A gene editing system for constructing a porcine nuclear transplantation donor cell model of atherosclerosis with double AF gene mutations and its application.

Abstract

This invention discloses a gene editing system for constructing a porcine nuclear transplantation donor cell model of atherosclerosis with double gene mutations in AF and its applications. The invention provides a kit comprising plasmid pKG-U6gRNA (APOE-E2-gRNA2), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 25 (FBN1-gRNA4), a target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 26 (FBN1-gRNA6), and FBN1-mutant-ss163 as shown in SEQ ID NO: 27. The kit is used for: preparing recombinant cells; preparing porcine atherosclerosis models; preparing atherosclerosis cell models, atherosclerosis tissue models, or atherosclerosis organ models. The plasmid pKG-U6gRNA (APOE-E2-gRNA2) is transcribed to obtain sgRNA with a target sequence binding region as shown in nucleotides 1-20 of SEQ ID NO: 11. APOE‑E2‑gRNA2 This invention lays the foundation for developing pig models of atherosclerosis through somatic cell nuclear transfer animal cloning technology.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, specifically to the technical field of gene editing, and more specifically relates to a gene editing system for constructing an AF double-gene mutation atherosclerosis model pig nuclear transfer donor cell and application thereof. BACKGROUND

[0002] Cardiovascular disease is the leading cause of death among all diseases in China. According to reports, cardiovascular disease deaths account for more than 40% of the composition of residents' disease deaths, much higher than cancer and other diseases. Atherosclerosis is the main cause of coronary heart disease, cerebral infarction and peripheral vascular disease. Abnormal lipid metabolism and inflammatory response are the main pathological basis of atherosclerosis.

[0003] Apolipoprotein E (APOE) is a major apolipoprotein protein that can bind to receptors on liver cells or surrounding cells. Defects in the APOE gene can lead to elevated serum cholesterol and triglycerides due to the inability of chylomicrons and very low-density lipoproteins to be normally cleared. Fibrillin-1 is the main structural component of microfibers, which provides a scaffold for the deposition and cross-linking of elastin, and is encoded by the FBN1 gene. In mouse model studies, it was found that the C1039G mutation of this protein can lead to increased arterial stiffness, thereby accelerating the progression of atherosclerotic disease. Sequence alignment found that the mutation region is highly conserved among species. Abnormalities in APOE and FBN1 genes have been shown to be closely related to the occurrence and development of human atherosclerosis. Therefore, there is an urgent need to develop an atherosclerosis animal model based on APOE and FBN1 combined mutations to quickly unravel the atherosclerotic disease progression mechanism and disease progression mystery, and to lay the foundation for further treatment.

[0004] Currently, a mouse model of APOE knockout combined with FBN1 point mutation has been established, which can accurately simulate the development process of highly unstable plaques in the early stages of human atherosclerotic disease. However, mice differ greatly from humans in terms of size, organ size, physiology, pathology, and other aspects, and cannot truly simulate human normal physiological and pathological states. Pigs, as large animals, have been the main meat supply for humans for a long time. Their size and physiological functions are similar to those of humans, they are easy to breed in large quantities, and they have lower requirements in terms of ethics and animal protection, making them ideal animals for human disease models.

[0005] Gene editing is a biological technology that has made great progress in recent years, including gene editing based on homologous recombination to ZFN, TALEN, CRISPR / Cas9 based nuclease editing technology, among which CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is more and more applied to the production of animal models.

[0006] Homologous recombination (HDR) is to exchange DNA sequence information through sequence homology: that is, the repair template contains the desired insertion fragment, and the two ends of the repair template are recombination arms with sequence homology near the insertion site. In the past, double-stranded DNA (dsDNA) was usually used as a repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxynucleotide (ssODN) as a HDR donor template. First, ssODN as a donor template has higher insertion site specificity than dsDNA template, and dsDNA template is prone to random insertion. Second, ssODN has a shorter length requirement for homologous recombination arms than dsDNA template, and a single-sided 30-60 base recombination arm design can achieve efficient and stable HDR, which provides higher insertion efficiency than similar dsDNA templates. Third, dsDNA is easily incorporated by the NHEJ repair pathway, resulting in homologous arm replication or partial integration of the dsDNA template, while ssODN is less likely to produce such phenomena. In addition, dsDNAs are harmful to cultured cells, and linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates have more advantages in these aspects. SUMMARY

[0007] The purpose of the present application is to provide a gene editing system for constructing an AF double gene mutation atherosclerosis model pig nuclear transfer donor cell and its application.

[0008] The present application provides a kit comprising plasmid pKG-U6gRNA(APOE-E2-gRNA2), FBN1-gRNA4, FBN1-gRNA6 and FBN1-mutant-ss163.

[0009] The kit further comprises a plasmid expressing Cas9 protein.

[0010] The kit further comprises NCN protein.

[0011] The kit further comprises PRONCN protein.

[0012] The kit further comprises plasmid pKG-GE4.

[0013] The kit further comprises a pig cell.

[0014] The use of the kit is as follows (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing an atherosclerosis model pig; (c) preparing an atherosclerotic cell model or an atherosclerotic tissue model or an atherosclerotic organ model.

[0015] The application further provides a method for preparing a recombinant cell, comprising the following steps: co-transfecting a pig cell with a plasmid pKG-U6gRNA(APOE-E2-gRNA2), a plasmid for expressing a Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein to obtain a recombinant cell in which the APOE gene is mutated and the FBN1 gene is mutated.

[0016] The FBN1 gene is mutated refers to replacing a DNA molecule shown in SEQ ID NO: 28 in the chromosomal DNA of the pig cell with a DNA molecule shown in SEQ ID NO: 27 to obtain the recombinant cell.

[0017] The ratio of the plasmid pKG-U6gRNA(APOE-E2-gRNA2), the plasmid for expressing the Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein is as follows: 0.8-1.0 μg of the plasmid pKG-U6gRNA(APOE-E2-gRNA2): 0.9-1.2 μg of the plasmid for expressing the Cas9 protein: 0.8-1.2 μg of FBN1-gRNA4: 0.8-1.2 μg of FBN1-gRNA6: 1.8-2.2 μg of FBN1-mutant-ss163: 3-5 μg of NCN protein.

[0018] The ratio of the plasmid pKG-U6gRNA(APOE-E2-gRNA2), the plasmid for expressing the Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein is as follows: 0.92 μg of the plasmid pKG-U6gRNA(APOE-E2-gRNA2): 1.08 μg of the plasmid for expressing the Cas9 protein: 1 μg of FBN1-gRNA4: 1 μg of FBN1-gRNA6: 2 μg of FBN1-mutant-ss163: 4 μg of NCN protein.

[0019] The ratio of pig cells, plasmid pKG-U6gRNA (APOE-E2-gRNA2), plasmid for expressing Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein is 200,000 pig cells: 0.8-1.0 μg of plasmid pKG-U6gRNA (APOE-E2-gRNA2): 0.9-1.2 μg of plasmid for expressing Cas9 protein: 0.8-1.2 μg of FBN1-gRNA4: 0.8-1.2 μg of FBN1-gRNA6: 1.8-2.2 μg of FBN1-mutant-ss163: 3-5 μg of NCN protein.

[0020] The ratio of pig cells, plasmid pKG-U6gRNA (APOE-E2-gRNA2), plasmid for expressing Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein is 200,000 pig cells: 0.92 μg of plasmid pKG-U6gRNA (APOE-E2-gRNA2): 1.08 μg of plasmid for expressing Cas9 protein: 1 μg of FBN1-gRNA4: 1 μg of FBN1-gRNA6: 2 μg of FBN1-mutant-ss163: 4 μg of NCN protein.

[0021] Plasmid pKG-U6gRNA (APOE-E2-gRNA2) transcribed to obtain sgRNA APOE-E2-gRNA2 ; sgRNA APOE-E2-gRNA2 The target sequence binding region of sgRNA is shown as nucleotides 1-20 in SEQ ID NO: 11.

[0022] Specifically, the sgRNA APOE-E2-gRNA2 is shown as SEQ ID NO: 11.

[0023] FBN1-gRNA4, sgRNA, the target sequence binding region of which is shown as nucleotides 3-22 in SEQ ID NO: 25.

[0024] Specifically, the FBN1-gRNA4 is shown as SEQ ID NO: 25.

[0025] Specifically, the FBN1-gRNA4 is shown as SEQ ID NO: 19.

[0026] FBN1-gRNA6, sgRNA, the target sequence binding region of which is shown as nucleotides 3-22 in SEQ ID NO: 26.

[0027] Specifically, the FBN1-gRNA6 is as shown in SEQ ID NO: 26.

[0028] Specifically, the FBN1-gRNA6 is as shown in SEQ ID NO: 21.

[0029] The FBN1-mutant-ss163 is a single-stranded DNA molecule as shown in SEQ ID NO: 27.

[0030] The NCN protein is a Cas9 protein or a fusion protein having the Cas9 protein.

[0031] Specifically, the NCN protein is as shown in SEQ ID NO: 3.

[0032] The pig cell is a pig fibroblast.

[0033] The pig cell is a primary pig fibroblast.

[0034] The preparation method of the NCN protein comprises the following steps:

[0035] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium;

[0036] (2) culturing the recombinant bacterium at 30°C using a liquid medium, then adding IPTG and performing 25°C induction culture, and then collecting the bacterial body;

[0037] (3) performing bacterial body disruption on the collected bacterial body to collect a crude protein solution;

[0038] (4) purifying the fusion protein having a His6 tag from the crude protein solution using affinity chromatography;

[0039] (5) performing enterokinase enzyme digestion on the fusion protein having a His6 tag, and then removing the protein having a His6 tag using Ni-NTA resin to obtain the purified NCN protein;

[0040] The plasmid pKG-GE4 has a fusion gene as shown in SEQ ID NO: 1 at positions 5209-9852.

[0041] The preparation method of the NCN protein specifically comprises the following steps:

[0042] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium.

[0043] (2) inoculating the recombinant bacterium obtained in step (1) into a liquid LB medium containing ampicillin and performing shaking culture;

[0044] (3) The bacteria solution obtained in step (2) was inoculated into liquid LB medium and cultured at 30°C with 230 rpm shaking until OD 600nm = 1.0, and then IPTG was added to a concentration of 0.5 mM in the system, and then cultured at 25°C with 230 rpm shaking for 12 hours, and then the bacteria were collected by centrifugation;

[0045] (4) The bacteria obtained in step (3) were washed with PBS buffer;

[0046] (5) The bacteria obtained in step (4) were suspended in crude extraction buffer, and then the bacteria were disrupted, and then the supernatant was collected by centrifugation, filtered using a filter membrane with a pore size of 0.22 μm, and the filtrate was collected;

[0047] (6) The fusion protein (fusion protein shown in SEQ ID NO: 2) with His6 tag was purified from the filtrate obtained in step (5) using affinity chromatography;

[0048] (7) The post-column solution collected in step (6) was concentrated using an ultrafiltration tube, and then diluted with 25 mM Tris-HCl (pH 8.0);

[0049] (8) The recombinant bovine enterokinase with His6 tag was added to the solution obtained in step (7) for enzyme digestion;

[0050] (9) The solution after step (8) was mixed with Ni-NTA resin, incubated, and then the supernatant was collected by centrifugation;

[0051] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube, and then added to the enzyme storage solution, which was the NCN protein solution.

[0052] The specific method for purifying the fusion protein with His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0053] First, the Ni-NTA agarose column was equilibrated with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then 50 ml of the filtrate obtained in step (5) was loaded (at a flow rate of 0.5-1 ml / min); then the column was washed with 5 column volumes of equilibration buffer (at a flow rate of 1 ml / min); then the column was washed with 5 column volumes of buffer (at a flow rate of 1 ml / min) to remove impurities; then 10 column volumes of elution buffer were used to elute at a flow rate of 0.5-1 ml / min, and the post-column solution (90-100 ml) was collected.

[0054] The PRONCN protein comprises, from upstream to downstream, the following elements: a signal peptide, a chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, a nuclear localization signal.

[0055] The signal peptide functions to promote protein secretion expression. The signal peptide can be selected from an E. coli alkaline phosphatase (phoA) signal peptide, a Staphylococcus aureus protein A signal peptide, an E. coli outer membrane protein (ompa) signal peptide, or a signal peptide of any other prokaryotic gene, preferably a phoA signal peptide. The phoA signal peptide is used to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the intracellular protein from the bacteria, and the target protein secreted into the bacterial periplasmic cavity is soluble expression, which can be cleaved by the signal peptide enzyme in the bacterial periplasmic cavity.

