DNA <213> Artificial Sequence <400> 139 ctggaggttg ggtgagacc 19 <210> 140 <211> 19 <212> DNA <213> Artificial Sequence <400> 140 cagcctccct agctccatc 19 <210> 141 <211> twenty one <212> DNA <213> Artificial Sequence <400> 141 ggggagaagt atttagggtg g 21 <210> 142 <211> 20 <212> DNA <213> Artificial Sequence <400> 142 gtgtagaagt ggaggcctgg 20 <210> 143 <211> 20 <212> DNA <213> Artificial Sequence <400> 143 tgtctcaatt ctctgtcccc 20 <210> 144 <211> 18 <212> DNA <213> Artificial Sequence <400> 144 tttgcaagga aggtctgc 18 <210> 145 <211> 19 <212> DNA <213> Artificial Sequence <400> 145 ggtgccaaac ctgatggtc 19 <210> 146 <211> 20 <212> DNA <213> Artificial Sequence <400> 146 ctaagctctg gggaacccac 20 <210> 147 <211> 19 <212> DNA <213> Artificial Sequence <400> 147 atagccaggg agcagccac 19 <210> 148 <211> 17 <212> DNA <213> Artificial Sequence <400> 148 gagaccatgg ggccagc 17 <210> 149 <211> 20 <212> DNA <213> Artificial Sequence <400> 149 ttgtgcattg tttcaaccac 20 <210> 150 <211> 19 <212> DNA <213> Artificial Sequence <400> 150 ccttccctgg agagacacc 19 <210> 151 <211> twenty four <212> DNA <213> Artificial Sequence <400> 151 gactatttcc aagctagcat ttcc 24 <210> 152 <211> 18 <212> DNA <213> Artificial Sequence <400> 152 gcattggaag ctggaggc 18 <210> 153 <211> twenty one <212> DNA <213> Artificial Sequence <400> 153 aatcctgcaa attgtcacca g 21 <210> 154 <211> twenty two <212> DNA <213> Artificial Sequence <400> 154 tgttgcatta gaaacagtcc ag 22 <210> 155 <211> 17 <212> DNA <213> Artificial Sequence <400> 155 atccagtgcc caggtgc 17 <210> 156 <211> twenty one <212> DNA <213> Artificial Sequence <400> 156 gagcctctgt gttctctggt g 21 <210> 157 <211> 19 <212> DNA <213> Artificial Sequence <400> 157 cggagctcag aagtcctcc 19 <210> 158 <211> 20 <212> DNA <213> Artificial Sequence <400> 158 ttgtagaggc cacaagggtc 20 <210> 159 <211> 17 <212> DNA <213> Artificial Sequence <400> 159 gcaggagcct gacgctg 17 <210> 160 <211> 17 <212> DNA <213> Artificial Sequence <400> 160 ccagagatcc cgagggg 17 <210> 161 <211> 17 <212> DNA <213> Artificial Sequence <400> 161 cttcagctgc gactgcc 17 <210> 162 <211> 20 <212> DNA <213> Artificial Sequence <400> 162 gattcctggg cgatgtattg 20 <210> 163 <211> 18 <212> DNA <213> Artificial Sequence <400> 163 aggcagccct gtgatgtc 18 <210> 164 <211> 17 <212> DNA <213> Artificial Sequence <400> 164 ctacccaggc ctctggc 17 <210> 165 <211> 20 <212> DNA <213> Artificial Sequence <400> 165 agaccatagt gcccatctgc 20 <210> 166 <211> 17 <212> DNA <213> Artificial Sequence <400> 166 aggtgccgtg gaaggag 17 <210> 167 <211> 17 <212> DNA <213> Artificial Sequence <400> 167 gcacaggctc gcagctc 17 <210> 168 <211> 20 <212> DNA <213> Artificial Sequence <400> 168 ggaagggaga agagacgcta 20 <210> 169 <211> twenty four <212> DNA <213> Artificial Sequence <400> 169 tgcattgagc tttctgtatt tctt 24 <210> 170 <211> twenty one <212> DNA <213> Artificial Sequence <400> 170 acagactgca tcaaagtggg a 21 <210> 171 <211> twenty two <212> DNA <213> Artificial Sequence <400> 171 actcataatc gagccactgt tt 22 <210> 172 <211> 29 <212> DNA <213> Artificial Sequence <400> 172 cacagtagat actcaataat gtttcacaa 29 <210> 173 <211> twenty three <212> DNA <213> Artificial Sequence <400> 173 tcaaaagtca ctcttaagca gca 23 <210> 174 <211> twenty two <212> DNA <213> Artificial Sequence <400> 174 tctttgaagg tcttcatggg ag 22 <210> 175 <211> 28 <212> DNA <213> Artificial Sequence <400> 175 gatgctaaaa gtcttggact aatattct 28 <210> 176 <211> twenty three <212> DNA <213> Artificial Sequence <400> 176 cccttcagct gttattgaaa cat 23 <210> 177 <211> twenty two <212> DNA <213> Artificial Sequence <400> 177 tgttaaccaa cgtgcttctg ta 22 <210> 178 <211> twenty two <212> DNA <213> Artificial Sequence <400> 178 aaggaagtac aggctggaaa tg 22 <210> 179 <211> 28 <212> DNA <213> Artificial Sequence <400> 179 tcagatcaag tatgtgtgtc tactctaa 28 <210> 180 <211> twenty four <212> DNA <213> Artificial Sequence <400> 180 ccatgggtgt actttaccta caga 24 <210> 181 <211> twenty two <212> DNA <213> Artificial Sequence <400> 181 cctgaaaagt tctctgcagg tt 22 <210> 182 <211> 29 <212> DNA <213> Artificial Sequence <400> 182 tctaactggg attattctca catagtaaa 29 <210> 183 <211> twenty two <212> DNA <213> Artificial Sequence <400> 183 gggatattaa agtttgtgtg cg 22 <210> 184 <211> twenty four <212> DNA <213> Artificial Sequence <400> 184 aaacaggtga gaagttaagc attg 24 <210> 185 <211> 20 <212> DNA <213> Artificial Sequence <400> 185 actatctcca cttgcccagc 20 <210> 186 <211> 19 <212> DNA <213> Artificial Sequence <400> 186 cacaaaaccc agtaggggc 19 <210> 187 <211> 20 <212> DNA <213> Artificial Sequence <400> 187 cggagaagaa ggcaactgag 20 <210> 188 <211> 20 <212> DNA <213> Artificial Sequence <400> 188 aggtgctcct aacaaggtgg 20 <210> 189 <211> twenty one <212> DNA <213> Artificial Sequence <400> 189 aagccaattg aatagcacag g 21 <210> 190 <211> 19 <212> DNA <213> Artificial Sequence <400> 190 aagtccctgg ggtctctcc 19 <210> 191 <211> 20 <212> DNA <213> Artificial Sequence <400> 191 gttgcccttc aaaggtgatg 20 <210> 192 <211> 19 <212> DNA <213> Artificial Sequence <400> 192 tcagactacc ttgcgggtg 19 <210> 193 <211> 20 <212> DNA <213> Artificial Sequence <400> 193 gcatttgagg aattgctgtg 20 <210> 194 <211> twenty four <212> DNA <213> Artificial Sequence <400> 194 tccatttata atgtgagatg gaag 24 <210> 195 <211> 20 <212> DNA <213> Artificial Sequence <400> 195 ccgacttcca caaggaaaac 20 <210> 196 <211> 20 <212> DNA <213> Artificial Sequence <400> 196 ggaaatcata cccatcgcag 20 <210> 197 <211> 20 <212> DNA <213> Artificial Sequence <400> 197 agctgactca tcgcctcttc 20 <210> 198 <211> 20 <212> DNA <213> Artificial Sequence <400> 198 tgttgtgggt ttgctgtgag 20 <210> 199 <211> 18 <212> DNA <213> Artificial Sequence <400> 199 caaggggaac ttcctcgc 18 <210> 200 <211> 17 <212> DNA <213> Artificial Sequence <400> 200 ccccagcatc tgggagc 17 <210> 201 <211> 20 <212> DNA <213> Artificial Sequence <400> 201 ctctgtgtgc tgacctccag 20 <210> 202 <211> 19 <212> DNA <213> Artificial Sequence <400> 202 ccaaggcact tcagacacc 19 <210> 203 <211> 17 <212> DNA <213> Artificial Sequence <400> 203 gtcctgtgcc cctctgc 17 <210> 204 <211> 20 <212> DNA <213> Artificial Sequence <400> 204 gttgttgtct cccgtaaccc 20 <210> 205 <211> 18 <212> DNA <213> Artificial Sequence <400> 205 gagccgatct gggaggag 18 <210> 206 <211> 17 <212> DNA <213> Artificial Sequence <400> 206 cagggatcgc attgcac 17 <210> 207 <211> 18 <212> DNA <213> Artificial Sequence <400> 207 atgtgcgaga ccggctac 18 <210> 208 <211> 19 <212> DNA <213> Artificial Sequence <400> 208 acagctagcc tgggtgttg 19 <210> 209 <211> 18 <212> DNA <213> Artificial Sequence <400> 209 actgtgactc cggcaagg 18 <210> 210 <211> 19 <212> DNA <213> Artificial Sequence <400> 210 tttggtagca aagctgggg 19 <210> 211 <211> 20 <212> DNA <213> Artificial Sequence <400> 211 aggcagtttc ctgctccttg 20 <210> 212 <211> 20 <212> DNA <213> Artificial Sequence <400> 212 aggcaacagg cttcttcagc 20 <210> 213 <211> 20 <212> DNA <213> Artificial Sequence <400> 213 tggctgggct atgagctatg 20 <210> 214 <211> 18 <212> DNA <213> Artificial Sequence <400> 214 gatgtgttca ccaggccc 18 <210> 215 <211> 20 <212> DNA <213> Artificial Sequence <400> 215 atggccaaga ctgcctgttc 20 <210> 216 <211> 20 <212> DNA <213> Artificial Sequence <400> 216 ctagagttgg gcccggtctg 20 <210> 217 <211> 20 <212> DNA <213> Artificial Sequence <400> 217 accctgactc cagctcatcc 20 <210> 218 <211> 19 <212> DNA <213> Artificial Sequence <400> 218 acccacccct gagctcttc 19 <210> 219 <211> 20 <212> DNA <213> Artificial Sequence <400> 219 gtacctcaag cccaacagcc 20 <210> 220 <211> 17 <212> DNA <213> Artificial Sequence <400> 220 tgccaggccc catgaag 17 <210> 221 <211> 17 <212> DNA <213> Artificial Sequence <400> 221 cctggcggtg accacac 17 <210> 222 <211> 19 <212> DNA <213> Artificial Sequence <400> 222 ttgtccctgc aactcaggc 19 <210> 223 <211> 18 <212> DNA <213> Artificial Sequence <400> 223 gctggtggcc aggacttg 18 <210> 224 <211> 18 <212> DNA <213> Artificial Sequence <400> 224 gtccagcagc acacctgc 18 <210> 