A DNA tetrahedron-based sensing chip, a preparation method and device thereof

By using a DNA tetrahedral-based sensor chip and antibody-coupled via amidation reaction, the simultaneous detection of multiple indicators of Alzheimer's disease-related protein biomarkers can be achieved. This solves the problems of high cost and high invasiveness in existing technologies and provides a high-throughput, low-cost, and highly sensitive early diagnostic solution.

CN115433767BActive Publication Date: 2026-05-08THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE NAT CENT FOR NANOSCI & TECH NCNST OF CHINA
Filing Date
2022-04-29
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing methods for diagnosing Alzheimer's disease are costly and invasive, making it difficult to achieve early, non-invasive, and accurate diagnosis.

Method used

Using a DNA tetrahedral-based sensor chip, multiple antibodies are coupled via amidation reaction to achieve simultaneous detection of Alzheimer's disease-related protein biomarkers, which are then detected using surface plasmon resonance technology.

Benefits of technology

It achieves high-throughput, low-cost, and highly sensitive early detection of Alzheimer's disease, and can distinguish between dementia and mild cognitive impairment patients and normal people, providing non-invasive and miniaturized detection equipment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115433767B_ABST
    Figure CN115433767B_ABST
Patent Text Reader

Abstract

The application provides a DNA tetrahedron-based sensing chip, and also provides a preparation method and device thereof. The DNA tetrahedron-based sensing chip is prepared by modifying the surface of the DNA tetrahedron-based sensing chip with antibody functionalization modification. The DNA tetrahedron-based sensing chip prepared by the application can detect Alzheimer's disease through surface plasmon resonance imaging technology, has the advantages of high throughput, high sensitivity, and reusable chip, and the method shows good disease diagnosis performance. In the case that there is currently a lack of early detection means for Alzheimer's disease, the application selects a blood-based detection method and provides a miniaturized device for early detection and non-invasive detection of Alzheimer's disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of bioengineering and medical devices, specifically relating to a DNA tetrahedron-based sensing chip, its preparation method, and apparatus. Background Technology

[0002] Alzheimer's disease (AD) is the most common neurodegenerative disease, characterized by progressive and irreversible cognitive decline. As the seventh leading cause of death worldwide, Alzheimer's disease and other dementias claimed 1.6 million lives in 2019. This represents an increase of 1 million deaths annually compared to 2000. With an aging population, the number of AD patients is rising rapidly. However, accurate diagnosis and effective treatment of AD remain insurmountable challenges, placing a significant economic burden on society.

[0003] As clinical symptoms become increasingly apparent, the progression of Alzheimer's disease (AD) is divided into three stages: preclinical, mild cognitive impairment (MCI), and dementia. Currently, clinical diagnostic methods primarily include reviewing patient and family medical history, neurophysiological testing, cognitive function assessment, magnetic resonance imaging (MRI), and positron emission tomography (PET). These methods are mostly only applicable to the dementia stage and the MCI stage with obvious clinical symptoms. Furthermore, imaging examinations are often costly, and lumbar puncture sampling can cause significant pain for patients. To obtain convenient, miniaturized, and low-cost early detection devices, blood analysis-based testing technologies have received widespread attention. The sensitivity and specificity of the device itself, as well as its diagnostic sensitivity, specificity, and accuracy during clinical application, are important indicators for evaluating blood analysis-based testing technologies. Summary of the Invention

[0004] Therefore, the purpose of this invention is to overcome the deficiencies in the prior art and provide a DNA tetrahedron-based sensing chip, its preparation method, and apparatus. The SPRi sensing chip of this invention, based on DNA tetrahedrons, couples multiple antibodies via an amidation reaction, enabling the simultaneous detection of multiple Alzheimer's disease-related protein biomarkers, and achieving effective differentiation between plasma samples from dementia patients and those with mild cognitive impairment and from healthy individuals.

[0005] Before describing the invention, the terms used herein are defined as follows:

[0006] The term "AD" refers to Alzheimer's disease.

[0007] The term "Aβ40" refers to β-amyloid protein 40.

[0008] The term "Aβ42" refers to β-amyloid protein 42.

[0009] The term "Anti-Aβ42" refers to: β-amyloid 40 antibody.

[0010] The term "Anti-Aβ42" refers to: β-amyloid protein 42 antibody.

[0011] The term "Anti-GFAP" refers to: glial fibrillary acidic protein antibody.

[0012] The term "Anti-NFL" refers to: neurofilament light chain protein antibody.