[0056] The chaperone protein functions to increase the solubility of the protein. The chaperone can be any protein that helps form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can help the co-expressed target protein (such as the Cas9 protein) form disulfide bonds as a chaperone, improve the stability, folding accuracy of the protein, and increase the solubility and activity of the target protein.

[0057] The protein tag functions for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, further preferably a His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein.

[0058] The protease cleavage site functions to remove the non-functional segment after purification to release the native form of the Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, further preferably enterokinase. EK is an enterokinase cleavage site, which facilitates the removal of the fused TrxA-His segment using enterokinase to obtain the native form of the Cas9 protein. After the application uses commercial enterokinase to cleave the fusion protein with a His tag, the TrxA-His segment and the enterokinase with a His tag can be removed by one-step affinity chromatography to obtain the native form of the Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification and dialysis.

[0059] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. The NLS is a nuclear localization signal, and one NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.

[0060] The Cas9 protein can be a saCas9 or a spCas9, preferably a spCas9 protein.

[0061] The PRONCN protein is specifically shown in SEQ ID NO: 2.

[0062] The plasmid pKG-GE4 comprises the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.

[0063] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, and can efficiently drive the expression of an exogenous gene.

[0064] The operator can be specifically a Lac operator. The Lac operator is a regulatory element for lactose-induced expression, and can be used to induce the expression of a target protein at low temperature after the bacteria grow to a certain amount, thereby avoiding the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improving the solubility of the expressed target protein.

[0065] The ribosome binding site is a ribosome binding site during protein translation, which is necessary for protein translation.

[0066] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of a target gene at the end of the target gene, thereby avoiding the transcription and translation of other downstream sequences other than the target gene.

[0067] For the codons of the spCas9 protein, the codons are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21(DE3), thereby improving the expression level of the Cas9 protein.

[0068] The T7 promoter is shown in SEQ ID NO: 1 at nucleotides 5121-5139.

[0069] The Lac operator is shown in SEQ ID NO: 1 at nucleotides 5140-5164.

[0070] The ribosome binding site is shown in SEQ ID NO: 1 at nucleotides 5178-5201.

[0071] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0072] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0073] The coding sequence of the His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0074] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0075] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0076] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0078] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.

[0079] The DNA molecule in the plasmid pKG-GE4 has nucleotides 5121-9949 in SEQ ID NO: 1.

[0080] Specifically, the plasmid pKG-GE4 is shown in SEQ ID NO: 1.

[0081] The plasmid for expressing the Cas9 protein can be specifically the plasmid pKG-GE3.

[0082] In the plasmid pKG-GE3, there is a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

[0083] The specific fusion protein comprises the following elements in order from N-terminus to C-terminus: two nuclear localization signals (NLS), a Cas9 protein, two nuclear localization signals, a self-cleavage polypeptide P2A, a fluorescent reporter protein, a self-cleavage polypeptide T2A, and a resistance screening marker protein.

[0084] In the plasmid pKG-GE3, the expression of the specific fusion gene is initiated by an EF1a promoter.

[0085] The plasmid pKG-GE3 has, downstream of the specific fusion gene, a WPRE sequence element, a 3'LTR sequence element and a bGH poly(A) signal sequence element.

[0086] The plasmid pKG-GE3 has, in sequence, a CMV enhancer, an EFla promoter, the specific fusion gene, a WPRE sequence element, a 3'LTR sequence element, a bGH poly(A) signal sequence element.

[0087] In the specific fusion protein, the two nuclear localization signals upstream of the Cas9 protein are SV40 nuclear localization signals, and the two nuclear localization signals downstream of the Cas9 protein are nucleoplasmin nuclear localization signals.

[0088] In the specific fusion protein, the fluorescent reporter protein can be specifically an EGFP protein.

[0089] In the specific fusion protein, the resistance screening marker protein can be specifically a Puromycin resistance protein.

[0090] The amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP" (the cleavage position of self-cleavage is between the first and second amino acid residues from the C-terminus).

[0091] The amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP" (the cleavage position of self-cleaving is between the first and second amino acid residues from the C-terminus).

[0092] The specific fusion gene is specifically shown in SEQ ID NO: 29 from nucleotides 911 to 6706.

[0093] The CMV enhancer is shown in SEQ ID NO: 29 from nucleotides 395 to 680.

[0094] The EFla promoter is shown in SEQ ID NO: 29 from nucleotides 682 to 890.

[0095] The WPRE sequence element is shown in SEQ ID NO: 29 from nucleotides 6722 to 7310.

[0096] The 3'LTR sequence element is shown in SEQ ID NO: 29 from nucleotides 7382 to 7615.

[0097] The bGH poly(A) signal sequence element is shown in SEQ ID NO: 29 from nucleotides 7647 to 7871.

[0098] The plasmid pKG-GE3 is specifically shown in SEQ ID NO: 29.

[0099] In the plasmid pKG-U6gRNA, the DNA molecule shown in SEQ ID NO: 30 at nucleotides 2280-2637 is present.

[0100] The plasmid pKG-U6gRNA is specifically shown in SEQ ID NO: 30.

[0101] Specifically, the plasmid pKG-U6gRNA (APOE-E2-gRNA2) is obtained by inserting the coding sequence of the target sequence binding region of sgRNA APOE-E2-gRNA2 into the pKG-U6gRNA vector by means of restriction enzyme BbsI.

[0102] The present application also protects the recombinant cell prepared by any of the above-mentioned methods.

[0103] The present application also protects the use of the recombinant cell in the preparation of an atherosclerosis model pig.

[0104] The somatic cell clone of the recombinant cell as a nuclear transfer donor cell can obtain a cloned pig, which is an atherosclerosis model pig.

[0105] The present application also protects the pig tissue of the model pig prepared by the recombinant cell, i.e. an atherosclerosis tissue model.

[0106] The present application also protects the pig organ of the model pig prepared by the recombinant cell, i.e. an atherosclerosis organ model.

[0107] The present application also protects the pig cell of the model pig prepared by the recombinant cell, i.e. an atherosclerosis cell model.

[0108] The present application also protects the use of the recombinant cell, the atherosclerosis tissue model, the atherosclerosis organ model, the atherosclerosis cell model or the atherosclerosis model pig, which is as follows (d1) or (d2) or (d3) or (d4):

[0109] (d1) screening drugs for treating atherosclerosis;

[0110] (d2) performing efficacy evaluation of atherosclerosis drugs;

[0111] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for atherosclerosis;

[0112] (d4) studying the pathogenesis of atherosclerosis.

[0113] Any of the above pig can be a Jiangxiang pig.

[0114] Pig APOE gene information: encoding Apolipoprotein E protein; located on chromosome 6; GeneID is 397576, Sus scrofa. The protein encoded by the pig APOE gene is shown as SEQ ID NO: 8. The pig APOE gene has a DNA segment shown as SEQ ID NO: 9.

[0115] Pig FBN1 gene information: encoding Fibrillin-1; located on pig chromosome 1; GeneID is 414836, Sus scrofa. The protein encoded by the pig FBN1 gene is shown as SEQ ID NO: 14. The pig FBN1 gene has a DNA segment shown as SEQ ID NO: 15.

[0116] Rodents such as mice and rats are very different from humans in terms of body size, organ size, physiology, pathology, and the like, and cannot truly simulate the normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice and rats are ineffective in human clinical trials. As for large animals, primates are the closest relatives of humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and high feeding costs. In addition, primate cloning is low in efficiency, difficult, and high in cost. As a model animal, pigs have none of the above shortcomings. Pigs are the closest relatives of humans, with similar body size, weight, organ size, and the like to humans, and are very similar to humans in anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. At the same time, pigs mature early (4-6 months), have high reproductive capacity, and can form a large population in 2-3 years. In addition, pig cloning technology is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.

[0117] The present application adopts CRISPR / Cas9 technology combined with ssODN homologous recombination technology to carry out point mutation gene editing of FBN1 gene, and edits APOE gene at the same time, to obtain a single cell clone of APOE gene knockout and FBN1 gene precise point mutation, which lays a foundation for cultivating an atherosclerotic disease model pig through somatic cell nuclear transfer animal cloning technology in the later stage. The model pig is expected to simulate the human disease progression characteristics of atherosclerotic disease, and will provide a powerful experimental tool for studying the pathogenesis, disease progression and drug research and development of atherosclerosis. BRIEF DESCRIPTION OF DRAWINGS

[0118] Figure 1 It is a schematic diagram of the structure of plasmid pET-32a.

[0119] Figure 2 Figure 1 is a schematic diagram of the structure of plasmid pKG-GE4.

[0120] Figure 3 Figure 2 is an electropherogram of gRNA and NCN protein dosage ratio optimization in Example 3.

[0121] Figure 4 Figure 3 is an electropherogram of NCN protein and commercial Cas9 protein gene editing efficiency comparison in Example 3.

[0122] Figure 5 Figure 4 is an electropherogram of PCR amplification using primer pair APOE-E2-F and APOE-E2-R with genomic DNA of 18 pigs as templates in Example 4.

[0123] Figure 6 Figure 5 is a sequencing peak chart of different target sites in Example 4.

[0124] Figure 7 Figure 6 is an electropherogram of PCR amplification using different primer pairs with genomic DNA of pig named 1 as template in Example 5.

[0125] Figure 8 Figure 7 is an electropherogram of PCR amplification using primer pair FBN1-JDF419 and FBN1-JDR673 with genomic DNA of 18 pigs as templates in Example 5.

[0126] Figure 9 Figure 8 is an electropherogram of editing efficiency comparison of different target sites in Example 5.

[0127] Figure 10 Figure 9 is the alignment result of reverse sequencing of single cell clone No. 2 in Example 6 with the wild type sequence of the APOE gene target site.

[0128] Figure 11 Figure 10 is the alignment result of reverse sequencing of single cell clone No. 3 in Example 6 with the wild type sequence of the APOE gene target site.

[0129] Figure 12 Figure 11 is the alignment result of reverse sequencing of single cell clone No. 10 in Example 6 with the wild type sequence of the APOE gene target site.

[0130] Figure 13 Figure 12 is the alignment result of forward and reverse sequencing of single cell clone No. 8 in Example 6 with the wild type sequence of the APOE gene target site.

[0131] Figure 14is the alignment result of reverse sequencing of the single cell clone numbered 3 in Example 6 and the wild type sequence of the FBN1 gene target site.

[0132] Figure 15 is the alignment result of reverse sequencing of the single cell clone numbered 1 in Example 6 and the wild type sequence of the FBN1 gene target site.

[0133] Figure 16 is the alignment result of reverse sequencing of the single cell clone numbered 2 in Example 6 and the wild type sequence of the FBN1 gene target site.

[0134] Figure 17 is the alignment result of reverse sequencing of the single cell clone numbered 11 in Example 6 and the wild type sequence of the FBN1 gene target site.

[0135] Figure 18 is the alignment result of reverse sequencing of the single cell clone numbered 10 in Example 6 and the wild type sequence of the FBN1 gene target site.

[0136] Figure 19 is the alignment result of reverse sequencing of the single cell clone numbered 15 in Example 6 and the wild type sequence of the FBN1 gene target site. DETAILED DESCRIPTION

[0137] The application will be further described in conjunction with the preferred embodiments thereof, given only by way of illustration of the present application and not intended to limit the scope of the present application. The following examples provided as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation on the present application in any way.

[0138] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. The recombinant plasmids constructed in the examples have been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 constant temperature incubator.

[0139] The pig primary fibroblast cells used in the examples were prepared from the ear tissue of a newborn Jiangxiang pig. The method for preparing the pig primary fibroblast cells was as follows: ① 0.5 g of pig ear tissue was obtained, the hair and bone tissue were removed, and then the tissue was immersed in 75% alcohol for 30-40 s, then washed with PBS buffer containing 5% (by volume) Penicillin-Streptomycin (Gibco) for 5 times, and then washed with PBS buffer once; ② the tissue was cut into pieces using scissors, and then digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuged at 500g for 5 min, and the supernatant was discarded; ③ the precipitate was resuspended with 1 mL of complete culture medium, and then plated into a cell culture dish with a diameter of 10 cm containing 10 mL of complete culture medium and having been sealed with 0.2% gelatin (VWR), and cultured until the cells grew to about 60% of the bottom of the dish; ④ after step ③ was completed, the cells were digested with trypsin and collected, and then resuspended in complete culture medium. The cells were used for subsequent electroporation experiments.

