Application of rice RLK mutant in promoting plant growth or rice-oil crop rotation

Abstract

The present invention belongs to the technical field of agriculture, and specifically relates to the application of Osflr3 or Osflr11 rice mutants in promoting plant growth or rice-oil rotation. The inventors of this patent found that the Osflr3 or Osflr11 gene is a key factor affecting the participation of rice roots in the soil in rice-oil rotation, and obtained and applied excellent gene resources of rice that promote rice-oil rotation. The Osflr3 or Osflr11 gene in rice was site-directed edited by the CRISPR / Cas9 technology, and after further removing the Cas9 background by self-crossing, the genetic stability was stronger. The site-directed edited rice materials have a good effect on the growth of rapeseed.

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture, and particularly relates to the application of Osflr3 or Osflr11 rice mutants in promoting plant growth or rice-oil rotation. Background Art

[0002] FERONIA (FER), an important member of the RLK subfamily Catharanthus roseus RLK1-like (CrRLK1L), has been reported that the mutation of FER (fer8) in Arabidopsis thaliana can enrich beneficial microbial flora (such as Pseudomonas fluorescens) to promote the growth of other plants, but the growth of Arabidopsis thaliana is inhibited due to the mutation of FER. The immune suppression mediated by the FER module can form a special microbial flora to relieve low-phosphorus stress. It reveals that Arabidopsis thaliana balances plant immune responses, microbial community composition, and mineral absorption through regulatory mechanisms under nutrient stress conditions.

[0003] Grain and oil security is a major event related to the national economy and people's livelihood and long-term stability. The rice-oil rotation system is an effective means to ensure national grain and oil security. The soil of rice roots is closely related to soil fertility. Therefore, studying the root soil is the basis for increasing production and efficiency under the rice-oil rotation system. Under the rice-oil rotation mode, the rice root microbiota regulates the efficient utilization of soil or crop nutrients, and great progress has been made in the research on the physiological mechanism affecting rice-oil rotation. However, excellent rice gene resources that promote rice-oil rotation are still very scarce, and there are no relevant reports. Studying and utilizing excellent rice gene resources that promote rice-oil rotation to increase rapeseed yield and giving full play to the advantages of rapeseed in improving soil fertility and increasing grain production will bring basic guarantees for China's grain and oil security. Summary of the Invention

[0004] The main technical problem to be solved by the present invention is: how to use genetic engineering means to edit the OsFLR3 or OsFLR11 gene to obtain rice mutants participating in rice-oil rotation and increase grain yield.

[0005] Application of Osflr3 or Osflr11 rice mutants in promoting plant growth, with the OsFLR3 gene being low-expressed or not expressed in the Osflr3 rice mutant respectively; the OsFLR11 gene being low-expressed or not expressed in the Osflr11 rice mutant.

[0006] Preferably, the nucleotide sequence of the OsFLR3 gene is as shown in SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is as shown in SEQ ID NO.2; the amino acid sequence encoded by the OsFLR3 gene is respectively SEQ ID NO.3; the amino acid sequence encoded by the OsFLR11 gene is as shown in SEQ ID NO.4.

[0007] Preferably, gene editing means are used to achieve low expression or non-expression of the OsFLR3 gene in the Osflr3 rice mutant; gene editing means are used to achieve low expression or non-expression of the OsFLR11 gene in the Osflr11 rice mutant.

[0008] Preferably, the gene editing is to perform site-directed editing on the rice Osflr3 or Osflr11 gene by using CRISPR / Cas9 gene editing or interference technology.

[0009] Preferably, the specific method of the CRISPR / Cas9 gene editing technology is as follows: using the rice Osflr3 or Osflr11 gene as a target, designing a CRISPR / Cas9-based sgRNA sequence, ligating the DNA fragment encoding the above sgRNA into a CRISPR / Cas9 vector and transforming rice to achieve site-directed editing of the rice OsFLR3 or OsFLR11 gene, and obtaining a rice variety with low expression or non-expression of the OsFLR3 or OsFLR11 gene; the regions of site-directed editing of the OsFLR3 or OsFLR11 include the promoter, 5'-UTR, coding region and 3'-UTR.

[0010] Preferably, the nucleotide sequence of the sgRNA of the Osflr3 gene includes one of those shown in SEQ ID NO: 6-7; the nucleotide sequence of the sgRNA of the Osflr11 gene includes one of those shown in SEQ ID NO: 10-11.

[0011] Preferably, the plant is rapeseed.

[0012] Application of the Osflr3 or Osflr11 rice mutant in rice-oilseed rape rotation, with low expression or non-expression of the OsFLR3 gene in the Osflr3 rice mutant; low expression or non-expression of the OsFLR11 gene in the Osflr11 rice mutant.

[0013] Preferably, the method for obtaining the Osflr3 or Osflr11 rice mutant is as follows: constructing a target expression vector by using the CRISPR / cas9 gene knockout system, transforming the expression vector into rice callus by an Agrobacterium-mediated method, performing site-directed knockout of the OsFLR3 or OsFLR11 gene, and obtaining the Osflr3 or Osflr11 rice mutant; the nucleotide sequence of the OsFLR3 gene is as shown in SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is as shown in SEQ ID NO.2; the amino acid sequence encoded by the OsFLR3 gene is respectively SEQ ID NO.3; the amino acid sequence encoded by the OsFLR11 gene is as shown in SEQ ID NO.4.