[0013] The term "Anti-Tau" refers to Tau protein antibodies.

[0014] The term "Anti-p-Tau" refers to a phosphorylated Tau protein antibody.

[0015] The term "Anti-p-Tau181" refers to an antibody against Tau protein phosphorylated at position 181.

[0016] The term "Anti-p-Tau217" refers to an antibody against Tau protein phosphorylated at position 217.

[0017] The term "AUC" refers to the area under the curve.

[0018] The term "bp" refers to a base pair.

[0019] The term "BSA" refers to bovine serum albumin.

[0020] The term "EDC" refers to 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride.

[0021] The term "HAS" refers to human serum albumin.

[0022] The term "IgG" refers to immunoglobulin G.

[0023] The term "IgM" refers to immunoglobulin M.

[0024] The term "Ladder" refers to a trapezoidal strip.

[0025] The term "MCI" refers to mild cognitive impairment.

[0026] The term "NC" refers to: healthy control.

[0027] The term "NFL" refers to neurofilament light chain protein.

[0028] The term "NHS" refers to nitrogen-hydroxysuccinimide.

[0029] The term "PBS" refers to phosphate-buffered saline.

[0030] The term "ROC" refers to the receiver operating characteristic curve.

[0031] The term "SPR" refers to surface plasmon resonance.

[0032] The term "SPRi" refers to SPR imaging.

[0033] The term "TM" refers to: Tris(hydroxymethyl)aminomethane-magnesium ion buffer solution.

[0034] The term "TRF" refers to transferrin.

[0035] To achieve the above objectives, a first aspect of the present invention provides a DNA tetrahedron-based sensing chip, wherein the DNA tetrahedron-based sensing chip is prepared by combining the DNA tetrahedron with the surface of the sensing chip and performing antibody functionalization modification; wherein:

[0036] The DNA tetrahedron is a tetrahedral structure formed by DNA strands, and the number of base pairs on each side of the DNA tetrahedron is 15-30 bp, preferably 20-30 bp, and most preferably 26 bp.

[0037] According to the first aspect of the present invention, a DNA tetrahedral-based sensing chip is wherein,

[0038] The sequences of the DNA strands forming the DNA tetrahedron include: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

[0039] According to the first aspect of the present invention, a DNA tetrahedral-based sensing chip is wherein,

[0040] The sensing chip is selected from one or more of the following: surface plasmon resonance (SPR) sensing chip, SPR imaging (SPRi) sensing chip, chemical sensing chip, electrochemical sensing chip, quartz crystal microbalance sensing chip, surface-enhanced Raman sensing chip, microfluidic chip, liquid chip, suspension chip, resistance / conductivity / impedance sensing chip, field-effect transistor sensing chip; and / or

[0041] The triangles forming the DNA tetrahedron have the same planar dimensions and are uniformly dispersed on the substrate;

[0042] Preferably, the DNA tetrahedron has a thiol group at each of the three vertices of the bottom triangle and a DNA strand extending from the top.

[0043] More preferably, the DNA strand extending from the top is a double-stranded DNA with carboxyl groups modified;

[0044] More preferably, the number of base pairs extending from the top of the DNA strand is 10-17 bp, further preferably 13-17 bp, and most preferably 15 bp; and / or

[0045] More preferably, the number of DNA strands extending from the top is 1 to 4, more preferably 1 to 3, and most preferably 1.

[0046] A second aspect of the present invention provides a method for preparing the DNA tetrahedron-based sensor chip described in the first aspect, the method comprising:

[0047] The DNA tetrahedron is bound to the surface of a sensor chip and then functionalized with an antibody to obtain the chip. The binding is preferably thiol bonding and the antibody functionalization is preferably amidation modification.

[0048] Preferably, the method includes the following steps:

[0049] (1) Prepare a DNA single-strand mixed solution, and then obtain a DNA tetrahedral solution after annealing;

[0050] (2) The DNA tetrahedral solution prepared in step (1) is bonded to the sensor chip to obtain a DNA tetrahedral modified sensor chip; and

[0051] (3) After activating the DNA tetrahedral modified sensor chip prepared in step (2), add antibody for incubation, wash and dry to obtain antibody-functionalized DNA tetrahedral based sensor chip.