[0140] Example 1, Construction of Plasmid

[0141] I. Construction of Plasmid pKG-GE3

[0142] Plasmid pKG-GE3 is a circular plasmid as shown in SEQ ID NO: 29. In SEQ ID NO: 29, nucleotides 395-680 constitute a CMV enhancer, nucleotides 682-890 constitute an EFla promoter, nucleotides 986-1006 encode a nuclear localization signal (NLS), nucleotides 1016-1036 encode a nuclear localization signal (NLS), nucleotides 1037-5161 encode a Cas9 protein, nucleotides 5162-5209 encode a nuclear localization signal (NLS), nucleotides 5219-5266 encode a nuclear localization signal (NLS), nucleotides 5276-5332 encode a self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the cleavage position for self-cleavage is between the first and second amino acid residues from the C terminus), nucleotides 5333-6046 encode an EGFP protein, nucleotides 6056-6109 encode a self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage position for self-cleavage is between the first and second amino acid residues from the C terminus), nucleotides 6110-6703 encode a Puromycin protein (referred to as a Puro protein), nucleotides 6722-7310 constitute a WPRE sequence element, nucleotides 7382-7615 constitute a 3'LTR sequence element, and nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 29, nucleotides 911-6706 form a fusion gene, and express a fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein having the Cas9 protein, a protein having the EGFP protein, and a protein having the Puro protein.

[0143] II. Construction of plasmid pKG-U6gRNA

[0144] The pKG-U6gRNA vector, i.e., plasmid pKG-U6gRNA, is a circular plasmid as shown in SEQ ID NO: 30. In SEQ ID NO: 30, nucleotides 2280-2539 constitute a hU6 promoter, and nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain a gRNA.

[0145] III. Construction of a prokaryotic Cas9 high-efficiency expression vector

[0146] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 1 .

[0147] The plasmid pKG-GE4 is obtained by modifying the plasmid pET-32a. The plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the schematic diagram of the structure is shown in Figure 2 .

[0148] In SEQ ID NO: 1, the nucleotides at positions 5121-5139 constitute a T7 promoter, the nucleotides at positions 5140-5164 encode a lac operator, the nucleotides at positions 5178-5201 constitute a ribosome binding site (RBS), the nucleotides at positions 5209-5271 encode a phoA signal peptide, the nucleotides at positions 5272-5598 encode a TrxA protein, the nucleotides at positions 5620-5637 encode a His-Tag, the nucleotides at positions 5638-5652 encode an enterokinase cleavage site (EK cleavage site), the nucleotides at positions 5656-5670 encode a nuclear localization signal, the nucleotides at positions 5701-9801 encode a spCas9 protein, the nucleotides at positions 9802-9849 encode a nuclear localization signal, and the nucleotides at positions 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the E. coli BL21 (DE3) strain.

[0149] The main modifications of the plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein is retained, which can help the expressed target protein to form disulfide bonds, increase the solubility and activity of the target protein; the coding sequence of the phoA signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; ② The coding sequence of the His-Tag is added downstream of the coding sequence of the TrxA protein, which can be used for enrichment of the expressed target protein; ③ The coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of the His-Tag, and the purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ The Cas9 gene suitable for expression in the E. coli BL21 (DE3) strain is inserted after codon optimization, and the coding sequence of the nuclear localization signal is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.

[0150] The fusion gene in plasmid pKG-GE4 is shown as nucleotides 5209-9852 in SEQ ID NO: 1, which encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein for short). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0151] Example 2, Preparation and purification of NCN protein

[0152] I. Inducing expression

[0153] 1. Introduce plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain recombinant bacteria.

[0154] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and incubate at 37°C with 200 rpm shaking overnight.

[0155] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium, and incubate at 30°C with 230 rpm shaking until the OD value = 1.0, then add isopropyl thiogalactoside (IPTG) to a concentration of 0.5 mM in the system, then incubate at 25°C with 230 rpm shaking for 12 hours, then centrifuge at 4°C at 10000 g for 15 minutes to collect the bacterial cells. 600nm

[0156] 4. Take the bacterial cells obtained in step 3, and wash with PBS buffer.

[0157] II. Purification of fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0158] 1. Take the bacterial cells obtained in step I, add crude extraction buffer and suspend the bacterial cells, then use a homogenizer to break the bacterial cells (1000 par cycles for three times), then centrifuge at 4°C at 15000 g for 30 min to collect the supernatant, and filter the supernatant with a 0.22 μm pore size filter membrane to collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet bacterial cells.

[0159] Crude extraction buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 1 mM PMSF, and the rest is ddH2O.

[0160] 2. Purify the fusion protein by affinity chromatography.

[0161] ​First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then load 50 ml of the filtrate obtained in step 1 at a flow rate of 0.5-1 ml / min; then wash the column with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then wash the column with 5 column volumes of buffer at a flow rate of 1 ml / min to remove impurities; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0162] Ni-NTA agarose column: Qiagen, L00250 / L00250-C, with a packing of 10 ml.

[0163] Equilibration buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the rest ddH2O.

[0164] Buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the rest ddH2O.

[0165] Elution buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the rest ddH2O.

[0166] III. Enzymatic cleavage of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of the NCN protein

[0167] 1. Take 15 ml of the post-column solution collected in step two, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0168] 2. Add commercially sourced recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (about 6 ml), and incubate at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.

[0169] 3. Take the solution from step 2 (about 6 ml) and mix with 480 μl Ni-NTA resin (Genscript, L00250 / L00250-C) and rotate for 15 min at room temperature, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).

[0170] 4. Take the supernatant from step 3 and concentrate to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add enzyme storage solution and adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.

[0171] After sequencing, the protein in the NCN protein solution has the N-terminal 15 amino acid residues as shown in SEQ ID NO: 3, i.e. NCN protein.

[0172] The NCN protein used in the subsequent examples is provided by the NCN protein solution.

[0173] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (by volume) glycerol, and the rest is ddH2O.

[0174] Example 3, Performance of NCN protein

[0175] Two gRNA target sites targeting the TTN gene are selected as follows:

[0176] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0177] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0178] The primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:

[0179] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0180] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0181] I. Preparation of gRNA

[0182] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template

[0183] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0184] TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0185] 2. In vitro transcription of gRNA

[0186] Take TTN-T7-gRNA1 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification, to obtain TTN-gRNA1. TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0187] Take TTN-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) for recovery and purification, to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0188] II. Optimization of the ratio of gRNA to NCN protein dosage

[0189] 1. Co-transfection of porcine primary fibroblasts

[0190] The first group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.

[0191] The second group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.

[0192] Group 3: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0193] Group 4: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.

[0194] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0195] Co-transfection was performed by electroporation. Mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter settings: 1450V, 10ms, 3pulse) were used.

[0196] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0197] 3. After completing step 2, use trypsin to digest and collect cells, extract genomic DNA, use primer pair composed of TTN-F55 and TTN-R560 for PCR amplification, then perform 1% agarose gel electrophoresis.

[0198] The electrophoresis map is shown in Figure 3 . The 505bp band is the wild type band (WT), and the 254bp band (251bp missing from the theoretical wild type band 505bp) is the deletion mutant band (MT).

[0199] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. The gene deletion mutation efficiency of the first group was 19.9%, the gene deletion mutation efficiency of the second group was 39.9%, the gene deletion mutation efficiency of the third group was 79.9%, the gene deletion mutation efficiency of the fourth group was 44.3%, and the fifth group did not occur mutation.

[0200] The results show that when the mass ratio of two gRNAs to NCN protein is 1:1:4, and the actual amount used is 1 μg:1 μg:4 μg, the gene editing efficiency is the highest. Therefore, the optimal amount of two gRNAs to NCN protein is determined to be 1 μg:1 μg:4 μg.

[0201] III. Comparison of gene editing efficiency of NCN protein and commercial Cas9 protein

[0202] 1. Co-transfection of porcine primary fibroblasts

[0203] Cas9-A group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.

[0204] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.

[0205] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.

[0206] Control group: TTN-gRNA1, TTN-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0207] Co-transfection was performed by electroporation, using mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter settings: 1450V, 10ms, 3pulse).

[0208] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0209] 3. After step 2, the cells were digested by trypsin, genomic DNA was extracted, and PCR amplification was performed by using a primer pair consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0210] The electropherogram is shown in Figure 4 The gene deletion mutation efficiency of the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency of the NCN protein was 85.6%, and the gene deletion mutation efficiency of the commercial Cas9-B protein was 16.6%.

[0211] The results show that, compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.

[0212] Example 4, screening of APOE gene high-efficiency gRNA target points

[0213] Pig APOE gene information: encoding Apolipoprotein E protein; located on chromosome 6; GeneID is 397576, Sus scrofa. The protein encoded by the pig APOE gene is shown in SEQ ID NO: 8. In the genomic DNA, the pig APOE gene has 3 exons. The partial sequence of the pig APOE gene (containing the 2nd exon and each 350bp upstream and downstream) is shown in SEQ ID NO: 9.

[0214] I. Analysis of the conservation of the APOE gene pre-set point mutation site and the adjacent genomic sequence

[0215] 18 newborn Jiangxiang pigs, of which 10 were female (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) and 8 were male (named A, B, C, D, E, F, G, and H, respectively).

[0216] APOE-E2-F: ACCTGATGGCTGTGAACTGG;

[0217] APOE-E2-R: GGCGACAAGGACAGAAGGAA.

[0218] The genomic DNA of the 18 pigs was used as a template, and PCR amplification was performed by using a primer pair consisting of APOE-E2-F and APOE-E2-R, followed by 1% agarose gel electrophoresis. The electropherogram is shown in Figure 5 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the APOE gene sequence in the public database. The conserved region common to the 18 pigs was selected for gRNA target point design.

[0219] II. Screening of target points

[0220] Through screening NGG (avoiding possible mutation sites), several target points were preliminarily screened, and 4 target points were further screened from them through pre-experiments.

[0221] The 4 target points are as follows:

[0222] APOE-E2-gRNA1: GTAATCCCAGAAGCGGCCCA;

[0223] APOE-E2-gRNA2: TGTGGTGGGAGGAGCCCAAG;

[0224] APOE-E2-gRNA3: CCTGTCTGACCAAGTGCAGG;

[0225] APOE-E2-gRNA4: CACCACACGTGCACCTCCGG.

[0226] III. Preparation of recombinant plasmid

[0227] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (about 3 kb of linear large fragments) was recovered.

[0228] APOE-E2-gRNA1-S and APOE-E2-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were connected to obtain the plasmid pKG-U6gRNA (APOE-E2-gRNA1). The plasmid pKG-U6gRNA (APOE-E2-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 APOE-E2-gRNA1 .

[0229] sgRNA APOE-E2-gRNA1 (SEQ ID NO: 10):

[0230] GUAAUCCCAGAAGCGGCCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0231] APOE-E2-gRNA2-S and APOE-E2-gRNA2-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(APOE-E2-gRNA2). The plasmid pKG-U6gRNA(APOE-E2-gRNA2) expresses sgRNA represented by SEQ ID NO: 11 APOE-E2-gRNA2 .

[0232] sgRNA APOE-E2-gRNA2 (SEQ ID NO: 11):

[0233] UGUGGUGGGAGGAGCCCAAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0234] APOE-E2-gRNA3-S and APOE-E2-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(APOE-E2-gRNA3). The plasmid pKG-U6gRNA(APOE-E2-gRNA3) expresses sgRNA represented by SEQ ID NO: 12 APOE-E2-gRNA3 .

[0235] sgRNA APOE-E2-gRNA3 (SEQ ID NO: 12):

[0236] CCUGUCUGACCAAGUGCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0237] APOE-E2-gRNA4-S and APOE-E2-gRNA4-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(APOE-E2-gRNA4). The plasmid pKG-U6gRNA(APOE-E2-gRNA4) expresses sgRNA represented by SEQ ID NO: 13 APOE-E2-gRNA4 .

[0238] sgRNAAPOE-E2-gRNA4 (SEQ ID NO: 13):

[0239] CACCACACGUGCACCUCCGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0240] APOE-E2-gRNA1-S: caccGTAATCCCAGAAGCGGCCCA;

[0241] APOE-E2-gRNA1-A: aaacTGGGCCGCTTCTGGGATTAC;

[0242] APOE-E2-gRNA2-S: caccgTGTGGTGGGAGGAGCCCAAG;

[0243] APOE-E2-gRNA2-A: aaacCTTGGGCTCCTCCCACCACAc;

[0244] APOE-E2-gRNA3-S: caccgCCTGTCTGACCAAGTGCAGG;

[0245] APOE-E2-gRNA3-A: aaacCCTGCACTTGGTCAGACAGGc;

[0246] APOE-E2-gRNA4-S: caccgCACCACACGTGCACCTCCGG;

[0247] APOE-E2-gRNA4-A: aaacCCGGAGGTGCACGTGTGGTGc.