225 <211> 17 <212> DNA <213> Artificial Sequence <400> 225 aggtcctggg gtggtgg 17 <210> 226 <211> 19 <212> DNA <213> Artificial Sequence <400> 226 ctctagagaa gcccacccg 19 <210> 227 <211> 20 <212> DNA <213> Artificial Sequence <400> 227 agttcaacca ggggaaacct 20 <210> 228 <211> twenty three <212> DNA <213> Artificial Sequence <400> 228 ggagacctaa catgttctag cca 23 <210> 229 <211> 20 <212> DNA <213> Artificial Sequence <400> 229 gcccttttgt tggcatagac 20 <210> 230 <211> 20 <212> DNA <213> Artificial Sequence <400> 230 caaggtgtcc tcatgcctct 20 <210> 231 <211> twenty one <212> DNA <213> Artificial Sequence <400> 231 tgtcttttcc cagacttcca g 21 <210> 232 <211> 20 <212> DNA <213> Artificial Sequence <400> 232 tgatgagttt cggaatgacc 20 <210> 233 <211> 17 <212> DNA <213> Artificial Sequence <400> 233 tcggtcagat gcccctt 17 <210> 234 <211> 18 <212> DNA <213> Artificial Sequence <400> 234 ggctggggtc tggagaaa 18 <210> 235 <211> 19 <212> DNA <213> Artificial Sequence <400> 235 gagatgcccc tctttgcag 19 <210> 236 <211> twenty one <212> DNA <213> Artificial Sequence <400> 236 tgaccaaggt ctggataagg a 21 <210> 237 <211> 26 <212> DNA <213> Artificial Sequence <400> 237 gatggtacag attacattga gatcat 26 <210> 238 <211> twenty three <212> DNA <213> Artificial Sequence <400> 238 cagcagtaat ggaaaaatga gaa 23 <210> 239 <211> 20 <212> DNA <213> Artificial Sequence <400> 239 actgccctag ctctggagaa 20 <210> 240 <211> 20 <212> DNA <213> Artificial Sequence <400> 240 aggagaacct gtgctttgct 20 <210> 241 <211> 20 <212> DNA <213> Artificial Sequence <400> 241 agccaagaca ctggttctcc 20 <210> 242 <211> 18 <212> DNA <213> Artificial Sequence <400> 242 gggtgctttc tccccaag 18 <210> 243 <211> twenty four <212> DNA <213> Artificial Sequence <400> 243 ggatggagga aagagtagac tgaa 24 <210> 244 <211> 20 <212> DNA <213> Artificial Sequence <400> 244 aagacctgga ggacagcttg 20 <210> 245 <211> twenty one <212> DNA <213> Artificial Sequence <400> 245 gaccctgatc aaatgcactc t 21 <210> 246 <211> 20 <212> DNA <213> Artificial Sequence <400> 246 tggagaaagg gttgtatggc 20 <210> 247 <211> 25 <212> DNA <213> Artificial Sequence <400> 247 gcttaagtac atttgtggat cattc 25 <210> 248 <211> 19 <212> DNA <213> Artificial Sequence <400> 248 cctgatcgct cagtggcat 19 <210> 249 <211> twenty two <212> DNA <213> Artificial Sequence <400> 249 gaaattcctg agaaagaggc aa 22 <210> 250 <211> 20 <212> DNA <213> Artificial Sequence <400> 250 ctccaagaac ttcgggactt 20 <210> 251 <211> twenty three <212> DNA <213> Artificial Sequence <400> 251 cctctctgtg tcaacagatt ttt 23 <210> 252 <211> 19 <212> DNA <213> Artificial Sequence <400> 252 gggacctctt cccattacc 19 <210> 253 <211> twenty four <212> DNA <213> Artificial Sequence <400> 253 tccctaacca tggagtttta cttt 24 <210> 254 <211> 20 <212> DNA <213> Artificial Sequence <400> 254 ggggtaccat tcacagacca 20 <210> 255 <211> twenty one <212> DNA <213> Artificial Sequence <400> 255 aggcagtgtg tgacttgttg a 21 <210> 256 <211> 27 <212> DNA <213> Artificial Sequence <400> 256 agtcataata attctaggcc aagtcta 27 <210> 257 <211> 20 <212> DNA <213> Artificial Sequence <400> 257 tgcagggaat attggtgtgt 20 <210> 258 <211> 20 <212> DNA <213> Artificial Sequence <400> 258 gccctaagag aacaccatgc 20 <210> 259 <211> twenty three <212> DNA <213> Artificial Sequence <400> 259 ccttagccat ttatgttgtc att 23 <210> 260 <211> 20 <212> DNA <213> Artificial Sequence <400> 260 tctcttccag gggtttttga 20 <210> 261 <211> twenty one <212> DNA <213> Artificial Sequence <400> 261 gcctttgatg accctgaata c 21 <210> 262 <211> 25 <212> DNA <213> Artificial Sequence <400> 262 aaagacttag acattttccc ttttc 25 <210> 263 <211> 20 <212> DNA <213> Artificial Sequence <400> 263 ccaggccgag aatacaccta 20 <210> 264 <211> 20 <212> DNA <213> Artificial Sequence <400> 264 tgttgaatct tttggtgggg 20 <210> 265 <211> 18 <212> DNA <213> Artificial Sequence <400> 265 ttggcctgtg tctctccc 18 <210> 266 <211> 20 <212> DNA <213> Artificial Sequence <400> 266 tgcggtagtg gatgtagcac 20 <210> 267 <211> twenty