[0014] The present invention targets the rice Osflr3 or Osflr11 gene, designs the sgRNA sequence of CRISPR / Cas9, ligates the DNA fragment encoding the above sgRNA into the CRISPR / Cas9 vector, then transforms rice, obtains the editing materials of the rice Osflr3 or Osflr11 gene, and finds that the soil of its root system has an obvious promoting effect on the growth of rapeseed.

[0015] The inventors of the present invention previously planted Osflr3 or Osflr11 mutants and found that the growth conditions were similar to those of Nipponbare and were not significantly affected. Rapeseed was planted with the soil of the Osflr3 or Osflr11 mutant root system, and it was found that the soil of the Osflr3 or Osflr11 mutant root system promoted the vegetative growth of rapeseed. It shows that the rice receptor-like kinase Osflr3 or Osflr11 is a key factor affecting the participation of rice root system soil in rice-rape rotation, and excellent gene resources of rice that promote rice-rape rotation are obtained and applied. Description of the Drawings

[0016] Figure 1 It is a sequencing analysis diagram of the editing site in the OsFLR3 gene knockout plant and the control plant.

[0017] Figure 2 It is a sequencing analysis diagram of the editing site in the OsFLR11 gene knockout plant and the control plant.

[0018] Figure 3 It is the observation of the vegetative growth of WT and rice Osflrs mutants.

[0019] Figure 4 It is the promoting effect of the root system soil of WT and Osflr3 or Osflr11 mutants on the growth of rapeseed.

[0020] Figure 5 It is the recovery effect of the root system soil of Osflr3 or Osflr11 mutants on low-nutrient rapeseed. Detailed Embodiments

[0021] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0022] I. Indoor Experiments

[0023] The rice ecotype is Nipponbare; the Agrobacterium strain is EH105; the vector is pYLCRISPR / Cas9P ubi -H; The main reagents include: restriction endonucleases from Thermo Fisher Biotech Company, DNA polymerase from Novoprotein, Infusion ligase, etc.; reverse transcription kits from Thermo Company; RNA extraction kits from Tiangen Company; plasmid extraction kits and DNA recovery kits from Tiangen Company; quantitative PCR reagents from Taraka Company; reagents such as MS medium, agar powder, agarose, ampicillin, kanamycin, rifampicin and other antibiotics are purchased from Sigma; various other chemical reagents used in the examples are all imported or domestic analytical pure reagents; primer synthesis and sequencing are completed by Beijing Tsingke Biotechnology Co., Ltd.

[0024] The nucleotide sequence of the OsFLR3 gene is as shown in SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is as shown in SEQ ID NO.2; the amino acid sequence encoded by the OsFLR3 gene is SEQ ID NO.3 respectively; the amino acid sequence encoded by the OsFLR11 gene is as shown in SEQ ID NO.4.

[0025] First, log in to the website http: / / skl.scau.edu.cn / , design primers according to the target site design principle, and finally select the sequence shown in SEQ ID NO.5 in the OsFLR3 gene as the target of sgRNA: 5’-gccctcctatcgattgcca-3’; select the sequence shown in SEQ ID NO.9 in the OsFLR11 gene as the target of sgRNA: 5’-gacgctgaaccgcgccgag-3’. Design primers according to the target, and construct the target vector of CRISPR / Cas9 by means of PCR, enzyme digestion, ligation, etc.

[0026] The sgRNA sequences are as follows:

[0027] OsFLR3-Y1+: cagtGGTCTCaggcgccctcctatcgattgcca(SEQ ID NO.6)

[0028] OsFLR3-Y1-: cagtGGTCTCaaaactggcaatcgataggagggc(SEQ ID NO.7)

[0029] OsFLR11-Y1+: cagtGGTCTCaggcgacgctgaaccgcgccgag(SEQ ID NO.10)

[0030] OsFLR11-Y1-: cagtGGTCTCaaaacctcggcgcggttcagcgtc (SEQ ID NO.11)

[0031] The vector construction is as follows:

[0032] (1) Annealing: The annealing reaction of the above primers was carried out according to the product instruction manual of Shanghai Beyotime Biotechnology Co., Ltd. (Product No.: D0251). Reaction system: 4 μL of 5×Annealing Buffer for DNA Oligos, 4 μL each of the upstream and downstream primers (50 μmol / μL), supplemented with Nuclease-free water to 20 μL; Reaction program: 95°C for 5 min, decreasing 0.1°C every 8 s until 25°C; Store at 4°C;

[0033] (2) Vector ligation: The DNA product obtained from the annealing reaction was ligated to the pYLCRISPR / Cas9P ubi -H vector digested with Bsa I; Ligation system: 2 μL of the annealed DNA product, 1.5 μL of the digested pYLCRISPR / Cas9P ubi -H vector, 1 μL of 10×T4 DNA Ligase Buffer, 0.5 μL of T4 DNA Ligase (400 U / μL), supplemented with sterile water to 10 μL. The ligation product was transformed into DH5a competent cells to screen for positive clones; Use the upstream primer: cagtGGTCTCgccctcctatcgattgcca (SEQ ID NO.6) or cagtGGTCTCaggcgacgctgaaccgcgccgag (SEQ ID NO.10); Downstream primer: Universal vector primer: atacgaagttatgactgcgaccga (SEQ ID NO.8) for colony PCR of the bacterial colonies; After detection by 1% agarose gel electrophoresis, sequencing verification was carried out; Figure 1 Sequencing analysis diagram of the editing sites in the OsFLR3 gene knockout plants and control plants. Figure 2 Sequencing analysis of the editing sites in the OsFLR11 gene knockout plants and control plants.