[0248] APOE-E2-gRNA1-S, APOE-E2-gRNA1-A, APOE-E2-gRNA2-S, APOE-E2-gRNA2-A, APOE-E2-gRNA3-S, APOE-E2-gRNA3-A, APOE-E2-gRNA4-S, and APOE-E2-gRNA4-A are all single-stranded DNA molecules.

[0249] IV. Comparison of editing efficiency of different target sites

[0250] 1. Co-transfection

[0251] The first group: co-transfecting plasmid pKG-U6gRNA(APOE-E2-gRNA1) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(APOE-E2-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0252] The second group: co-transfecting plasmid pKG-U6gRNA(APOE-E2-gRNA2) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(APOE-E2-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0253] The third group: co-transfecting plasmid pKG-U6gRNA(APOE-E2-gRNA3) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(APOE-E2-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0254] The fourth group: co-transfecting plasmid pKG-U6gRNA(APOE-E2-gRNA4) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(APOE-E2-gRNA4): 1.08 μg of plasmid pKG-GE3.

[0255] The fifth group: porcine primary fibroblasts, the same electric conversion parameters without plasmid.

[0256] Co-transfection is performed by electroporation, using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter setting: 1450V, 10ms, 3pulse).

[0257] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0258] 3. After completing step 2, use trypsin to digest and collect cells, lyse cells, extract genomic DNA, use primer pair composed of APOE-E2-F and APOE-E2-R for PCR amplification, and then perform 1% agarose gel electrophoresis.

[0259] After cutting the target product and recovering it, send it to a sequencing company for sequencing. The sequencing peak chart is shown inFigure 6 The sequencing results were analyzed by the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different targets. The gene editing efficiencies of the first group to the fourth group were 19%, 61%, 12%, and 8%, respectively. The fifth group did not occur gene editing. The results showed that the APOE-E2-gRNA2 editing efficiency was higher.

[0260] Example 5, Screening of high-efficiency gRNA target sites of FBN1 gene

[0261] Pig FBN1 gene information: encoding fibrillin-1; located on pig chromosome 1; Gene ID is 414836, Sus scrofa. The protein encoded by the pig FBN1 gene is shown as SEQ ID NO: 14. The pig FBN1 gene has 65 exons in the genomic DNA. The partial sequence of the pig FBN1 gene (containing the 25th exon and the 26th exon) is shown as SEQ ID NO: 15. The FBN1 gene C1039G mutation can cause increased arterial stiffness.

[0262] I. Analysis of the conservation of the FBN1 gene preset point mutation site and the adjacent genomic sequence

[0263] 18 newborns from Jiangxiang pigs, of which 10 were female (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) and 8 were male (named A, B, C, D, E, F, G, and H, respectively).

[0264] FBN1-JDF412: CCTGGGTTTAGAATGGGGTGT;

[0265] FBN1-JDR692: ACGCTTTCCTTCTTGAGGCA;

[0266] FBN1-JDF419: TTAGAATGGGGTGTTGAGCCC;

[0267] FBN1-JDR673: AGTGGGTTAAAGGCGAGGTG.

[0268] The ear tissue of the pig named 1 was used to extract the genome as a template, and different primer pairs were used for PCR amplification, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 7 . Figure 7Group 1: FBN1-JDF412 / FBN1-JDR692; Group 2: FBN1-JDF412 / FBN1-JDR673; Group 3: FBN1-JDF419 / FBN1-JDR692; Group 4: FBN1-JDF419 / FBN1-JDR673. The results show that the primer pair composed of FBN1-JDF419 and FBN1-JDR673 is preferably used for amplifying the target fragment.

[0269] The genomic DNA of 18 pigs was used as a template, and the primer pair composed of FBN1-JDF419 and FBN1-JDR673 was used for PCR amplification, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 8 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the FBN1 gene sequence in the public database. The conserved region common to 18 pigs was selected for gRNA target site design.

[0270] II. Screening of target sites

[0271] Through screening of NGG (avoiding possible mutation sites), several target sites were preliminarily screened, and 7 target sites were further screened from them through pre-experiments.

[0272] The 7 target sites are as follows:

[0273] FBN1-E25-gRNA1: ATCCCCAACCTCTGTACCCA;

[0274] FBN1-E25-gRNA2: AGTGTTCCTGCACTTGCCGT;

[0275] FBN1-E25-gRNA3: TAGTGTTCCTGCACTTGCCG;

[0276] FBN1-E25-gRNA4: TGCACTTGCCGTGGGTACAG;

[0277] FBN1-E25-gRNA5: GGCAAGTGCAGGAACACTAT;

[0278] FBN1-E25-gRNA6: CTTCAACAAAAATTGAATGT;

[0279] FBN1-E25-gRNA7: TCTTCAACAAAAATTGAATG.

[0280] III. Preparation of recombinant plasmid

[0281] The plasmid pKG-U6gRNA was digested with restriction enzyme Bbsl, and the vector skeleton (a linear large fragment of about 3 kb) was recovered.

[0282] FBN1-E25-gRNA1-S and FBN1-E25-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(FBN1-E25-gRNA1). The plasmid pKG-U6gRNA(FBN1-E25-gRNA1) expressed the sgRNA shown in SEQ ID NO: 16 FBN1-E25-gRNA1 .

[0283] sgRNA FBN1-E25-gRNA1 (SEQ ID NO: 16):

[0284] AUCCCCAACCUCUGUACCCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0285] FBN1-E25-gRNA2-S and FBN1-E25-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(FBN1-E25-gRNA2). The plasmid pKG-U6gRNA(FBN1-E25-gRNA2) expressed the sgRNA shown in SEQ ID NO: 17 FBN1-E25-gRNA2 .

[0286] sgRNA FBN1-E25-gRNA2 (SEQ ID NO: 17):

[0287] AGUGUUCCUGCACUUGCCGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0288] FBN1-E25-gRNA3-S and FBN1-E25-gRNA3-A, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(FBN1-E25-gRNA3). The plasmid pKG-U6gRNA(FBN1-E25-gRNA3) expresses the sgRNA represented by SEQ ID NO: 18 FBN1-E25-gRNA3 .

[0289] sgRNA FBN1-E25-gRNA3 (SEQ ID NO: 18):

[0290] UAGUGUUCCUGCACUUGCCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0291] FBN1-E25-gRNA4-S and FBN1-E25-gRNA4-A, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(FBN1-E25-gRNA4). The plasmid pKG-U6gRNA(FBN1-E25-gRNA4) expresses the sgRNA represented by SEQ ID NO: 19 FBN1-E25-gRNA4 .

[0292] sgRNA FBN1-E25-gRNA4 (SEQ ID NO: 19):

[0293] UGCACUUGCCGUGGGUACAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0294] FBN1-E25-gRNA5-S and FBN1-E25-gRNA5-A, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(FBN1-E25-gRNA5). The plasmid pKG-U6gRNA(FBN1-E25-gRNA5) expresses the sgRNA represented by SEQ ID NO: 20 FBN1-E25-gRNA5 .

[0295] sgRNA FBN1-E25-gRNA5 (SEQ ID NO: 20):

[0296] GGCAAGUGCAGGAACACUAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0297] FBN1-E25-gRNA6-S and FBN1-E25-gRNA6-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(FBN1-E25-gRNA6). The plasmid pKG-U6gRNA(FBN1-E25-gRNA6) expresses the sgRNA represented by SEQ ID NO: 21 FBN1-E25-gRNA6 .

[0298] sgRNA FBN1-E25-gRNA6 (SEQ ID NO: 21):

[0299] CUUCAACAAAAAUUGAAUGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0300] FBN1-E25-gRNA7-S and FBN1-E25-gRNA7-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(FBN1-E25-gRNA7). The plasmid pKG-U6gRNA(FBN1-E25-gRNA7) expresses the sgRNA represented by SEQ ID NO: 22 FBN1-E25-gRNA7 .

[0301] sgRNA FBN1-E25-gRNA7 (SEQ ID NO: 22):

[0302] UCUUCAACAAAAAUUGAAUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.

[0303] FBN1-E25-gRNA1-S: caccgATCCCCAACCTCTGTACCCA;

[0304] FBN1-E25-gRNA1-A: aaacTGGGTACAGAGGTTGGGGATc;

[0305] FBN1-E25-gRNA2-S: caccgAGTGTTCCTGCACTTGCCGT;

[0306] FBN1-E25-gRNA2-A: aaacACGGCAAGTGCAGGAACACTc;

[0307] FBN1-E25-gRNA3-S: caccgTAGTGTTCCTGCACTTGCCG;

[0308] FBN1-E25-gRNA3-A: aaacCGGCAAGTGCAGGAACACTAc;

[0309] FBN1-E25-gRNA4-S: caccgTGCACTTGCCGTGGGTACAG;

[0310] FBN1-E25-gRNA4-A: aaacCTGTACCCACGGCAAGTGCAc;

[0311] FBN1-E25-gRNA5-S: caccGGCAAGTGCAGGAACACTAT;

[0312] FBN1-E25-gRNA5-A: aaacATAGTGTTCCTGCACTTGCC;

[0313] FBN1-E25-gRNA6-S: caccgCTTCAACAAAAATTGAATGT;

[0314] FBN1-E25-gRNA6-A: aaacACATTCAATTTTTGTTGAAGc;

[0315] FBN1-E25-gRNA7-S: caccgTCTTCAACAAAAATTGAATG;

[0316] FBN1-E25-gRNA7-A: aaacCATTCAATTTTTGTTGAAGAc.

[0317] FBN1-E25-gRNA1-S, FBN1-E25-gRNA1-A, FBN1-E25-gRNA2-S, FBN1-E25-gRNA2-A, FBN1-E25-gRNA3-S, FBN1-E25-gRNA3-A, FBN1-E25-gRNA4-S, FBN1-E25-gRNA4-A, FBN1-E25-gRNA5-S, FBN1-E25-gRNA5-A, FBN1-E25-gRNA6-S, FBN1-E25-gRNA6-A, FBN1-E25-gRNA7-S, FBN1-E25-gRNA7-A are all single-stranded DNA molecules.

[0318] IV. Comparison of editing efficiency of different target sites

[0319] 1. Co-transfection

[0320] First group: co-transfect plasmid pKG-U6gRNA(FBN1-E25-gRNA1), plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0321] Second group: co-transfect plasmid pKG-U6gRNA(FBN1-E25-gRNA2), plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0322] Third group: co-transfect plasmid pKG-U6gRNA(FBN1-E25-gRNA3), plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0323] Fourth group: co-transfect plasmid pKG-U6gRNA(FBN1-E25-gRNA4), plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA4): 1.08 μg of plasmid pKG-GE3.

[0324] Group 5: Plasmid pKG-U6gRNA(FBN1-E25-gRNA5) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA5): 1.08 μg of plasmid pKG-GE3.

[0325] Group 6: Plasmid pKG-U6gRNA(FBN1-E25-gRNA6) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA6): 1.08 μg of plasmid pKG-GE3.

[0326] Group 7: Plasmid pKG-U6gRNA(FBN1-E25-gRNA7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(FBN1-E25-gRNA7): 1.08 μg of plasmid pKG-GE3.

[0327] Group 8: Porcine primary fibroblasts were subjected to electroporation without plasmids under the same electroporation parameters.

[0328] Co-transfection was performed by electroporation using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameters set at 1450V, 10ms, 3 pulses).

[0329] 2. After completing step 1, the cells were cultured with complete culture medium for 12-18 hours, and then new complete culture medium was added for culture. The total culture time after electroporation was 48 hours.

[0330] 3. After completing step 2, the cells were trypsinized and collected, the cells were lysed, genomic DNA was extracted, and PCR amplification was performed using a primer pair consisting of FBN1-JDF419 and FBN1-JDR673, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 9 .

[0331] The target product was cut and recovered, and then sent to a sequencing company for sequencing. The sequencing results were analyzed using the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first to seventh groups was 25%, 20%, 13%, 45%, 12%, 52%, and 9%, respectively. The eighth group did not occur gene editing. The results showed that the editing efficiency of FBN1-E25-gRNA4 and FBN1-E25-gRNA6 was higher.