two <212> DNA <213> Artificial Sequence <400> 267 ggatatgcat ttcaatcaac ca 22 <210> 268 <211> 20 <212> DNA <213> Artificial Sequence <400> 268 tttgcccagt ggtatgaacc 20 <210> 269 <211> twenty four <212> DNA <213> Artificial Sequence <400> 269 ttgtcatgat caaccttaaa tcct 24 <210> 270 <211> 26 <212> DNA <213> Artificial Sequence <400> 270 tctcagaagt tactagttgg attcag 26 <210> 271 <211> twenty four <212> DNA <213> Artificial Sequence <400> 271 gaaattggct ttcagattat ttgg 24 <210> 272 <211> twenty three <212> DNA <213> Artificial Sequence <400> 272 ctgcatctga agggtattat gtg 23 <210> 273 <211> twenty three <212> DNA <213> Artificial Sequence <400> 273 gaaatgcatg ttaaatgatg ctg 23 <210> 274 <211> 26 <212> DNA <213> Artificial Sequence <400> 274 tgctgaagtt tcagatacag attttc 26 <210> 275 <211> 19 <212> DNA <213> Artificial Sequence <400> 275 tctaagctca cccgtgctg 19 <210> 276 <211> 20 <212> DNA <213> Artificial Sequence <400> 276 ccagctgagc tccagttttg 20 <210> 277 <211> 26 <212> DNA <213> Artificial Sequence <400> 277 tctgtgtatg tgaaatactg tttgtg 26 <210> 278 <211> 20 <212> DNA <213> Artificial Sequence <400> 278 tccccagcca cttacatagc 20 <210> 279 <211> 19 <212> DNA <213> Artificial Sequence <400> 279 gaccgagcca catgtcttc 19 <210> 280 <211> twenty one <212> DNA <213> Artificial Sequence <400> 280 tgagaggccc tgttaatttt c 21 <210> 281 <211> 20 <212> DNA <213> Artificial Sequence <400> 281 ggctaacatt gctgttgctc 20 <210> 282 <211> 20 <212> DNA <213> Artificial Sequence <400> 282 gggaaggaat ctcctgcttc 20 <210> 283 <211> twenty four <212> DNA <213> Artificial Sequence <400> 283 cactcagcag ctacttcaat aacc 24 <210> 284 <211> 18 <212> DNA <213> Artificial Sequence <400> 284 acatctggga ccacagcc 18 <210> 285 <211> twenty three <212> DNA <213> Artificial Sequence <400> 285 ttccctctag agataggcaa cac 23 <210> 286 <211> 19 <212> DNA <213> Artificial Sequence <400> 286 ctcccaggtt tccaggttg 19 <210> 287 <211> 20 <212> DNA <213> Artificial Sequence <400> 287 gggagcccta gacctggtag 20 <210> 288 <211> twenty three <212> DNA <213> Artificial Sequence <400> 288 ccagaggtga ccttctcttt acc 23 <210> 289 <211> 20 <212> DNA <213> Artificial Sequence <400> 289 agtggtgacc tccgaagatg 20 <210> 290 <211> twenty four <212> DNA <213> Artificial Sequence <400> 290 tcgtgctact agtaaattgt ttgc 24 <210> 291 <211> twenty three <212> DNA <213> Artificial Sequence <400> 291 tgagaataac ttcttccaac cag 23 <210> 292 <211> twenty one <212> DNA <213> Artificial Sequence <400> 292 gcctagccag aattctcctt c 21 <210> 293 <211> 20 <212> DNA <213> Artificial Sequence <400> 293 aattagagga ctgggctggg 20 <210> 294 <211> twenty three <212> DNA <213> Artificial Sequence <400> 294 tgttattcct tgggtcatag gag 23 <210> 295 <211> twenty two <212> DNA <213> Artificial Sequence <400> 295 cagtgctgac actacaaggc tc 22 <210> 296 <211> twenty two <212> DNA <213> Artificial Sequence <400> 296 cagctttcca ttttaaacaa cg 22 <210> 297 <211> 25 <212> DNA <213> Artificial Sequence <400> 297 cccctaaatc attcctattt aattc 25 <210> 298 <211> twenty two <212> DNA <213> Artificial Sequence <400> 298 gaagctttgc aagtccattg tc 22 <210> 299 <211> 26 <212> DNA <213> Artificial Sequence <400> 299 cataaatatc atctggcact tgtaac 26 <210> 300 <211> 29 <212> DNA <213> Artificial Sequence <400> 300 cagagacata aaaatcctta agcaaatag 29 <210> 301 <211> twenty three <212> DNA <213> Artificial Sequence <400> 301 gattcaggtc cacattgtat tcc 23 <210> 302 <211> twenty two <212> DNA <213> Artificial Sequence <400> 302 ctgtgccagc cttgaaaaat ag 22 <210> 303 <211> twenty four <212> DNA <213> Artificial Sequence <400> 303 gaaccagtgc tctgtatttt tgac 24 <210> 304 <211> 19 <212> DNA <213> Artificial Sequence <400> 304 gtgcacattc caggcaatc 19 <210> 305 <211> twenty two <212> DNA <213> Artificial Sequence <400> 305 taacatatgc ctacttcgct gg 22 <210> 306 <211> twenty two <212> DNA <213> Artificial Sequence <400> 306 tccacttcca gtttcaaaga ac 22 <210> 307 <211> 20 <212> DNA <213> Artificial Sequence <400> 307 acagtgcctt