[0034] (3) Transformation of the expression vector into Agrobacterium and genetic transformation of rice: The correctly sequenced pYLCRISPR / Cas9P ubiThe plasmid was extracted from the -H vector and then transformed into Agrobacterium tumefaciens EH105. The transformed bacteria were screened and cultured on YEB plates containing kanamycin and rifampicin resistance. Single colonies were picked for colony PCR verification. The positive bacterial liquid was amplified and cultured, and then centrifuged. The bacterial cells were resuspended in MS liquid medium and used to infect rice calli. The infected calli were screened on MS solid medium containing NAA, 6-BA, and hygromycin. Finally, calli and positive seedlings that passed the resistance screening were obtained. The gene-edited plants were self-crossed to obtain the T1 generation for subsequent experiments. To prevent re-mutation, mutants were selected for self-crossing after sequencing to remove the Cas9 background, and they were named Osflr3 and Osflr11 respectively.

[0035] Root and soil collection experiment of gene-edited materials: The rice pot experiment was carried out in the greenhouse of the College of Biology, Hunan University. The rice planting soil was collected from the rice field of the Hunan University Cross Research Institute (113E, 28.21N). Seeds of Oryza sativa L. cv. Nipponbare, Osflr3, and Osflr11 mutants were soaked in deionized water for 1 day, sown on wet filter paper in a petri dish, and placed in a 37°C incubator for dark treatment for 48 h until the seeds germinated. The seedlings were transplanted into the pre-weighed and well-mixed soil and grown in a growth chamber with a photoperiod of 12 h light (28°C) / 12 h dark (24°C) for 6-7 weeks. The above-ground parts of the first-generation Oryza sativa L. cv. Nipponbare, Osflr3, and Osflr11 mutant plants were cut off, and the remaining parts (including roots and soil) of the same genotype were completely mixed in a sterilized container, dried, and placed in a new clean pot ( Figure 3 ), and there was no obvious difference in the growth of Osflrs mutants and wild-type rice.

[0036] Rapeseed pot experiment: The rapeseed seedlings were cultured in the light incubator of the College of Biology, Hunan University. The temperature in the light incubator was set at 22°C, the light cycle was 14 h (light) / 10 h (dark), the light intensity was 300 - 320 μmol / m 2 / s, and the humidity was 60 - 75%. Rapeseed seeds of the same size were sterilized with 1% NaClO for 10 min. After rinsing the seed surface thoroughly, the seeds were soaked in sterilized ultrapure water (>18.25 MΩ) at 4°C for 24 h. The soaked seeds were evenly sown on the gauze fixed on the surface of a plastic seedling tray, and an appropriate amount of ultrapure water was added to the seedling tray. After 3 days of seedling cultivation, the seedlings with consistent growth were transplanted into pots containing the root and soil of different genotypes of rice. The rapeseed seedlings were watered with autoclaved water. Different materials were placed side by side in the same growth chamber to observe the changes in the growth indexes of rapeseed during the vegetative period ( Figure 4)。Through screening, it was found that the promotion effect of the roots of the Osflr3 mutant on the growth of rapeseed was more significant. It indicates that the rice receptor kinase Osflr3 or Osflr11 is a key potential factor affecting rice-rape rotation.