[0332] Example 6, Preparation of single cell clone for simultaneous editing of APOE and FBN1 genes

[0333] An efficient gRNA target (APOE-E2-gRNA2) for the APOE gene screened in Example 4 was selected, and the target was edited by co-transfecting the plasmid pKG-U6gRNA(APOE-E2-gRNA2) and the plasmid pKG-GE3 into cells; two efficient gRNA targets (FBN1-E25-gRNA4 and FBN1-E25-gRNA6) for the FBN1 gene screened in Example 5 were selected, and the site-directed mutation (FBN1 gene C1039G mutation) was performed by co-transfecting the corresponding two sgRNAs, NCN protein and FBN1-mutant-ss163 donor DNA into cells.

[0334] I. Preparation of gRNA

[0335] 1. Preparation of FBN1-T7-gRNA4 transcription template and FBN1-T7-gRNA6 transcription template.

[0336] The FBN1-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 23.

[0337] The FBN1-T7-gRNA6 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 24.

[0338] 2. In vitro transcription of gRNA

[0339] The FBN1-T7-gRNA4 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification, and FBN1-gRNA4 was obtained. FBN1-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 25.

[0340] SEQ ID NO: 25:

[0341] GGUGCACUUGCCGUGGGUACAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.

[0342] Take FBN1-T7-gRNA6 transcription template, in vitro transcription is carried out by using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then recovered and purified by using MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) to obtain FBN1-gRNA6. FBN1-gRNA6 is single-stranded RNA, as shown in SEQ ID NO: 26.

[0343] SEQ ID NO: 26:

[0344] GGUGCACUUGCCGUGGGUACAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.

[0345] II. Synthesis of single-stranded Donor DNA containing FBN1 mutation site

[0346] Synthesize single-stranded DNA corresponding to C1039G mutation as Donor DNA, which contains PAM sequence synonymous mutation of FBN1-E25-gRNA4 and FBN1-E25-gRNA6 target site in addition to target site mutation. The single-stranded Donor DNA is named FBN1-mutant-ss163.

[0347] FBN1-mutant-ss163 is shown in SEQ ID NO: 27.

[0348] SEQ ID NO: 27:

[0349] ggtttagaatggggtgttgagccctcctcactgatcactgatggacttttAccacattcaatttttgttgaagacatcaacgagtgcaagatgatccccaaTctcGgtacccacggcaagtgcaggaacactatcggcagcttcaagtgcagatgtgacagtg.

[0350] III. Transfection of porcine primary fibroblasts

[0351] 1. Co-transfect pKG-U6gRNA(APOE-E2-gRNA2) plasmid, plasmid pKG-GE3, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 pg pKG-U6gRNA(APOE-E2-gRNA2) plasmid: 1.08 pg pKG-GE3 plasmid: 1 pg FBN1-gRNA4: 1 pg FBN1-gRNA6: 2 pg FBN1-mutant-ss163: 4 pg NCN protein. Co-transfection is performed by electroporation, using a mammalian nucleofection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3 pulses).

[0352] 2. After completing step 1, use complete culture medium to culture for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.

[0353] 3. After completing step 2, trypsinize and collect the cells, then wash with complete culture medium, then resuspend with complete culture medium, then pick up each single cell and transfer to a 96-well plate (1 cell per well, each well contains 100 pl of complete culture medium), and culture for 2 weeks (replace with new complete culture medium every 2-3 days).

[0354] 4. After completing step 3, trypsinize and collect the cells (the cells obtained in each well, about 2 / 3 are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0355] 5. Take the 6-well plate of step 4, culture until the cells reach 80% confluence, trypsinize and collect the cells, and use cell freezing solution (90% complete culture medium + 10% DMSO, by volume) to freeze the cells.

[0356] 6. Take the centrifuge tube of step 4, take the cells, perform cell lysis and extract genomic DNA, and use the primer pair composed of APOE-E2-F and APOE-E2-R and the primer pair composed of FBN1-JDF419 and FBN1-JDR673 to perform PCR amplification, and use the primary porcine fibroblast cells as wild type control (WT).

[0357] 7. Recover the PCR amplification product and sequence to confirm the editing of the APOE gene and the point mutation of the FBN1 gene.

[0358] If the sequencing result of a single cell clone is two, and one is consistent with the sequencing result of the primary porcine fibroblast cells and the other is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary porcine fibroblast cells, the genotype of the single cell clone is heterozygous; if the sequencing result of a single cell clone is two, and both are mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary porcine fibroblast cells, the genotype of the single cell clone is double allele different mutant; if the sequencing result of a single cell clone is one, and is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the primary porcine fibroblast cells, the genotype of the single cell clone is double allele same mutant; if the sequencing result of a single cell clone is one, and is consistent with the sequencing result of the primary porcine fibroblast cells, the genotype of the single cell clone is homozygous wild type.

[0359] The single cell clones with the same number in Table 1 and Table 2 are the same single cell clone.

[0360] The editing result of the APOE gene confirmed by sequencing alignment is shown in Table 1. The genotypes of the single cell clones numbered 2, 7, 17, 19, 22, 24, 28, 30, 33, 36 and 40 are homozygous wild type. The genotypes of the single cell clones numbered 1, 3, 9, 11, 14, 16, 18, 23, 25, 27, 29, 35 and 37 are heterozygous. The genotypes of the single cell clones numbered 5, 10, 26, 31 and 39 are double allele same mutant. The genotypes of the single cell clones numbered 4, 6, 8, 12, 13, 15, 20, 21, 32, 34 and 38 are double allele different mutant. The ratio of obtaining APOE gene editing single cell clones is 72.5%.

[0361] The exemplary sequencing alignment result is shown in Figures 10 to 13 . Figure 10 is the alignment result of reverse sequencing of the single cell clone numbered 2 with the wild type sequence, and is determined as homozygous wild type. Figure 11is the alignment result of reverse sequencing of single cell clone No. 3 with wild type sequence, determined as heterozygous type. Figure 12 is the alignment result of forward sequencing of single cell clone No. 10 with wild type sequence, determined as double allele same mutant type. Figure 13 is the alignment result of forward and reverse sequencing of single cell clone No. 8 with wild type sequence, determined as double allele different mutant type.

[0362] Table 1 Genotype identification results of APOE gene editing

[0363]

[0364]

[0365] The genotype results of FBN1 gene point mutation single cell clones confirmed by sequencing alignment are shown in Table 2. The genotypes of single cell clones No. 3, 8, 17, 21, 33, and 38 are homozygous wild type. The genotypes of single cell clones No. 1, 5, 6, 10, 12, 14, 18, 24, 26, 30, 34, and 35 are heterozygous type. The genotypes of single cell clones No. 2, 7, 9, 13, 20, 22, 23, 25, 27, 28, 31, 36, 37, and 39 are double allele different mutant type. The genotypes of single cell clones No. 4, 11, 15, 16, 19, 29, 32, and 40 are double allele same mutant type. Single cell clones No. 10, 14, 26, and 30 are heterozygous type of target site mutation (i.e. one of the two homologous chromosomes has completed single-stranded Donor DNA replacement). Single cell clones No. 22, 25, 28, and 37 are double allele different mutant type of target site mutation (i.e. one of the two homologous chromosomes has completed single-stranded Donor DNA replacement). Single cell clone No. 15 is double allele same mutant type of target site mutation (i.e. both of the two homologous chromosomes have completed single-stranded Donor DNA replacement). The ratio of FBN1 gene editing single cell clones obtained is 85%, and the ratio of single cell clones with target site mutation obtained is 22.5%.

[0366] Exemplary sequencing alignment results are shown in Figures 14 to 19 . Figure 14 is the alignment result of reverse sequencing of single cell clone No. 3 with wild type sequence, determined as heterozygous type. Figure 15 is the alignment result of reverse sequencing of single cell clone No. 1 with wild type sequence, determined as heterozygous type. Figure 16 is the alignment result of reverse sequencing of single cell clone No. 2 with wild type sequence, determined as double allele different mutant type. Figure 17is the result of reverse sequencing of single cell clone No. 11 and alignment with wild type sequence of target site, determined as biallelic identical mutant. Figure 18 is the result of reverse sequencing of single cell clone No. 10 and alignment with wild type sequence of target site, determined as heterozygous mutant with point mutation of target site. Figure 19 is the result of reverse sequencing of single cell clone No. 15 and alignment with wild type sequence of target site, determined as biallelic identical mutant with point mutation of target site.

[0367] Table 2 Genotype results of single cell clones of point mutation of FBN1 gene

[0368]

[0369]

[0370] Note: Target site mutation refers to the replacement of single strand Donor DNA; that is, the DNA molecule shown in SEQ ID NO: 27 replaces the DNA molecule shown in SEQ ID NO: 28 in the chromosome DNA.

[0371] The single cell clone with APOE gene as biallelic mutant (including biallelic identical mutant or biallelic different mutant) and FBN1 gene as target site mutant heterozygote (target site mutant biallelic different mutant, target site mutant heterozygote) is the target single cell clone. The target single cell clone can be used as a nuclear transfer donor cell for somatic cloning, and a cloned pig, i.e. an atherosclerotic disease model pig, can be obtained.

[0372] The single cell clones No. 10 and 26 are the target single cell clones. The target single cell clone can be used as a nuclear transfer donor cell for somatic cloning, and a cloned pig, i.e. an atherosclerotic disease model pig, can be obtained.