cctgaccatc 20 <210> 308 <211> 20 <212> DNA <213> Artificial Sequence <400> 308 aaatccaccc aggacaagac 20 <210> 309 <211> 17 <212> DNA <213> Artificial Sequence <400> 309 caccctggtc cccacag 17 <210> 310 <211> 20 <212> DNA <213> Artificial Sequence <400> 310 gcctctccta ccacaagcac 20 <210> 311 <211> twenty two <212> DNA <213> Artificial Sequence <400> 311 aaataaaatg ctggcctatt tg 22 <210> 312 <211> 20 <212> DNA <213> Artificial Sequence <400> 312 gtcccacata cactccgctc 20 <210> 313 <211> twenty two <212> DNA <213> Artificial Sequence <400> 313 aaaatgtgcc ccaaataatg tc 22 <210> 314 <211> 20 <212> DNA <213> Artificial Sequence <400> 314 agggcacaga aagtctagcg 20 <210> 315 <211> 20 <212> DNA <213> Artificial Sequence <400> 315 gcaggtccag ttctctcacc 20 <210> 316 <211> twenty two <212> DNA <213> Artificial Sequence <400> 316 tgccttgctg agtaagaaaa tc 22 <210> 317 <211> 20 <212> DNA <213> Artificial Sequence <400> 317 ctggagggag gctgaatagc 20 <210> 318 <211> 20 <212> DNA <213> Artificial Sequence <400> 318 atggagatgg tcagaggcag 20 <210> 319 <211> twenty one <212> DNA <213> Artificial Sequence <400> 319 ggcagatcat agcaagggat g 21 <210> 320 <211> 20 <212> DNA <213> Artificial Sequence <400> 320 ccaactcagc tctgccattg 20 <210> 321 <211> 20 <212> DNA <213> Artificial Sequence <400> 321 gcaggatgca atgactcagc 20 <210> 322 <211> 30 <212> DNA <213> Artificial Sequence <400> 322 gtacatagat gagacaaata ccactgtatg 30 <210> 323 <211> 27 <212> DNA <213> Artificial Sequence <400> 323 tgtctgttct tgaaactatt ttgatcc 27 <210> 324 <211> twenty two <212> DNA <213> Artificial Sequence <400> 324 cctcctcctc attttctcct tc 22 <210> 325 <211> 25 <212> DNA <213> Artificial Sequence <400> 325 tgttacatga tgataggcac ttttc 25 <210> 326 <211> 18 <212> DNA <213> Artificial Sequence <400> 326 aggagggcct tgtggaag 18 <210> 327 <211> 28 <212> DNA <213> Artificial Sequence <400> 327 ttctcataat aataattcca gtgacctc 28 <210> 328 <211> 20 <212> DNA <213> Artificial Sequence <400> 328 catggcaaca gtgaccttgg 20 <210> 329 <211> 19 <212> DNA <213> Artificial Sequence <400> 329 cgaggcccag gtaaaggac 19 <210> 330 <211> 25 <212> DNA <213> Artificial Sequence <400> 330 gctgcatctt cagtatgaaa gtagg 25 <210> 331 <211> 20 <212> DNA <213> Artificial Sequence <400> 331 attcagcttg ctcgtcattg 20 <210> 332 <211> twenty three <212> DNA <213> Artificial Sequence <400> 332 aaaatcacat aacacacaaa cgc 23 <210> 333 <211> twenty four <212> DNA <213> Artificial Sequence <400> 333 cagttgtcag taaaagttaa gggg 24 <210> 334 <211> twenty three <212> DNA <213> Artificial Sequence <400> 334 cagatgcaga aaaatattgg gtc 23 <210> 335 <211> 28 <212> DNA <213> Artificial Sequence <400> 335 attgtacagg ttaactaagtc tctgtagg 28 <210> 336 <211> twenty two <212> DNA <213> Artificial Sequence <400> 336 gggaacagtt agaggctagt gg 22 <210> 337 <211> 29 <212> DNA <213> Artificial Sequence <400> 337 aaattttgag tcctagaatc ttagatatg 29 <210> 338 <211> twenty three <212> DNA <213> Artificial Sequence <400> 338 aggtgttcag atttgaaaca atg 23 <210> 339 <211> 26 <212> DNA <213> Artificial Sequence <400> 339 ctgaatagta gtcataaaat ggatcg 26 <210> 340 <211> twenty two <212> DNA <213> Artificial Sequence <400> 340 ttcccaataa aacacacctc ac 22 <210> 341 <211> twenty two <212> DNA <213> Artificial Sequence <400> 341 ctttccgcta gtggtagaag ag 22 <210> 342 <211> 20 <212> DNA <213> Artificial Sequence <400> 342 gcaacacaga gactcaagcg 20 <210> 343 <211> 17 <212> DNA <213> Artificial Sequence <400> 343 cacgcactct gggcctg 17 <210> 344 <211> 19 <212> DNA <213> Artificial Sequence <400> 344 gcactgcaac atgctcctc 19 <210> 345 <211> 20 <212> DNA <213> Artificial Sequence <400> 345 cttaggtgtc tgcgaaaggg 20 <210> 346 <211> 19 <212> DNA <213> Artificial Sequence <400> 346 gctaggtgct gggtgtttg 19 <210> 347 <211> 20 <212> DNA <213> Artificial Sequence <400> 347 agagccctgt taatcttgcc 20 <210> 348 <211> 20 <212> DNA <213> Artificial Sequence <400> 348 cagcactgtg gaggaggaag 20 <210> 349 <211> 20 <212> DNA <213> Artificial Sequence <400> 349 acggatggta tttctcctgg 20 <210> 350 <211> 20 <212> DNA <213> Artificial Sequence <400> 350 cagaacccag agtgtagggg 20 <210> 351 <211> 20 <212> DNA <213> Artificial Sequence <400> 351 gcctctcctg actgtcatcc 20 <210> 352 <211> 18 <212> DNA <213> Artificial Sequence <400> 352 ggagcttatg ggctctcc 18 <210> 353 <211> 19 <212> DNA <213> Artificial Sequence <400> 353 caaagacaac gatgctgcc 19 <210> 354 <211> 17 <212> DNA <213> Artificial Sequence <400> 354 tctggggatc tctgggc 17 <210> 355 <211> 17 <212> DNA <213> Artificial Sequence <400> 355 cctgacctct gggcacc 17 <210> 356 <211> 18 <212> DNA <213> Artificial Sequence <400> 356 gaaccagggt ccccactc 18 <210> 357 <211> 17 <212> DNA <213> Artificial Sequence <400> 357 tgtagccctg tcccagc 17 <210> 358 <211> 20 <212> DNA <213> Artificial Sequence <400> 358 gcacaacaga caggtaagcc 20 <210> 359 <211> 20 <212> DNA <213> Artificial Sequence <400> 359 cagtcacctg ccttcttgtc 20 <210> 360 <211> 19 <212> DNA <213> Artificial Sequence <400> 360 aggcctgtgg tttgtggtg 19 <210> 361 <211> 19 <212> DNA <213> Artificial Sequence <400> 361 cctcctcctg ctcaggtcc 19 <210> 362 <211> 17 <212> DNA <213> Artificial Sequence <400> 362 atgtgaggcc cacctgc 17 <210> 363 <211> 20 <212> DNA <213> Artificial Sequence <400> 363 tccgatattc gctgagaagg 20 <210> 364 <211> 20 <212> DNA <213> Artificial Sequence <400> 364 ataaattgaa gcacgcggag 20 <210> 365 <211> 25 <212> DNA <213> Artificial Sequence <400> 365 tcagactgta aagaactgac gattg 25 <210> 366 <211> 17 <212> DNA <213> Artificial Sequence <400> 366 tcagtgccat tgcgtgc 17 <210> 367 <211> 20 <212> DNA <213> Artificial Sequence <400> 367 gcaggtcctg aatgtgactg 20 <210> 368 <211> 20 <212> DNA <213> Artificial Sequence <400> 368 tccggttgtg ttgttcattc 20 <210> 369 <211> 18 <212> DNA <213> Artificial Sequence <400> 369 ctcttaggcc cctccacc 18 <210> 370 <211> 20 <212> DNA <213> Artificial Sequence <400> 370 ctgagcctca tcctctggac 20 <210> 371 <211> 17 <212> DNA <213> Artificial Sequence <400> 371 atctctggcc gctgacc 17 <210> 372 <211> 18 <212> DNA <213> Artificial Sequence <400> 372 ggaagctcac ctctgcgg 18 <210> 373 <211> 17 <212> DNA <213> Artificial Sequence <400> 373 gcccctcacc acctctg 17 <210> 374 <211> 17 <212> DNA <213> Artificial Sequence <400> 374 acccagcacg tgagcag 17 <210> 375 <211> 19 <212> DNA <213> Artificial Sequence <400> 375 aaagtgccac tggggagag 19 <210> 376 <211> 19 <212> DNA <213> Artificial Sequence <400> 376 ctctcggctg ctgtggtag 19 <210> 377 <211> 18 <212> DNA <213> Artificial Sequence <400> 377 agaacatgct gtgtgcgg 18 <210> 378 <211> 17 <212> DNA <213> Artificial Sequence <400> 378 catgcaaaag cccagcc 17 <210> 379 <211> twenty three <212> DNA <213> Artificial Sequence <400> 379 cctgtgcatt ttgattttct tgt 23 <210> 380 <211> twenty one <212> DNA <213> Artificial Sequence <400> 380 cttttcggcc acttttcttc t 21 <210> 381 <211> twenty four <212> DNA <213> Artificial Sequence <400> 381 cccagtattt caaatgacat gtag 24 <210> 382 <211> twenty two <212> DNA <213> Artificial Sequence <400> 382 acagacaaaa ggaactcatc ca 22 <210> 383 <211> twenty two <212> DNA <213> Artificial Sequence <400> 383 gtgcattgat catgcttctg tt 22 <210> 384 <211> twenty two <212> DNA <213> Artificial Sequence <400> 384 ggagattgtg ccaaacactt ta 22 <210> 385 <211> twenty two <212> DNA <213> Artificial Sequence <400> 385 tcggatacag gccctaagtc ta 22 <210> 386 <211> twenty two <212> DNA <213> Artificial Sequence <400> 386 atgttccctt ctgatgcttt tt 22 <210> 387 <211> twenty three <212> DNA <213> Artificial Sequence <400> 387 ccgtttattc tctgtagtga tgg 23 <210> 388 <211> twenty three <212> DNA <213> Artificial Sequence <400> 388 tcaatatcaa gcaacagact gga 23 <210> 389 <211> 30 <212> DNA <213> Artificial Sequence <400> 389 cctaagtatc ttactggctt aattttattg 30 <210> 390 <211> twenty two <212> DNA <213> Artificial Sequence <400> 390 aagaaccgtt ccaaatttct ca 22 <210> 391 <211> twenty two <212> DNA <213> Artificial Sequence <400> 391 ttcattggtt ctaggcttca gg 22 <210> 392 <211> twenty