[0037] Low-nutrient treatment experiment of rapeseed: Disinfect and raise rapeseed seeds using the above method. After 3 days of raising seedlings, transplant the seedlings with consistent growth to perlite. The perlite has been disinfected and washed with dilute hydrochloric acid and sieved, and 2 kg is weighed for each pot. The pot experiment is set with 2 nutrient levels: lack of macronutrients and normal. Under each level treatment, 5 biological replicates are set for each genotype material. Ultra-pure water (>18.25 MΩ) is used for daily watering of rapeseed, and the growth phenotype of rapeseed is observed. Experiment on restoring the low-nutrient growth of rapeseed with rice root soil: Plant the first-generation rice Nipponbare, Osflrs3, and Osflrs11 mutants in the uniformly mixed and weighed soil for 6-7 weeks, pull out the rice plants, collect the root soil (including the roots), grind it, and water the rapeseed seedlings planted on low-nutrient perlite, and observe whether the growth indexes during the vegetative period of rapeseed are restored. (The results are shown in Figure 5 ), and it was found that the restoration ability with the root soil of Osflr3 or Osflr11 was significantly enhanced, the plant height and root length of rapeseed during the vegetative period were significantly longer, and the fresh weight was significantly increased. It indicates that the root soil of the rice receptor-like kinase Osflr3 or Osflr11 promotes the growth of rapeseed under low-nutrient stress. Sequence Listing <110> Hunan University <120> Application of Rice RLK Mutants in Promoting Plant Growth or Rice-Rape Rotation <141> 2022-06-22 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2646 <212> DNA <213> Oryza sativa <400> 1 atgatgcacc caagcctact agctaccatc caatggctca cactgtcagc cctcctatcg 60 attgccatgg cggctgataa caattccacg gcctctgctc caatctttct gaattgtgga 120 gcctctggtg tgcaacctga tagctacaat cggagctggg atggggatgc tagctccaag 180 tttgcgccat cggtgaaagg caatgtagcc agggcttcat accaagaccc ttcgctccca 240 tcacccgtgc cttacatgac tgctcgattc ttcacttcaa attacaccta ttccttccct 300 gtcagcccag gccgcatgtt cgtgcgccta cacttctatc caactaatta taatgggaac 360 cttgattctg caaatgccta ctttggtgtc acaaccaaca atctgatcct tttagacaac 420 ttcaacgcat cacaaactgc tctggcaaca agctctgcct acttctttcg agaattctcg 480 gttaatgtca cttcaagcag cctaaaactc acctttgccc cgtccacacg aaacgggtct 540 tatgcatttg tgaatgggat tgagattgtg cccacgcctg acatcttcac aacaccgaca 600 cctacatctg ccaatggcgg ggacaatgtg caatatggca tagatcctgt gatgggtctc 660 caaacgatgt accggctcaa tgttggggga cagcccatct ctccgcaagg tgattctgga 720 ttctatcgtt cttgggataa tgattctcct tacatatatg gtgctgccta tggggtgacc 780 ttctccaaag atggtaatgt caccatcaaa tatccaaata ctgagccaaa ttacactgca 840 ccagttgcag tctacgcaac agcaaggtca atggggccaa ctgcacagat caacctgaac 900 ccagttgcag tctacgcaac agcaaggtca atggggccaa ctgcacagat caacctgaac 900 tacaatctta catggatctt accggttgat gcggggttca cctacctctt gaggttccat 960 tacaatctta catggatctt accggttgat gcggggttca cctacctctt gaggttccat 960 ttctgtgaga tccagtatcc aataaccaag gtgaatcaga gatcattttt catttacatc 1020 ttctgtgaga tccagtatcc aataaccaag gtgaatcaga gatcattttt catttacatc 1020 aacaaccaga cggcgcagaa tcaaatggac gtcattgttt ggagtggagg aattggcaga 1080 aacaaccaga cggcgcagaa tcaaatggac gtcattgttt ggagtggagg aattggcaga 1080 acaacatata ccaactatgt tgtcacaacg gttggttctg gccagacgga cctgtgggtc 1140 acaacatata ccaactatgt tgtcacaacg gttggttctg gccagacgga cctgtgggtc 1140 gcgcttcacc ctgatctttc aagcaaacca gagtattttg atgcaatact aaatggcctt 1200 gcgcttcacc ctgatctttc aagcaaacca gagtattttg atgcaatact aaatggcctt 1200 gaggtcttca agctacagga ccttggaaga aataaccttg ctgggctcaa ccctccactt 1260 gaggtcttca agctacagga ccttggaaga aataaccttg ctgggctcaa ccctccactt 1260 ccaccaaagc ctggtgtgaa tcccaatggg ggatctagta gaggtaaatc aaagagtgtt 1320 ccaccaaagc ctggtgtgaa tcccaatggg ggatctagta gaggtaaatc aaagagtgtt 1320 gccccagcag ccataggtgg agcagtgggt ggccttgccg tgttgttgat tgcttgtgtt 1380 gccccagcag ccataggtgg agcagtgggt ggccttgccg tgttgttgat tgcttgtgtt 1380 ggattgtgca tcatctgtag acgaaagaag aaggtagcaa aggatactgg caaatctgat 1440 ggattgtgca tcatctgtag acgaaagaag aaggtagcaa aggatactgg caaatctgat 1440 gaaggacgct ggactcctct cactgatttc accaagtcac agtcagccac ctcaggaaag 1500 gaaggacgct ggactcctct cactgatttc accaagtcac agtcagccac ctcaggaaag 1500 acaaccaaca cagggagcca ctcgatgctg ccagccaatc tttgccggca cttttcgttt 1560 acaaccaaca cagggagcca ctcgatgctg ccagccaatc tttgccggca cttttcgttt 1560 gcagaaatcc aggctgccac