[0373] The above has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviate from the scope disclosed in the present application. Some basic features can be applied within the scope of the following appended claims. SEQUENCE LISTING <110> Nanjing Qi-zhen Gene Engineering Co., Ltd. <120> A gene editing system for constructing AF double gene mutation atherosclerosis model pig nuclear transfer donor cells and application thereof <130> GNCYX211723 <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg tagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740. aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980 gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160 ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Glu Val Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Lys Tyr Val Is His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Is The Asp Is The Asn Is The Asp Lys Is The Best 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Thr Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Thr Wire Only Thr Wire Wire Tyr Wire Thr Wire Lys Asn Wire With Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Serves Asp Val Asp Lys Lew Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Arg Leu Ser Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 930 935 940 His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA [[ID=2C]]213 Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 317 <212> PRT <213> Sus scrofa <400> 8 Met Arg Val Leu Trp Val Ala Leu Val Val Thr Leu Leu Ala Gly Cys 1 5 10 15 Arg Thr Glu Asp Glu Pro Gly Pro Pro Pro Glu Val His Val Trp Trp 20 25 30 Glu Glu Pro Lys Trp Gln Gly Ser Gln Pro Trp Glu Gln Ala Leu Gly 35 40 45 Arg Phe Trp Asp Tyr Leu Arg Trp Val Gln Ser Leu Ser Asp Gln Val 50 55 60 Gln Glu Glu Leu Leu Ser Thr Lys Val Thr Gln Glu Leu Thr Glu Leu 65 70 75 80 Ile Glu Glu Ser Met Lys Glu Val Lys Ala Tyr Arg Glu Glu Leu Glu 85 90 95 Ala Gln Leu Gly Pro Val Thr Gln Glu Thr Gln Ala Arg Leu Ser Lys 100 105 110 Glu Leu Gln Ala Ala Gln Ala Arg Val Gly Ala Asp Met Glu Asp Val 115 120 125 Arg Asn Arg Leu Val Leu Tyr Arg Ser Glu Val His Asn Met Leu Gly 130 135 140 Gln Thr Thr Glu Glu Leu Arg Ser Arg Leu Ala Ser His Leu Arg Asn 145 150 155 160 Val Arg Lys Arg Leu Val Arg Asp Thr Glu Asp Leu Gln Lys Arg Leu 165 170 175 Ala Val Tyr Gln Ala Gly Leu Arg Glu Gly Ala Glu Arg Ser Val Ser 180 185 190 Ala Leu Arg Glu Arg Leu Gly Pro Leu Val Glu Gln Gly Arg Leu Arg 195 200 205 Ala Ala Thr Leu Ser Thr Arg Ala Gly Gln Pro Leu Arg Glu Arg Ala 210 215 220 Glu Ala Trp Gly Gln Lys Leu Arg Gly Arg Leu Glu Glu Met Gly Ser 225 230 235 240 Arg Thr Arg Asp Arg Leu Asp Glu Met Arg Asp Glu Leu Glu Glu Val 245 250 255 Arg Thr Lys Val Glu Glu Gln Gly Ser Gln Leu Arg Leu Gln Ala Glu 260 265 270 Ala Phe Gln Ala Arg Leu Lys Gly Trp Phe Glu Pro Leu Val Glu Asp 275 280 285 Met Arg Arg Gln Trp Ala Gly Leu Val Glu Arg Met Gln Ser Ala Val 290 295 300 Dear Ile Dear Dear Dear Thr Dear Ala Pro Dear Asp Asn Gln 305 310 315 <210> 9 <211> 890 <212> DNA <213> On sow <400> 9 ggaccctcg cctgggaact tccacgtatg ccactggtgc agccctaaaa gacaaacaaa 60 caaaaacgaa agaaagagaa aagaaaggaa agggggcttc tgtttctaat gcgttgttgc 120 ctggcagggc gtgagcatta gatacgtgtc agctgtgact agcgtgcacg gagcacacaa 180 tccatgcttg tccagtaatt agacaggctg ggtgtccttc cacccctccc tgcccaccag 240 tgctctag aagcccacc accggggctg ggggagcacc tgctctgtac caggtaccgt 300 gtgctgggag ggggcagagg acctgatggc tgtgaactgg ctcggtgcag gatgccggac 360 agaggacgag ccggggccgc cgccggaggt gcacgtgtgg tgggaggagc ccaagtggca 420 gggcagccag ccctgggagc aggccctggg ccgcttctgg gattacctgc gctgggtgca 480 gtccctgtct gaccaagtgc aggaggagct gctcagcacc aaggtcaccc aggaactgac 540 gtaagtgccc acccgactcc cgccgcgcgc gcgcgcgcgc gcgcgcgcct gaccctcctg 600 gcgaaccgtg tgttctggac cctcaggctc cacccgtccg ggtttccttc tgtccttgtc 660 gccaactctt gggggtctgg gtctctgttt cttttttttc cttcttcctt ttttgggggg 720 agtttacttt ttcttttttc tttcatttga cttcatgtct tgctttcttt ccatcttgag 780 ctcctgcctt cgcctgtctc tgggtcagtc ttgccgtcct tgctgtctct gaatctctgg 840 cacgtcctgg ccatcgccag ctcaggagcc ctccttctcc ccctccccgc 890 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence<�001487><400> 10 guaaucccag aagcggccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 ugugguggga ggagcccaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 ccugucugac caagugcagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 caccacacgu gcaccuccgg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 2871 <212> PRT <213> Sus scrofa <400> 14 Met Arg Arg Gly Arg Leu Leu Glu Val Ala Leu Gly Phe Thr Val Leu 1 5 10 15 Leu Ala Ser Tyr Thr Ser His Arg Ala Glu Ala Asn Leu Glu Ala Gly 20 25 30 Asn Gly Lys Glu Thr Arg Ala Ser Arg Ala Lys Arg Arg Gly Gly Gly 35 40 45 Gly His Asp Ala Leu Lys Gly Pro Asn Val Cys Gly Ser Arg Tyr Asn 50 55 60 Ala Tyr Cys Cys Pro Gly Trp Lys Thr Leu Pro Gly Gly Asn Gln Cys 65 70 75 80 Ile Val Pro Ile Cys Arg His Ser Cys Gly Asp Gly Phe Cys Ser Arg 85 90 95 Pro Asn Met Cys Thr Cys Pro Ser Gly Gln Ile Ala Pro Ser Cys Gly 100 105 110 Ser Arg Ser Ile Gln His Cys Asn Ile Arg Cys Met Asn Gly Gly Ser 115 120 125 Cys Ser Asp Asp His Cys Leu Cys Gln Lys Gly Tyr Ile Gly Thr His 130 135 140 Cys Gly Gln Pro Val Cys Glu Ser Gly Cys Leu Asn Gly Gly Arg Cys 145 150 155 160 Val Ala Pro Asn Arg Cys Ala Cys Thr Tyr Gly Phe Thr Gly Pro Gln 165 170 175 Cys Glu Arg Asp Tyr Arg Thr Gly Pro Cys Phe Thr Val Val Ser Asn 180 185 190 Gln Met Cys Gln Gly Gln Leu Ser Gly Ile Val Cys Thr Lys Thr Leu 195 200 205 Cys Cys Ala Thr Val Gly Arg Ala Trp Gly His Pro Cys Glu Met Cys 210 215 220 Pro Ala Gln Pro His Pro Cys Arg Arg Gly Phe Ile Pro Asn Ile Arg 225 230 235 240 Thr Gly Ala Cys Gln Asp Val Asp Glu Cys Gln Ala Ile Pro Gly Leu 245 250 255 Cys Gln Gly Gly Asn Cys Ile Asn Thr Val Gly Ser Phe Glu Cys Lys 260 265 270 Cys Pro Ala Gly His Lys Phe Asn Glu Val Ser Gln Lys Cys Glu Asp 275 280 285 Ile Asp Glu Cys Ser Thr Ile Pro Gly Ile Cys Asp Gly Gly Glu Cys 290 295 300 Thr Asn Thr Val Ser Ser Tyr Phe Cys Lys Cys Pro Pro Gly Phe Tyr 305 310 315 320 Thr Ser Pro Asp Gly Thr Arg Cys Ile Asp Val Arg Pro Gly Tyr Cys 325 330 335 Tyr Thr Ala Leu Thr Asn Gly Arg Cys Ser Asn Gln Leu Pro Gln Ser 340 345 350 Ile Thr Lys Met Gln Cys Cys Cys Asp Val Gly Arg Cys Trp Ser Pro 355 360 365 Gly Val Thr Val Thr Pro Glu Met Cys Pro Ile Arg Ala Thr Glu Asp 370 375 380 Phe Asn Lys Leu Cys Ser Val Pro Met Val Val Pro Glu Arg Pro Gly 385 390 395 400 Tyr Pro Ser Pro Pro Leu Gly Pro Ile Pro Pro Val His Pro Val Pro 405 410 415 Pro Gly Phe Pro Pro Gly Pro Gln Ile Pro Val Pro Arg Pro Pro Val 420 425 430 Glu Tyr Pro Tyr Pro Ser Arg Glu Pro Pro Arg Val Leu Pro Val Asn 435 440 445 Val Thr Asp Tyr Cys Gln Leu Phe Arg Tyr Leu Cys His Asn Gly Arg 450 455 460 Cys Ile Pro Thr Pro Gly Ser Tyr Arg Cys Glu Cys Asn Lys Gly Phe 465 470 475 480 Gln Leu Asp Leu Arg Gly Glu Cys Ile Asp Val Asp Glu Cys Glu Lys 485 490 495 Asn Pro Cys Ala Gly Gly Glu Cys Ile Asn Asn Gln Gly Ser Tyr Thr 500 505 510 Cys Gln Cys Arg Pro Gly Tyr Gln Ser Thr Leu Thr Arg Thr Glu Cys 515 520 525 Arg Asp Ile Asp Glu Cys Leu Gln Asn Gly Arg Ile Cys Asn Asn Gly 530 535 540 Arg Cys Ile Asn Thr Asp Gly Ser Phe His Cys Val Cys Asn Ala Gly 545 550 555 560 Phe His Val Thr Arg Asp Gly Lys Asn Cys Glu Asp Met Asp Glu Cys 565 570 575 Ser Ile Arg Asn Met Cys Leu Asn Gly Met Cys Ile Asn Glu Asp Gly 580 585 590 Ser Phe Lys Cys Ile Cys Lys Pro Gly Phe Gln Leu Ala Ser Asp Gly 595 600 605 Arg Tyr Cys Lys Asp Ile Asn Glu Cys Glu Thr Ser Gly Ile Cys Met 610 615 620 Asn Gly Arg Cys Val Asn Thr Asp Gly Ser Tyr Arg Cys Glu Cys Phe 625 630 635 640 Pro Gly Leu Ala Val Gly Leu Asp Gly Arg Val Cys Val Asp Thr His 645 650 655 Met Arg Ser Thr Cys Tyr Gly Gly Tyr Lys Arg Gly Gln Cys Val Lys 660 665 670 Pro Leu Phe Gly Ala Val Thr Lys Ser Glu Cys Cys Cys Ala Ser Thr 675 680 685 Glu Tyr Ala Phe Gly Glu Pro Cys Gln Pro Cys Pro Ser Gln Asn Ser 690 695 700 Ala Glu Tyr Gln Ala Leu Cys Ser Ser Gly Pro Gly Met Thr Ser Ala 705 710 715 720 Gly Ser Asp Ile Asn Glu Cys Ala Leu Asp Pro Asp Ile Cys Pro Asn 725 730 735 Gly Ile Cys Glu Asn Leu Arg Gly Thr Tyr Lys Cys Ile Cys Asn Ser 740 745 750 Gly Tyr Glu Val Asp Ser Thr Gly Lys Asn Cys Val Asp Ile Asn Glu 755 760 765 Cys Val Leu Asn Ser Leu Leu Cys Asp Asn Gly Gln Cys Arg Asn Thr 770 775 780 Pro Gly Ser Phe Val Cys Thr Cys Pro Lys Gly Phe Ile Tyr Lys Pro 785 790 795 800 Asp Leu Lys Thr Cys Glu Asp Ile Asp Glu Cys Glu Ser Ser Pro Cys 805 810 815 Ile Asn Gly Val Cys Lys Asn Ser Pro Gly Ser Phe Ile Cys Glu Cys 820 825 830 Ser Ser Glu Ser Thr Leu Asp Pro Thr Lys Thr Ile Cys Ile Glu Thr 835 840 845 Ile Lys Gly Thr Cys Trp Gln Thr Ile Ile Asp Gly Arg Cys Glu Ile 850 855 860 Asn Ile Asn Gly Ala Thr Leu Lys Ser Gln Cys Cys Ser Ser Leu Gly 865 870 875 880 Ala Ala Trp Gly Ser Pro Cys Thr Pro Cys Gln Val Asp Pro Ile Cys 885 890 895 Gly Lys Gly Tyr Ser Arg Ile Lys Gly Thr Gln Cys Glu Asp Ile Asp 900 905 910 Glu Cys Glu Val Phe Pro Gly Val Cys Lys Asn Gly Leu Cys Val Asn 915 920 925 Ser Lys Gly Ser Phe Lys Cys Gln Cys Pro Asn Gly Met Thr Leu Asp 930 935 940 Ala Thr Gly Arg Ile Cys Leu Asp Ile Arg Leu Glu Thr Cys Phe Leu 945 950 955 960 Arg Tyr Glu Asp Glu Glu Cys Thr Leu Pro Val Val Gly Arg His Arg 965 970 975 Met Asp Ala Cys Cys Cys Ser Val Gly Ala Ala Trp Gly Thr Glu Glu 980 985 990 Cys Glu Glu Cys Pro Pro Arg Asn Thr Pro Glu Tyr Glu Glu Leu Cys 995 1000 1005 Pro Arg Gly Pro Gly Phe Ala Thr Lys Glu Ile Thr Asn Gly Lys Pro 1010 1015 1020 Phe Phe Lys Asp Ile Asn Glu Cys Lys Met Ile Pro Asn Leu Cys Thr 1025 1030 1035 1040 His Gly Lys Cys Arg Asn Thr Ile Gly Ser Phe Lys Cys Arg Cys Asp 1045 1050 1055 Ser Gly Phe Ala Leu Asp Ser Glu Glu Arg Asn Cys Thr Asp Ile Asp 1060 1065 1070 Glu Cys Arg Ile Ser Pro Asp Leu Cys Gly Arg Gly Gln Cys Val Asn 1075 1080 1085 Thr Pro Gly Asp Phe Glu Cys Lys Cys Asp Glu Gly Tyr Glu Ser Gly 1090 1095 1100 Phe Met Met Met Lys Asn Cys Met Asp Ile Asp Glu Cys Gln Arg Asp 1105 1110 1115 1120 Pro Leu Leu Cys Arg Gly Gly Val Cys Leu Asn Thr Glu Gly Ser Tyr 1125 1130 1135 Arg Cys Glu Cys Pro Ser Gly His Gln Met Ser Pro Asn Ile Ser Ala 1140 1145 1150 Cys Ile Asp Ile Asn Glu Cys Glu Leu Ser Ala His Leu Cys Pro His 1155 1160 1165 Gly Arg Cys Val Asn Leu Ile Gly Lys Tyr Gln Arg Ala Arg Asn Pro 1170 1175 1180 Gly Tyr His Ser Thr Pro Asp Arg Leu Phe Cys Val Asp Ile Asp Glu 1185 1190 1195 1200 Cys Ser Ile Met Asn Gly Gly Cys Glu Thr Phe Cys Thr Asn Ser Glu 1205 1210 1215 Gly Ser Tyr Glu Cys Ser Cys Gln Pro Gly Phe Ala Leu Met Pro Asp 1220 1225 1230 Gln Arg Ser Cys Thr Asp Ile Asp Glu Cys Glu Asp Asn Pro Asn Ile 1235 1240 1245 Cys Asp Gly Gly Gln Cys Thr Asn Ile Pro Gly Glu Tyr Arg Cys Leu 1250 1255 1260 Cys Tyr Asp Gly Phe Met Ala Ser Glu Asp Met Lys Thr Cys Val Asp 1265 1270 1275 1280 Val Asn Glu Cys Asp Leu Asn Pro Asn Ile Cys Leu Ser Gly Thr Cys 1285 1290 1295 Glu Asn Thr Lys Gly Ser Phe Ile Cys His Cys Asp Met Gly Tyr Ser 1300 1305 1310 Gly Lys Lys Gly Lys Thr Gly Cys Thr Asp Ile Asn Glu Cys Glu Ile 1315 1320 1325 Gly Ala His Asn Cys Asp Arg His Ala Val Cys Thr Asn Thr Ala Gly 1330 1335 1340 Ser Phe Asn Cys Ser Cys Ser Pro Gly Trp Ile Gly Asp Gly Ile Lys 1345 1350 1355 1360 Cys Thr Asp Leu Asp Glu Cys Ser Asn Gly Thr His Met Cys Ser Gln 1365 1370 1375 His Ala Asp Cys Lys Asn Thr Met Gly Ser Tyr Arg Cys Leu Cys Lys 1380 1385 1390 Glu Gly Tyr Thr Gly Asp Gly Phe Thr Cys Ala Asp Leu Asp Glu Cys 1395 1400 1405 Ser Glu Asn Val Lys Leu Cys Gly Asn Val Gln Cys Leu Tyr Ala Pro 1410 1415 1420 Gly Gly Tyr His Cys Glu Tyr Asp Met Gly Phe Val Pro Ser Ala Asp 1425 1430 1435 1440 Arg Lys Ser Cys Val Asp Ser Asp Glu Cys Ser Leu Pro Asn Ile Cys 1445 1450 1455 Val Phe Gly Thr Cys His Asn Leu Pro Gly Leu Phe Arg Cys Glu Cys 1460 1465 1470 Glu Ile Gly Tyr Glu Leu Asp Arg Ser Gly Gly Asn Cys Thr Asp Val 1475 1480 1485 Asn Glu Cys Leu Glu Pro Pro Thr Cys Ile Ser Gly Asn Cys Val Asn 1490 1495 1500 Thr Pro Gly Ser Tyr Thr Cys Val Cys Pro Pro Asp Phe Glu Leu Asn 1505 1510 1515 1520 Pro Thr Arg Val Gly Cys Val Asp Thr Arg Ser Gly Asn Cys Tyr Leu 1525 1530 1535 Asp Val Arg Pro Arg Gly Asp Asn Gly Asp Thr Ala Cys Ser Asn Glu 1540 1545 1550 Ile Gly Val Gly Val Ser Lys Ala Ser Cys Cys Cys Ser Leu Gly Lys 1555 1560 1565 Ala Trp Gly Thr Pro Cys Glu Gln Cys Pro Pro Val Asn Thr Ser Glu 1570 1575 1580 Tyr Lys Ile Leu Cys Pro Gly Gly Glu Gly Phe Arg Pro Asn Pro Ile 1585 1590 1595 1600 Thr Val Ile Leu Glu Asp Ile Asp Glu Cys Gln Glu Leu Pro Gly Leu 1605 1610 1615 Cys Gln Gly Gly Lys Cys Ile Asn Thr Phe Gly Ser Phe Gln Cys Arg 1620 1625 1630 Cys Pro Thr Gly Tyr Tyr Leu Asn Glu Asp Thr Arg Val Cys Asp Asp 1635 1640 1645 Val Asn Glu Cys Glu Thr Pro Gly Ile Cys Gly Pro Gly Thr Cys Tyr 1650 1655 1660 Asn Thr Val Gly Asn Tyr Thr Cys Ile Cys Pro Pro Asp Tyr Met Gln 1665 1670 1675 1680 Val Asn Gly Gly Asn Asn Cys Met Asp Met Arg Arg Ser Leu Cys Tyr 1685 1690 1695 Arg Asn Tyr Tyr Ala Asp Asn Gln Thr Cys Asp Gly Glu Leu Leu Phe 1700 1705 1710 Asn Met Thr Lys Lys Met Cys Cys Cys Ser Tyr Asn Ile Gly Arg Ala 1715 1720 1725 Trp Asn Lys Pro Cys Glu Gln Cys Pro Ile Pro Ser Thr Asp Glu Phe 1730 1735 1740 Ala Thr Leu Cys Gly Ser Gln Arg Pro Gly Phe Val Ile Asp Ile Tyr 1745 1750 1755 1760 Thr Gly Leu Pro Val Asp Ile Asp Glu Cys Arg Glu Ile Pro Gly Val 1765 1770 1775 Cys Glu Asn Gly Val Cys Ile Asn Met Val Gly Ser Phe Arg Cys Glu 1780 1785 1790 Cys Pro Val Gly Phe Phe Tyr Asn Asp Lys Leu Leu Val Cys Glu Asp 1795 1800 1805 Ile Asp Glu Cys Gln Asn Gly Pro Val Cys Gln Arg Asn Ala Glu Cys 1810 1815 1820 Ile Asn Thr Ala Gly Ser Tyr Arg Cys Asp Cys Lys Pro Gly Tyr Arg 1825 1830 1835 1840 Phe Thr Ser Thr Gly Gln Cys Asn Asp Arg Asn Glu Cys Gln Glu Ile 1845 1850 1855 Pro Asn Ile Cys Ser His Gly Gln Cys Ile Asp Thr Val Gly Ser Phe 1860 1865 1870 Tyr Cys Leu Cys His Thr Gly Phe Lys Thr Asn Ala Asp Gln Thr Met 1875 1880 1885 Cys Leu Asp Ile Asn Glu Cys Glu Arg Asp Ala Cys Gly Asn Gly Thr 1890 1895 1900 Cys Arg Asn Thr Ile Gly Ser Phe Asn Cys Arg Cys Asn His Gly Phe 1905 1910 1915 1920 Ile Leu Ser His Asn Asn Asp Cys Ile Asp Val Asp Glu Cys Ala Thr 1925 1930 1935 Gly Asn Gly Asn Leu Cys Arg Asn Gly Gln Cys Ile Asn Thr Val Gly 1940 1945 1950 Ser Phe Gln Cys Gln Cys Asn Glu Gly Tyr Glu Val Ala Pro Asp Gly 1955 1960 1965 Arg Thr Cys Val Asp Ile Asn Glu Cys Leu Leu Glu Pro Gly Lys Cys 1970 1975 1980 Ala Pro Gly Thr Cys Gln Asn Leu Asp Gly Ser Tyr Arg Cys Ile Cys 1985 1990 1995 2000 Pro Pro Gly Tyr Ser Leu Gln Asn Asp Lys Cys Glu Asp Ile Asp Glu 2005 2010 2015 Cys Val Glu Glu Pro Glu Ile Cys Ala Leu Gly Thr Cys Ser Asn Thr 2020 2025 2030 Glu Gly Ser Phe Lys Cys Leu Cys Pro Asp Gly Phe Ser Leu Ser Ser 2035 2040 2045 Thr Gly Arg Arg Cys Gln Asp Leu Arg Met Ser Tyr Cys Tyr Ala Lys 2050 2055 2060 Phe Glu Gly Gly Lys Cys Ser Ser Pro Lys Ser Arg Asn His Ser Lys 2065 2070 2075 2080 Gln Glu Cys Cys Cys Ala Leu Lys Gly Glu Gly Trp Gly Asp Pro Cys 2085 2090 2095 Glu Leu Cys Pro Thr Glu Pro Asp Glu Ala Phe Arg Gln Ile Cys Pro 2100 2105 2110 Tyr Gly Ser Gly Ile Ile Val Gly Pro Asp Asp Ser Ala Val Asp Met 2115 2120 2125 Asp Glu Cys Lys Glu Pro Asp Val Cys Lys His Gly Gln Cys Ile Asn 2130 2135 2140 Thr Asp Gly Ser Tyr Arg Cys Glu Cys Pro Phe Gly Tyr Ile Leu Glu 2145 2150 2155 2160 Gly Asn Glu Cys Val Asp Thr Asp Glu Cys Ser Val Gly Asn Pro Cys 2165 2170 2175 Gly Asn Gly Thr Cys Lys Asn Val Ile Gly Gly Phe Glu Cys Thr Cys 2180 2185 2190 Glu Glu Gly Phe Glu Pro Gly Pro Met Met Thr Cys Glu Asp Ile Asn 2195 2200 2205 Glu Cys Ala Gln Asn Pro Leu Leu Cys Ala Phe Arg Cys Val Asn Thr 2210 2215 2220 Tyr Gly Ser Tyr Glu Cys Lys Cys Pro Thr Gly Tyr Val Leu Arg Glu 2225 2230 2235 2240 Asp Arg Arg Met Cys Lys Asp Glu Asp Glu Cys Glu Glu Gly Lys His 2245 2250 2255 