two <212> DNA <213> Artificial Sequence <400> 392 gcagagaact tttcaggaga cc 22 <210> 393 <211> twenty two <212> DNA <213> Artificial Sequence <400> 393 ttggtagtgt ctgctggtat gg 22 <210> 394 <211> twenty two <212> DNA <213> Artificial Sequence <400> 394 caccctctcc accatcagta at 22 <210> 395 <211> 19 <212> DNA <213> Artificial Sequence <400> 395 ctaggggttg cagcctagc 19 <210> 396 <211> 20 <212> DNA <213> Artificial Sequence <400> 396 agaaagtggt agcaaagcgg 20 <210> 397 <211> 17 <212> DNA <213> Artificial Sequence <400> 397 cccaccaaac ccaccac 17 <210> 398 <211> 20 <212> DNA <213> Artificial Sequence <400> 398 actcggaggt caggggtaac 20 <210> 399 <211> 26 <212> DNA <213> Artificial Sequence <400> 399 cctcctatga atgtttgtgt tcttac 26 <210> 400 <211> 19 <212> DNA <213> Artificial Sequence <400> 400 cacctctggg gtgagttcc 19 <210> 401 <211> 20 <212> DNA <213> Artificial Sequence <400> 401 gaagccaact ttctcccatc 20 <210> 402 <211> twenty one <212> DNA <213> Artificial Sequence <400> 402 gctgttcatg catctccttt c 21 <210> 403 <211> twenty one <212> DNA <213> Artificial Sequence <400> 403 tgttttccct cccagcttta g 21 <210> 404 <211> 20 <212> DNA <213> Artificial Sequence <400> 404 agagtctgtc ggggaaactg 20 <210> 405 <211> 20 <212> DNA <213> Artificial Sequence <400> 405 cgctttcaac ctctaccgag 20 <210> 406 <211> twenty three <212> DNA <213> Artificial Sequence <400> 406 ctttagtttt gaagtcaagc agg 23 <210> 407 <211> twenty two <212> DNA <213> Artificial Sequence <400> 407 ctcataacag cctcttcctg tg 22 <210> 408 <211> 18 <212> DNA <213> Artificial Sequence <400> 408 ttagcatgct gatgcccc 18 <210> 409 <211> twenty one <212> DNA <213> Artificial Sequence <400> 409 tgtggttcaa taaaactggg c 21 <210> 410 <211> 17 <212> DNA <213> Artificial Sequence <400> 410 gctgaggcag accctgg 17 <210> 411 <211> 20 <212> DNA <213> Artificial Sequence <400> 411 ctgccgatgt catttccttg 20 <210> 412 <211> 17 <212> DNA <213> Artificial Sequence <400> 412 cagtggcctg caggtgg 17 <210> 413 <211> 20 <212> DNA <213> Artificial Sequence <400> 413 ttacagctaa tgtgcaccgc 20 <210> 414 <211> 20 <212> DNA <213> Artificial Sequence <400> 414 ggtagcagtg gcactcgaag 20 <210> 415 <211> 20 <212> DNA <213> Artificial Sequence <400> 415 tagctacctc tgcgtctgcg 20 <210> 416 <211> 17 <212> DNA <213> Artificial Sequence <400> 416 gcctatgagc aagcccg 17 <210> 417 <211> 45 <212> DNA <213> Artificial Sequence <400> 417 aatgatacgg cgaccaccga gatctacact ctttccctac acgac 45 <210> 418 <211> 53 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (25)..(32) <223> n is a, c, g, or t <400> 418 caagcagaag acggcatacg agatnnnnnn nngtgactgg agttcagacg tgt <210> 419 <211> 32 <212> DNA <213> Artificial Sequence <400> 419 cactctttcc ctacacgacg ctcttccgat ct <210> 420 <211> 33 <212> DNA <213> Artificial Sequence <400> 420 tgactggagt tcagacgtgt gctcttccga tct
Claims
1. A test kit for hereditary thrombophilia, characterized in that, Including reagents for detecting mutations in F2, F5, F9, FGA, FGG, HABP2, HRG, LMAN1, MTHFR, PROC, PROS1, PROZ, SERPINC1, SERPIND1, and THBD genes; The reagent includes primers for amplifying the hereditary thrombotic susceptibility gene, the primers including a first round of specific primers and a second round of universal primers; The nucleotide sequences of the second round of universal primers are shown in SEQ ID NO.417-SEQ ID NO.418; The first round of specific primers includes the following A and B groups of amplification primers: Amplification primers of group A (nucleotide sequence as shown in SEQ ID NO. 1-SEQ ID NO. 16) and amplification primers of group B (nucleotide sequence as shown in SEQ ID NO. 211-SEQ ID NO. 224) are used for the F2 gene. Amplification primers of group A (SEQ ID NO. 17-SEQ ID NO. 60) and amplification primers of group B (SEQ ID NO. 225-SEQ ID NO. 270) are used for the nucleotide sequence of the F5 gene. Amplification primers of group A (SEQ ID NO. 61-SEQ ID NO. 70) and amplification primers of group B (SEQ ID NO. 271-SEQ ID