caacaatttc gacaaatcct tcctcctcgg caaaggtgga 1620 tttggcaacg tttaccttgg agagatagac agtggcacta gagttgcaat caagcgtggg 1680 aacccgctgt ctgagcaggg tgtccatgag ttccagaatg agattgagat gctgtccaag 1740 ctccgacacc gtcaccttgt gtctctaatc gggtactgcg aggataggaa tgagatgatt 1800 ttggtatatg actacatggc tcatgggaca cttcgagaac acttgtacaa caccaagaac 1860 ccaccattgt cgtggaagca gaggctggag atctgcatcg gcgccgcccg tgggctgtat 1920 tacctgcaca cgggtgcaaa gcaaaccatc atccaccgcg atgtcaagac caccaacatt 1980 ttgctggatg acaagtgggt tgccaaggtt tccgacttcg ggctgtccaa ggccggtcca 2040 aacgtggaca acacccatgt gagcacagtg gtgaagggca gcttcggata ccttgatcct 2100 gagtacttcc gacggcagca gcttaccgag aaatctgatg tctactcctt cggagttgtg 2160 ctgttcgagg tcctgtgcgc ccgcaacgcc ctgagcccat cacttccgaa ggagcaagtg 2220 agccttgcag actgggctct gcgttgccag aagaaaggtg ttcttggcga gatcattgac 2280 ccactcctca aagggaagat cgctccccag tgcttcttga agttcgccga gaccgcggag 2340 aaatgtgtgg ccgatcgcag cgtcgacagg ccgtccatgg gtgatgtgct ctggaacctc 2400 gagtttgcgc tccagctgca ggagagcacg gaggacagta gcagcctgac cgaggggacg 2460 tcagcgagca cgtcgccgct ggttgtggcc aggctgcatt cagatgagcc gtcgaccgac 2520 gtgactacta ccactacaac gacaacttct ttgagcatca ctgaccgtag cattgcgagc 2580 gtggagtctg atgggctgac cccaagcaac atcttctccc agctcatgac accagatgga 2640 agatga 2646 <210> 2 <211> 2535 <212> DNA <213> Oryza sativa <400> 2 atggctgcga tcgttttgct gctcttcctt gtcgtgggct tgatgccggt ttccaatggg 60 cagacgacgc ccttctcccc gcgattctcc gtctacctcg cgtgcggcgc cggcgggaac 120 gtcgtcgtga cgtcggactc gccgcagcgg actttcgtcc cggacgacgg cgagctgtcc 180 gggaagtccg cgaggttcag caaccccgac gcgagcccgc cgtcccctct ctacgccgcg 240 gcgcgcgcgg ggacgagcgg cttctcgtac cggctcagct acgctgccga cgcggcgccc 300 gacggcaaca ccacgctcgt cctccgcctc cacttcttcc ccttcgcgtc gcagtccggc 360 gacctcctct cggcgcggtt cagcgtctcg gccatgggga ggtacgtcct cctgcctcct 420 tccttctcgc cgccgcgcgc cggcgtggtg agggagttcc tcctcccgtc cgatggctcc 480 ggcgagttcg acgtcgcctt cacgcccgaa tcaggggggc tcgccttcgt caacgccatc 540 gagctgttcc ccgcgccgca ggagcttctg tggaagttcc ccctgacggc ggtcaacacc 600 gacgtctcgc cgtcgcatca ggcgctggag acgctgtacc ggctcaacgt cggcgggcca 660 acggtgacgc cgacgggcga caccatgtgg cgaacatggc tccccgacga ctcctacctc 720 tccccggcga cggtctcggc ggtggccagc atccagggcc agatcatctt cgaccgggcg 780 cagggctaca cgcagatggt cgcgccggac gccgtgtaca agtcgcagcg cacgacgaac 840 tcgaccacgt cgaacgtgac atggacgttc gccgtcgacg gcaacagcag ctacgtcgtc 900 cgcctccact tctgcgcctt cgaggagctc agctccgtca tcggagaagg cgtcgatttc 960 aatgtttatc tgatgcaagc catgggtacc cgggaattga aggccaagga ctacgcgacg 1020 ctgagcagtc cgacccaagc tttctacatg gactatgtcg ccgtggtccc gaccgccggc 1080 gagaacctca cggtgagcat cggcagggcg gcgagcagcg acagcaagaa ggcgatactg 1140 aacgggctgg agatcatgaa gctcagagcc gttgatatga ctccggcgag ctcgtccggc 1200 aagacgagca aggtcgtcgt cgtagccgtg accgcggcgg tgctcggcgc ggcggttcta 1260 gcaggtgtgg cattgtgcgt actgcttgtg cggcggagac agcggcgggc gacgctgcct 1320 gtgccggagg aggaggagaa ggagagcgtg gggacgccgt ggtcgccgtt cacgccggac 1380 ggcgagggct cgttcggcag cgccgtggtc acgccgcgga ggatgaacat gaagctccac 1440 atcccgctcg ccgagatcat ggtggcgacg ggggacttcg acgacgcaaa catcctcggc 1500 gtcggcgggt tcgggaacgt gtaccgcggc gtgctccgcg acggcacccg cgtcgccgtg 1560 aagcgcgcca agcgcgcgtc caggcagggg ttcccggagt tccagactga gatcctggtg 1620 ctctccagca tccgccaccg ccacctcgtc tcgctcatcg gctactgcaa cgagcggtcg 1680 gagatgatcc tcgtgtacga gctcatggcg cacggcaccc tgaggagcca cctgtacggc 1740 tccgacgccg cggcggcgac gccgccgccg ctgtcgtgga agcagcggct ggagatctgc 1800 atcggcgcgg cgaaggggct ccactacctg cacaccggcc actccgataa catcatccac 1860 cgcgacgtca agtcgacgaa catcctcctc ggcgacggct tcgtggcgaa ggtggccgac 1920 ttcgggctgt cccgcgtcgg gccatcgacg gggcagacgc acgtgagcac ggcggtgaag 1980 ggcagcttcg gctacctcga cccggagtac ttcaagacgc ggcagctcac cgaccgctcc 2040 gacgtctact ccttcggcgt cgtcctcttc gaggtgctgt gcgcgcggcc ggcgatcgac 2100 cagagcctcc cgcccgacga gatcaacctc gcggagtggg cgatgcagtg gagccggagg 2160 ggccggttcg acaagatcgt cgacccggcc gtcgccggcg acgccagcac gaactcgctc 2220 cggaagttcg cggagaccgc cgggaggtgc ctcgcggact acggcgagca gcggccgtcc 2280 atgggcgacg tggtgtggaa cctcgagtac tgcctccagc tgcaggagag ccagccgagc 2340 accgagacgg cgctggactt ggacgacagc ggcgcgcacc tgccacggga catcgtcgtg 2400 gcgaggcgag tggcgccgct cgcgcccgat gcttcggcgg acgccgccgg agacgacatg 2460 agctggtcgg agacggcgag cttcacggcg acgggcaacg tgttctcgca gattatgtcc 2520 cgcgatggta gatga 2535 <210> 3 <211> 881 <212> PRT <213> Oryza sativa <400> 3 Met Met His Pro Ser Leu Leu Ala Thr Ile Gln Trp Leu Thr Leu Ser 1 5 10 15 Ala