Asp Cys Ala Glu Lys Gln Met Glu Cys Lys Asn Leu Ile Gly Met Tyr 2260 2265 2270 Ile Cys Ile Cys Gly Pro Gly Tyr Gln Arg Arg Pro Asp Gly Glu Gly 2275 2280 2285 Cys Val Asp Glu Asn Glu Cys Gln Thr Lys Pro Gly Ile Cys Glu Asn 2290 2295 2300 Gly Arg Cys Leu Asn Thr Arg Gly Ser Tyr Thr Cys Glu Cys Asn Asp 2305 2310 2315 2320 Gly Phe Thr Ala Ser Pro Thr Gln Asp Glu Cys Leu Asp Asn Arg Glu 2325 2330 2335 Gly Tyr Cys Phe Thr Glu Val Leu Gln Asn Met Cys Gln Ile Gly Ser 2340 2345 2350 Ser Asn Arg Asn Pro Val Thr Lys Ser Glu Cys Cys Cys Asp Gly Gly 2355 2360 2365 Arg Gly Trp Gly Pro His Cys Glu Ile Cys Pro Phe Gln Gly Thr Val 2370 2375 2380 Ala Phe Lys Lys Leu Cys Pro His Gly Arg Gly Phe Met Thr Asn Gly 2385 2390 2395 2400 Ala Asp Ile Asp Glu Cys Lys Val Ile His Asp Val Cys Arg Asn Gly 2405 2410 2415 Glu Cys Ile Asn Asp Arg Gly Ser Tyr His Cys Ile Cys Lys Thr Gly 2420 2425 2430 Tyr Thr Pro Asp Ile Thr Gly Thr Ala Cys Val Asp Leu Asn Glu Cys 2435 2440 2445 Asn Gln Ala Pro Lys Pro Cys Asn Phe Ile Cys Lys Asn Thr Glu Gly 2450 2455 2460 Ser Tyr Gln Cys Ser Cys Pro Lys Gly Tyr Ile Leu Gln Glu Asp Gly 2465 2470 2475 2480 Arg Ser Cys Lys Asp Leu Asp Glu Cys Ala Thr Lys Gln His Asn Cys 2485 2490 2495 Gln Phe Leu Cys Val Asn Thr Ile Gly Ser Phe Ala Cys Lys Cys Pro 2500 2505 2510 Pro Gly Phe Thr Gln His His Thr Ala Cys Ile Asp Asn Asn Glu Cys 2515 2520 2525 Thr Ser Asp Ile Asn Leu Cys Gly Ala Lys Gly Ile Cys Gln Asn Thr 2530 2535 2540 Pro Gly Ser Phe Thr Cys Glu Cys Gln Arg Gly Phe Ser Leu Asp Gln 2545 2550 2555 2560 Ser Gly Ala Ser Cys Glu Asp Val Asp Glu Cys Glu Gly Asn His Arg 2565 2570 2575 Cys Gln His Gly Cys Gln Asn Ile Ile Gly Gly Tyr Arg Cys Ser Cys 2580 2585 2590 Pro Gln Gly Tyr Leu Gln His Tyr Gln Trp Asn Gln Cys Val Asp Glu 2595 2600 2605 Asn Glu Cys Leu Ser Ala His Ile Cys Gly Gly Ala Ser Cys His Asn 2610 2615 2620 Thr Leu Gly Ser Tyr Lys Cys Met Cys Pro Ala Gly Phe Gln Tyr Glu 2625 2630 2635 2640 Gln Phe Ser Gly Gly Cys Gln Asp Ile Asn Glu Cys Gly Ser Ser Gln 2645 2650 2655 Ala Pro Cys Ser Tyr Gly Cys Ser Asn Thr Glu Gly Gly Tyr Leu Cys 2660 2665 2670 Gly Cys Pro Pro Gly Tyr Phe Arg Ile Gly Gln Gly His Cys Val Ser 2675 2680 2685 Gly Met Gly Met Gly Arg Gly Ser Pro Glu Pro Pro Ala Ser Gly Glu 2690 2695 2700 Met Asp Asp Asn Ser Leu Ser Pro Glu Ala Cys Tyr Glu Cys Lys Ile 2705 2710 2715 2720 Asn Gly Tyr Pro Lys Arg Gly Arg Lys Arg Arg Ser Thr Asn Glu Thr 2725 2730 2735 Asp Ala Phe Asn Ile Glu Asp Gln Pro Glu Thr Glu Ser Asn Val Ser 2740 2745 2750 Leu Ala Ser Trp Asp Val Glu Lys Thr Ala Val Phe Ala Phe Asn Ile 2755 2760 2765 Ser His Ile Ser Asn Lys Val Arg Ile Leu Glu Leu Leu Pro Ala Leu 2770 2775 2780 Thr Thr Leu Thr Asn His Asn Arg Tyr Leu Ile Glu Ser Gly Asn Glu 2785 2790 2795 2800 Asn Gly Phe Phe Lys Ile Asn Gln Lys Glu Gly Ile Ser Tyr Leu His 2805 2810 2815 Phe Thr Lys Lys Lys Pro Val Ala Gly Thr Tyr Ser Leu Gln Ile Ser 2820 2825 2830 Ser Thr Pro Leu Tyr Lys Lys Lys Glu Leu Asn Gln Leu Glu Asp Lys 2835 2840 2845 Tyr Asp Lys Asp Tyr Leu Ser Gly Glu Leu Gly Asp Asn Leu Lys Met 2850 2855 2860 Lys Ile Gln Ile Leu Leu His 2865 2870 <210> 15 <211> 926 <212> DNA <213> On sow <400> 15 taaatgaata tctcattcca ctacatactc aattggttgc tctgaggcaa tctatttaaa 60 aatcttctac atgctttaga tacagaagct aatggtttag aatttttatt cttacaagca 120 attacttcag tgtttagtgt gtataaggta gtgccctggg ctttagaagt ccaagtaaac 180 acactcttta cttctttaat acgcctttct aaaatgtaga cttttaaaag tctagaactg 240 tttacggaat cctatttctc acggatcatc acatatcttt aaaactgagt atgaccaaga 300 ccttaaatca agatcctcta attcctgggt ttagaatggg gtgttgagcc ctcctcactg 360 atcactgatg gacttttccc acattcaatt tttgttgaag acatcaacga gtgcaagatg 420 atccccaacc tctgtaccca cggcaagtgc aggaacacta tcggcagctt caagtgcaga 480 tgtgacagtg gctttgctct ggactctgaa gaaaggaact gtacaggtca gtaaggggct 540 tagcccagag ggacatcccc tgggacacct cgcctttaac ccactgcctc aagaaggaaa 600 gcgttcctgc tgctcatttg ctgcccttgc tgctcctgtg cagatattga tgaatgccgc 660 atttctcctg acctctgtgg ccgaggccag tgtgtgaaca cccctgggga cttcgaatgc 720 aagtgtgatg aaggctatga aagtggattc atgatgatga agaactgcat gggtaagtgg 780 gtgagccttt gatcatacaa attctaagaa gctttggtga ctcatctcct gtgttcccag 840 ttcttcctgc tcccctaaag ccctggtctc ctgaccagtg agtcagcaat tggtcagttg 900 cagagagaga ctgacatgtg gaagga 926 <210> 16 <211> 100 <212> RNA <213> Artificial Sequence <400> 16 auccccaacc ucuguaccca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 17 <211> 100 <212> RNA <213> Artificial Sequence <400> 17 aguguuccug cacuugccgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 18 <211> 100 <212> RNA <213> Artificial Sequence <400> 18 uaguguuccu gcacuugccg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 19 <211> 100 <212> RNA <213> Artificial Sequence <400> 19 ugcacuugcc guggguacag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 20 <211> 100 <212> RNA <213> Artificial Sequence <400> 20 ggcaagugca ggaacacuau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 21 <211> 100 <212> RNA <213> Artificial Sequence <400> 21 cuucaacaaa aauugaaugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 22 <211> 100 <212> RNA <213> Artificial Sequence <400> 22 ucuucaacaa aaauugaaug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 23 <211> 225 <212> DNA <213> Artificial Sequence <400> 23 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggtgcac ttgccgtggg tacaggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 24 <211> 225 <212> DNA <213> Artificial Sequence <400> 24 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttca acaaaaattg aatgtgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 25 <211> 102 <212> RNA <213> Artificial Sequence <400> 25 ggugcacuug ccguggguac agguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 26 <211> 102 <212> RNA <213>Artificial Sequence <400>26 ggcuucaaca aaaauugaau guguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210>27 <211>163 <212>DNA <213>Artificial Sequence <400>27 ggtttagaat ggggtgttga gccctcctca ctgatcactg atggactttt accacattca 60 atttttgttg aagacatcaa cgagtgcaag atgatcccca atctcggtac ccacggcaag 120 tgcaggaaca ctatcggcag cttcaagtgc agatgtgaca gtg 163 <210>28 <211>163 <212>DNA <213>Sus scrofa <400>28 ggtttagaat ggggtgttga gccctcctca ctgatcactg atggactttt cccacattca 60 atttttgttg aagacatcaa cgagtgcaag atgatcccca acctctgtac ccacggcaag 120 tgcaggaaca ctatcggcag cttcaagtgc agatgtgaca gtg 163 <210>29 <211>10476 <212>DNA <213> Artificial Sequence <400> 29 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300 gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360 gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420 cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600 ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660 tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720 ggggaggggt cggcaattga tccggtgcct agaaaggtg gcgcggggta aactgggaaa 780 gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840 footgtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900 cggtgccacc atggactata aggaccacga cggagactac aggatcatg atattgatta 960 caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020 gaaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080 cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140 cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200 cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agaaccgc 1260 cagaaaga tacaccagac ggagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320 cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380 agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440 ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500 ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560 cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620 ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680 caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740 gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800 gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860 ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920 cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980 gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040 ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100 agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160 ccaggaaag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220 actgctcgtg aagctgaaca gagaggacct gctgggaag cagcggacct tcgacaacgg 2280 cagcatcccc caccagatcc acctgggaga gctccacgcc attctgcggc ggcaggaga 2340 tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400 cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460 gagcgaggaa accatcacccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520 ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580 gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640 atacgtgacc gaggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700 cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760 cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820 cgcctccctg ggcacatacc acgatctgct gaaaattatc areacaagg acttcctgga 2880 2940 cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000 gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060 cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120 cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180 ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240 cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300 gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360 gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420 caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480 cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540 ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600 ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660 caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720 cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780 gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840 aaagcacgtg gcacagatcc tggactccg gatgaacact aagtacgacg agaatgacaa 3900 gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960 ggattccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020 cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080 cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140 aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200 cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260 aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320 catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380 gtctatcctg cccaagagga acagcgataa gctgatcgcc agaagaagg actgggaccc 4440 tagaaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500 agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gaggctgctgg ggatcaccat 4560 catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620 agaagtgaaa agaagcctga tcatcaagct gcctaagtac tccctgttcg agctgggaaaa 4680 cggccggaag agaatgctgg cctctgccgg cgaactgcag aaggggaaacg aactggccct 4740 gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800 ccccgaggat aatgagcaga aacagctggtt tgtggagacag caaagcact acctggacga 4860 gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920 caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980 tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040 caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100 ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160 caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220 gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280 aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340 gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400 cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460 cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520 cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580 cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640 cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700 cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760 caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820 gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880 gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940 ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000 cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060 caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120 gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180 cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240 ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300 ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360 ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420 gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480 ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540 ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600 ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660 cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720 caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840 tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900 gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960 tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020 tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080 gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140 cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200 caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260 tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320 agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380 ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560 tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620 cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680 cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740 aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800 ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860 gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920 atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980 cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040 ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100 taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160 aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220 ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280 tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340 ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400 ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640 tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000 cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480 ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960 taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440 ggttcctggc cttttgctgg ccttttgctc acatgt 10476 <210> 30 <211> 3120 <212> DNA <213> Artificial Sequence <400> 30 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaagaagagt atgagtattc aacatttccg tgtcgccctt attcccttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgctttttttg caacacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 780 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga obedientctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280 ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340 tgttagagag ataattggaa ttaatttgac tgtaaacaca aagattag tacaaaatac 2400 gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460 ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520 gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580 ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640 tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700 ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760 accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880 ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940 gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