NO. 280) are used for the nucleotide sequence of the F9 gene. Amplification primers of group A (SEQ ID NO. 71-SEQ ID NO. 86) and amplification primers of group B (SEQ ID NO. 281-SEQ ID NO. 294) are used for the nucleotide sequence of the FGA gene. Amplification primers of group A (SEQ ID NO. 87-SEQ ID NO. 96) and amplification primers of group B (SEQ ID NO. 295-SEQ ID NO. 306) are used for the nucleotide sequence of the FGG gene. Amplification primers of group A (SEQ ID NO. 97-SEQ ID NO. 110) and amplification primers of group B (SEQ ID NO. 307-SEQ ID NO. 318) are used for the nucleotide sequence of the HABP2 gene. Amplification primers of group A (SEQ ID NO. 111-SEQ ID NO. 120) and / or amplification primers of group B (SEQ ID NO. 319-SEQ ID NO. 330) targeting the HRG gene nucleotide sequence, Amplification primers of group A (SEQ ID NO. 121-SEQ ID NO. 134) and amplification primers of group B (SEQ ID NO. 331-SEQ ID NO. 342) are used for the LMAN1 gene nucleotide sequence. Amplification primers of group A (SEQ ID NO. 135-SEQ ID NO. 146) and amplification primers of group B (SEQ ID NO. 343-SEQ ID NO. 356) are used for the MTHFR gene nucleotide sequence. Amplification primers of group A (SEQ ID NO. 147-SEQ ID NO. 156) and amplification primers of group B (SEQ ID NO. 357-SEQ ID NO. 368) are used for the PROZ gene nucleotide sequence. Amplification primers of group A (SEQ ID NO. 157-SEQ ID NO. 166) and amplification primers of group B (SEQ ID NO. 369-SEQ ID NO. 378) are used for the nucleotide sequence of the PROC gene. Amplification primers of group A (SEQ ID NO. 167-SEQ ID NO. 184) and amplification primers of group B (SEQ ID NO. 379-SEQ ID NO. 394) are used for the nucleotide sequence of the PROS1 gene. Amplification primers of group A (SEQ ID NO. 185-SEQ ID NO. 194) and amplification primers of group B (SEQ ID NO. 395-SEQ ID NO. 402) are used for the nucleotide sequence of the SERPINC1 gene. Amplification primers of group A (SEQ ID NO. 195-SEQ ID NO. 202) and / or amplification primers of group B (SEQ ID NO. 403-SEQ ID NO. 410) targeting the SERPIND1 gene nucleotide sequence, and The nucleotide sequences of the THBD gene are shown in Group A amplification primers as shown in SEQ ID NO.203-SEQ ID NO.210, and the nucleotide sequences of the THBD gene are shown in Group B amplification primers as shown in SEQ ID NO.411-SEQ ID NO.
416.
2. A method for constructing a sequencing library of hereditary thrombophilia, characterized in that, Includes the following steps: Obtain DNA from the biological sample to be tested; Using the DNA of the biological sample to be tested as a template, PCR amplification was performed using the first round of specific primers and the second round of universal primers as described in claim 1 to obtain a multi-gene sequencing library of hereditary thrombotic susceptibility.
3. The database construction method according to claim 2, characterized in that, The PCR amplification was as follows: Using the A and B groups of primers in the first round of amplification primers in the hereditary thrombotic susceptibility detection kit of claim 1, the genomic DNA of the sample to be tested is amplified respectively to obtain the A and B groups of amplification products; The two sets of amplification products were mixed and purified, and then used as templates for the second round of amplification. The amplification was performed using the second round of universal primers.
4. The method for constructing a sequencing library according to claim 3, characterized in that, The mixing ratio of the amplification products of groups A and B is 1:1 to 3.
Citation Information
Patent Citations
Detection kit for Thrombophilia-related gene mutation
CN107012238A
Probe set and kit for detecting whole exons of extended genetic diseases and application of probe set
CN110499364A
Multiplex PCR (polymerase chain reaction) detection method and kit for thrombophilia gene mutation
CN114369657A