Leu Leu Ser Ile Ala Met Ala Ala Asp Asn Asn Ser Thr Ala Ser 20 25 30 Ala Pro Ile Phe Leu Asn Cys Gly Ala Ser Gly Val Gln Pro Asp Ser 35 40 45 Tyr Asn Arg Ser Trp Asp Gly Asp Ala Ser Ser Lys Phe Ala Pro Ser 50 55 60 Val Lys Gly Asn Val Ala Arg Ala Ser Tyr Gln Asp Pro Ser Leu Pro 65 70 75 80 Ser Pro Val Pro Tyr Met Thr Ala Arg Phe Phe Thr Ser Asn Tyr Thr 85 90 95 Tyr Ser Phe Pro Val Ser Pro Gly Arg Met Phe Val Arg Leu His Phe 100 105 110 Tyr Pro Thr Asn Tyr Asn Gly Asn Leu Asp Ser Ala Asn Ala Tyr Phe 115 120 125 Gly Val Thr Thr Asn Asn Leu Ile Leu Leu Asp Asn Phe Asn Ala Ser 130 135 140 Gln Thr Ala Leu Ala Thr Ser Ser Ala Tyr Phe Phe Arg Glu Phe Ser 145 150 155 160 Val Asn Val Thr Ser Ser Ser Leu Lys Leu Thr Phe Ala Pro Ser Thr 165 170 175 Arg Asn Gly Ser Tyr Ala Phe Val Asn Gly Ile Glu Ile Val Pro Thr 180 185 190 Pro Asp Ile Phe Thr Thr Pro Thr Pro Thr Ser Ala Asn Gly Gly Asp 195 200 205 Asn Val Gln Tyr Gly Ile Asp Pro Val Met Gly Leu Gln Thr Met Tyr 210 215 220 Arg Leu Asn Val Gly Gly Gln Pro Ile Ser Pro Gln Gly Asp Ser Gly 225 230 235 240 Phe Tyr Arg Ser Trp Asp Asn Asp Ser Pro Tyr Ile Tyr Gly Ala Ala 245 250 255 Tyr Gly Val Thr Phe Ser Lys Asp Gly Asn Val Thr Ile Lys Tyr Pro 260 265 270 Asn Thr Glu Pro Asn Tyr Thr Ala Pro Val Ala Val Tyr Ala Thr Ala 275 280 285 Arg Ser Met Gly Pro Thr Ala Gln Ile Asn Leu Asn Tyr Asn Leu Thr 290 295 300 Trp Ile Leu Pro Val Asp Ala Gly Phe Thr Tyr Leu Leu Arg Phe His 305 310 315 320 Phe Cys Glu Ile Gln Tyr Pro Ile Thr Lys Val Asn Gln Arg Ser Phe 325 330 335 Phe Ile Tyr Ile Asn Asn Gln Thr Ala Gln Asn Gln Met Asp Val Ile 340 345 350 Val Trp Ser Gly Gly Ile Gly Arg Thr Thr Tyr Thr Asn Tyr Val Val 355 360 365 Thr Thr Val Gly Ser Gly Gln Thr Asp Leu Trp Val Ala Leu His Pro 370 375 380 Asp Leu Ser Ser Lys Pro Glu Tyr Phe Asp Ala Ile Leu Asn Gly Leu 385 390 395 400 Glu Val Phe Lys Leu Gln Asp Leu Gly Arg Asn Asn Leu Ala Gly Leu 405 410 415 Asn Pro Pro Leu Pro Pro Lys Pro Gly Val Asn Pro Asn Gly Gly Ser 420 425 430 Ser Arg Gly Lys Ser Lys Ser Val Ala Pro Ala Ala Ile Gly Gly Ala 435 440 445 Val Gly Gly Leu Ala Val Leu Leu Ile Ala Cys Val Gly Leu Cys Ile 450 455 460 Ile Cys Arg Arg Lys Lys Lys Val Ala Lys Asp Thr Gly Lys Ser Asp 465 470 475 480 Glu Gly Arg Trp Thr Pro Leu Thr Asp Phe Thr Lys Ser Gln Ser Ala 485 490 495 Thr Ser Gly Lys Thr Thr Asn Thr Gly Ser His Ser Met Leu Pro Ala 500 505 510 Asn Leu Cys Arg His Phe Ser Phe Ala Glu Ile Gln Ala Ala Thr Asn 515 520 525 Asn Phe Asp Lys Ser Phe Leu Leu Gly Lys Gly Gly Phe Gly Asn Val 530 535 540 Tyr Leu Gly Glu Ile Asp Ser Gly Thr Arg Val Ala Ile Lys Arg Gly 545 550 555 560 Asn Pro Leu Ser Glu Gln Gly Val His Glu Phe Gln Asn Glu Ile Glu 565 570 575 Met Leu Ser Lys Leu Arg His Arg His Leu Val Ser Leu Ile Gly Tyr 580 585 590 Cys Glu Asp Arg Asn Glu Met Ile Leu Val Tyr Asp Tyr Met Ala His 595 600 605 Gly Thr Leu Arg Glu His Leu Tyr Asn Thr Lys Asn Pro Pro Leu Ser 610 615 620 Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Arg Gly Leu Tyr 625 630 635 640 Tyr Leu His Thr Gly Ala Lys Gln Thr Ile Ile His Arg Asp Val Lys 645 650 655 Thr Thr Asn Ile Leu Leu Asp Asp Lys Trp Val Ala Lys Val Ser Asp 660 665 670 Phe Gly Leu Ser Lys Ala Gly Pro Asn Val Asp Asn Thr His Val Ser 675 680 685 Thr Val Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe Arg 690 695 700 Arg Gln Gln Leu Thr Glu Lys Ser Asp Val Tyr Ser Phe Gly Val Val 705 710 715 720 Leu Phe Glu Val Leu Cys Ala Arg Asn Ala Leu Ser Pro Ser Leu Pro 725 730 735 Lys Glu Gln Val Ser Leu Ala Asp Trp Ala Leu Arg Cys Gln Lys Lys 740 745 750 Gly Val Leu Gly Glu Ile Ile Asp Pro Leu Leu Lys Gly Lys Ile Ala 755 760 765 Pro Gln Cys Phe Leu Lys Phe Ala Glu Thr Ala Glu Lys Cys Val Ala 770 775 780 Asp Arg Ser Val Asp Arg Pro Ser Met Gly Asp Val Leu Trp Asn Leu 785 790 795 800 Glu Phe Ala Leu Gln Leu Gln Glu Ser Thr Glu Asp Ser Ser Ser Leu 805 810 815 Thr Glu Gly Thr Ser Ala Ser Thr Ser Pro Leu Val Val Ala Arg Leu 820 825 830 His Ser Asp Glu Pro Ser Thr Asp Val Thr Thr Thr Thr Thr Thr Thr 835 840 845 Thr Ser Leu Ser Ile Thr Asp Arg Ser Ile Ala Ser Val Glu Ser Asp 850 855 860 Gly Leu Thr Pro Ser Asn Ile Phe Ser Gln Leu Met Thr Pro Asp Gly 865 870 875 880 Arg <210> 4 <211> 844 <212> PRT <213> Oryza sativa <400> 4 Met Ala Ala Ile Val Leu Leu Leu Phe Leu Val Val Gly Leu Met Pro 1 5 10 15 Val Ser Asn Gly Gln Thr Thr Pro Phe Ser Pro Arg Phe Ser Val Tyr 20 25 30 Leu Ala Cys Gly Ala Gly Gly Asn Val Val Val Thr Ser Asp Ser Pro 35 40 45 Gln Arg Thr Phe Val Pro Asp Asp Gly