Claims

1. A kit comprising plasmid pKG-U6gRNA (APOE-E2-gRNA2), a plasmid expressing Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein; Plasmid pKG-U6gRNA(APOE-E2-gRNA2) which transcribes sgRNA APOE-E2-gRNA2 ; sgRNA APOE-E2-gRNA2 is sgRNA, the target sequence binding region of which is shown as nucleotides 1-20 in SEQ ID NO: 11; the plasmid expressing Cas9 protein is shown as SEQ ID NO: 29; FBN1-gRNA4 is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 25; FBN1-gRNA6 is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 26; FBN1-mutant-ss163 is a single-stranded DNA molecule shown as SEQ ID NO: 27; the NCN protein is shown as SEQ ID NO: 3; the preparation method of the NCN protein comprises the following steps: (1) introducing plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain a recombinant bacterium; (2) culturing the recombinant bacterium in a liquid medium at 30℃, then adding IPTG and inducing culture at 25℃, and then collecting the bacterial bodies; (3) subjecting the collected bacterial bodies to bacterial body disruption to collect a crude protein solution; (4) purifying the fusion protein with His6 tag from the crude protein solution by affinity chromatography; (5) subjecting the fusion protein with His6 tag to enterokinase enzyme cutting, then removing the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein; the plasmid pKG-GE4 is shown as SEQ ID NO: 1; the kit is used for the following (a) or (b) or (c) : (a) preparing a recombinant cell; (b) preparing an atherosclerosis model pig; (c) preparing an atherosclerotic cell model or an atherosclerotic tissue model or an atherosclerotic organ model.

2. The kit of claim 1, wherein: The kit further comprises a pig cell. 3.A method for preparing a recombinant cell, comprising the following steps: co-transfecting plasmid pKG-U6gRNA (APOE-E2-gRNA2), a plasmid expressing Cas9 protein, FBN1-gRNA4, FBN1-gRNA6, FBN1-mutant-ss163 and NCN protein into a pig cell to obtain a recombinant cell in which the APOE gene is mutated and the FBN1 gene is mutated; the FBN1 gene being mutated refers to that the DNA molecule shown as SEQ ID NO: 27 is used to replace the DNA molecule shown as SEQ ID NO: 28 in the chromosomal DNA of the pig cell to obtain the recombinant cell; Plasmid pKG-U6gRNA(APOE-E2-gRNA2) which transcribes sgRNA APOE-E2-gRNA2 ; sgRNA APOE-E2-gRNA2 is sgRNA, the target sequence binding region of which is shown as nucleotides 1-20 in SEQ ID NO: 11; the plasmid expressing Cas9 protein is shown as SEQ ID NO: 29; FBN1-gRNA4 is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 25; FBN1-gRNA6 is sgRNA, and the target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 26; FBN1-mutant-ss163 is a single-stranded DNA molecule as shown in SEQ ID NO: 27; the NCN protein is as shown in SEQ ID NO: 3; the preparation method of the NCN protein comprises the following steps: (1) introducing the plasmid pKG-GE4 into Escherichia coli BL21(DE3) to obtain a recombinant bacterium; (2) culturing the recombinant bacterium at 30°C using a liquid medium, then adding IPTG and inducing culture at 25°C, and then collecting the bacterium; (3) performing bacterium crushing on the collected bacterium to collect a crude protein solution; (4) purifying the fusion protein with His6 tag from the crude protein solution using affinity chromatography; (5) performing enterokinase enzyme cutting on the fusion protein with His6 tag, then removing the protein with His6 tag using Ni-NTA resin to obtain the purified NCN protein; the plasmid pKG-GE4 is as shown in SEQ ID NO: 1.

Images