Glu Leu Ser Gly Lys Ser Ala 50 55 60 Arg Phe Ser Asn Pro Asp Ala Ser Pro Pro Ser Pro Leu Tyr Ala Ala 65 70 75 80 Ala Arg Ala Gly Thr Ser Gly Phe Ser Tyr Arg Leu Ser Tyr Ala Ala 85 90 95 Asp Ala Ala Pro Asp Gly Asn Thr Thr Leu Val Leu Arg Leu His Phe 100 105 110 Phe Pro Phe Ala Ser Gln Ser Gly Asp Leu Leu Ser Ala Arg Phe Ser 115 120 125 Val Ser Ala Met Gly Arg Tyr Val Leu Leu Pro Pro Ser Phe Ser Pro 130 135 140 Pro Arg Ala Gly Val Val Arg Glu Phe Leu Leu Pro Ser Asp Gly Ser 145 150 155 160 Gly Glu Phe Asp Val Ala Phe Thr Pro Glu Ser Gly Gly Leu Ala Phe 165 170 175 Val Asn Ala Ile Glu Leu Phe Pro Ala Pro Gln Glu Leu Leu Trp Lys 180 185 190 Phe Pro Leu Thr Ala Val Asn Thr Asp Val Ser Pro Ser His Gln Ala 195 200 205 Leu Glu Thr Leu Tyr Arg Leu Asn Val Gly Gly Pro Thr Val Thr Pro 210 215 220 Thr Gly Asp Thr Met Trp Arg Thr Trp Leu Pro Asp Asp Ser Tyr Leu 225 230 235 240 Ser Pro Ala Thr Val Ser Ala Val Ala Ser Ile Gln Gly Gln Ile Ile 245 250 255 Phe Asp Arg Ala Gln Gly Tyr Thr Gln Met Val Ala Pro Asp Ala Val 260 265 270 Tyr Lys Ser Gln Arg Thr Thr Asn Ser Thr Thr Ser Asn Val Thr Trp 275 280 285 Thr Phe Ala Val Asp Gly Asn Ser Ser Tyr Val Val Arg Leu His Phe 290 295 300 Cys Ala Phe Glu Glu Leu Ser Ser Val Ile Gly Glu Gly Val Asp Phe 305 310 315 320 Asn Val Tyr Leu Met Gln Ala Met Gly Thr Arg Glu Leu Lys Ala Lys 325 330 335 Asp Tyr Ala Thr Leu Ser Ser Pro Thr Gln Ala Phe Tyr Met Asp Tyr 340 345 350 Val Ala Val Val Pro Thr Ala Gly Glu Asn Leu Thr Val Ser Ile Gly 355 360 365 Arg Ala Ala Ser Ser Asp Ser Lys Lys Ala Ile Leu Asn Gly Leu Glu 370 375 380 Ile Met Lys Leu Arg Ala Val Asp Met Thr Pro Ala Ser Ser Ser Gly 385 390 395 400 Lys Thr Ser Lys Val Val Val Val Ala Val Thr Ala Ala Val Leu Gly 405 410 415 Ala Ala Val Leu Ala Gly Val Ala Leu Cys Val Leu Leu Val Arg Arg 420 425 430 Arg Gln Arg Arg Ala Thr Leu Pro Val Pro Glu Glu Glu Glu Lys Glu 435 440 445 Ser Val Gly Thr Pro Trp Ser Pro Phe Thr Pro Asp Gly Glu Gly Ser 450 455 460 Phe Gly Ser Ala Val Val Thr Pro Arg Arg Met Asn Met Lys Leu His 465 470 475 480 Ile Pro Leu Ala Glu Ile Met Val Ala Thr Gly Asp Phe Asp Asp Ala 485 490 495 Asn Ile Leu Gly Val Gly Gly Phe Gly Asn Val Tyr Arg Gly Val Leu 500 505 510 Arg Asp Gly Thr Arg Val Ala Val Lys Arg Ala Lys Arg Ala Ser Arg 515 520 525 Gln Gly Phe Pro Glu Phe Gln Thr Glu Ile Leu Val Leu Ser Ser Ile 530 535 540 Arg His Arg His Leu Val Ser Leu Ile Gly Tyr Cys Asn Glu Arg Ser 545 550 555 560 Glu Met Ile Leu Val Tyr Glu Leu Met Ala His Gly Thr Leu Arg Ser 565 570 575 His Leu Tyr Gly Ser Asp Ala Ala Ala Ala Thr Pro Pro Pro Leu Ser 580 585 590 Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Lys Gly Leu His 595 600 605 Tyr Leu His Thr Gly His Ser Asp Asn Ile Ile His Arg Asp Val Lys 610 615 620 Ser Thr Asn Ile Leu Leu Gly Asp Gly Phe Val Ala Lys Val Ala Asp 625 630 635 640 Phe Gly Leu Ser Arg Val Gly Pro Ser Thr Gly Gln Thr His Val Ser 645 650 655 Thr Ala Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe Lys 660 665 670 Thr Arg Gln Leu Thr Asp Arg Ser Asp Val Tyr Ser Phe Gly Val Val 675 680 685 Leu Phe Glu Val Leu Cys Ala Arg Pro Ala Ile Asp Gln Ser Leu Pro 690 695 700 Pro Asp Glu Ile Asn Leu Ala Glu Trp Ala Met Gln Trp Ser Arg Arg 705 710 715 720 Gly Arg Phe Asp Lys Ile Val Asp Pro Ala Val Ala Gly Asp Ala Ser 725 730 735 Thr Asn Ser Leu Arg Lys Phe Ala Glu Thr Ala Gly Arg Cys Leu Ala 740 745 750 Asp Tyr Gly Glu Gln Arg Pro Ser Met Gly Asp Val Val Trp Asn Leu 755 760 765 Glu Tyr Cys Leu Gln Leu Gln Glu Ser Gln Pro Ser Thr Glu Thr Ala 770 775 780 Leu Asp Leu Asp Asp Ser Gly Ala His Leu Pro Arg Asp Ile Val Val 785 790 795 800 Ala Arg Arg Val Ala Pro Leu Ala Pro Asp Ala Ser Ala Asp Ala Ala 805 810 815 Gly Asp Asp Met Ser Trp Ser Glu Thr Ala Ser Phe Thr Ala Thr Gly 820 825 830 Asn Val Phe Ser Gln Ile Met Ser Arg Asp Gly Arg 835 840 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <400> 5 gccctcctat cgattgcca 19 <210> 6 <211> 33 <212> DNA <213> Artificial sequence <400> 6 cagtggtctc aggcgccctc ctatcgattg cca 33 <210> 7 <211> 34 <212> DNA <213> Artificial sequence <400> 7 cagtggtctc aaaactggca atcgatagga gggc 34 <210> 8 <211> 24 <212> DNA <213> Artificial sequence <400> 8 atacgaagtt atgactgcga ccga 24 <210> 9 <211> 19 <212> DNA <213> Artificial sequence <400> 9 gacgctgaac cgcgccgag 19 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <400> 10 cagtggtctc aggcgacgct gaaccgcgcc gag 33 <210> 11 <211> 34 <212> DNA <213> Artificial sequence <400> 11 cagtggtctc aaaacctcgg cgcggttcag cgtc 34

Claims

1. Application of the Osflr3 or Osflr11 rice mutant in promoting plant growth in rice-oilseed rotation, characterized in that, The OsFLR3 gene is lowly expressed or not expressed in the Osflr3 rice mutant; the OsFLR11 gene is lowly expressed or not expressed in the Osflr11 rice mutant; the plant is rapeseed; the nucleotide sequence of the OsFLR3 gene is as shown in SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is as shown in SEQ ID NO.2; the amino acid sequence encoded by the OsFLR3 gene is as shown in SEQ ID NO.3; the amino acid sequence encoded by the OsFLR11 gene is as shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, Gene editing means are used to make the OsFLR3 gene lowly expressed or not expressed in the Osflr3 rice mutant; gene editing means are used to make the OsFLR11 gene lowly expressed or not expressed in the Osflr11 rice mutant.

3. The application according to claim 2, characterized in that, The gene editing uses the CRISPR / Cas9 gene editing technology to perform site-directed editing on the rice Osflr3 or Osflr11 gene.

4. The application according to claim 3, characterized in that, The specific method of the CRISPR / Cas9 gene editing technology is as follows: using the rice Osflr3 or Osflr11 gene as a target, designing a CRISPR / Cas9-based sgRNA sequence, ligating the DNA fragment encoding the sgRNA into the CRISPR / Cas9 vector and transforming rice to achieve site-directed editing of the rice OsFLR3 or OsFLR11 gene, and obtaining a rice mutant with low expression or no expression of the OsFLR3 or OsFLR11 gene.

5. The application according to claim 4, characterized in that, The nucleotide sequence of the sgRNA of the Osflr3 gene is as shown in SEQ ID NO:5; the nucleotide sequence of the sgRNA of the Osflr11 gene is as shown in SEQ ID NO:9.

Images