[0052] According to the method of the second aspect of the present invention, step (1) further includes: first preparing a DNA single-strand mother liquor from DNA single strands, and then mixing the DNA single-strand mother liquor with a buffer solution to obtain a DNA single-strand mixed solution;

[0053] Preferably, the sequence of the DNA single strand includes: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5;

[0054] Preferably, the buffer solution is a TM buffer solution; the pH value of the buffer solution is preferably 7.5 to 8.5, more preferably 8; and / or

[0055] Preferably, the concentration of the DNA single strand in the DNA single-strand mixed solution is 0.4 to 5.0 μmol / L, more preferably 0.4 to 2.0 μmol / L, and most preferably 1.0 μmol / L.

[0056] According to a second aspect of the present invention, in step (1), the annealing process includes a heating reaction and a cooling reaction;

[0057] Preferably, the reaction temperature of the heating reaction is 95°C;

[0058] Preferably, the heating reaction time is 2 to 10 minutes, more preferably 4 to 9 minutes, and even more preferably 8 minutes;

[0059] Preferably, the cooling reaction time is greater than 30 seconds, more preferably greater than 3 minutes, and most preferably 8 minutes; and / or

[0060] Preferably, the reaction temperature of the cooling reaction is 4°C.

[0061] According to the method of the second aspect of the present invention, step (2) further includes: spreading the DNA tetrahedral solution prepared in step (1) on the surface of the sensor chip, incubating it to bond the DNA tetrahedrals to the sensor chip, washing it, and obtaining a DNA tetrahedral modified sensor chip.

[0062] Preferably, the incubation time is 10-25 hours, more preferably 10-20 hours, and even more preferably 12 hours.

[0063] According to the method of the second aspect of the present invention, step (3) further includes: immersing the DNA tetrahedral modified sensor chip prepared in step (2) in an activator for hydroxyl activation, washing and drying, and adding antibody for incubation;

[0064] Preferably, the activator is a mixed solution of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and nitrogen-hydroxysuccinimide (NHS);

[0065] Preferably, the antibody is selected from one or more of the following: Anti-Aβ40, Anti-Aβ42, Anti-NFL, Anti-Tau, Anti-p-Tau, Anti-p-Tau181, Anti-p-Tau217, Anti-GFAP, and more preferably Anti-Aβ42, Anti-NFL, and Anti-Tau;

[0066] Preferably, the volume of the antibody added to each sample drop is 0.4–1.0 μL, more preferably 0.4–0.5 μL, and most preferably 0.4 μL; and / or

[0067] Preferably, the incubation time is 10-25 hours, more preferably 10-20 hours, and even more preferably 12 hours.

[0068] According to the method of the second aspect of the present invention, step (3) further includes, after incubation: cleaning the chip and blocking the remaining activated carboxyl groups, washing and drying to obtain the antibody-functionalized DNA tetrahedron-based sensor chip;

[0069] Preferably, the solution used to block the remaining activated carboxyl groups is selected from one or more of the following: bovine serum albumin, skim milk powder, ethanolamine, with bovine serum albumin being the most preferred.

[0070] A third aspect of the present invention provides an Alzheimer's disease detection device, the Alzheimer's disease detection device comprising the DNA tetrahedron-based sensor chip described in the first aspect or the DNA tetrahedron-based sensor chip prepared according to the method described in the second aspect.

[0071] Specifically, as mentioned above, the sequence of the single-stranded DNA SEQ ID NO. 1-5 is as follows:

[0072] SEQ ID NO.1:

[0073] GCCTGGAGATACATGCACATTACGGCTTTCCCTATTAGAAGGTCTCAG GTGCGCGTTTCGGTAAGTAGACGGGACCAGTTCGCCTTTTTTTTTTGTA TCCAGTGGCTCA;

[0074] SEQ ID NO.2:

[0075] SH-CGCGCACCTGAGACCTTCTAATAGGGTTTGCGACAGTCGTTCAACT AGAATGCCCTTTGGGCTGTTCCGGGTGTGGCTCGTCGG (Since the nucleotide or amino acid sequence listing computer-readable vector cannot recognize SH-, SEQ ID NO.2 is based on the 5' thiol-modified sequence described herein).

[0076] SEQ ID NO.3:

[0077] SH-GGCCGAGGACTCCTGCTCCGCTGCGGTTTGGCGAACTGGTCCCGT CTACTTACCGTTTCCGACGAGCCACACCCGGAACAGCCC (Since the nucleotide or amino acid sequence listing computer-readable vector cannot recognize SH-, SEQ ID NO.3 is based on the 5' thiol-modified sequence described herein).

[0078] SEQ ID NO.4:

[0079] SH-GCCGTAATGTGCATGTATCTCCAGGCTTTCCGCAGCGGAGCAGGA GTCCTCGGCCTTTGGGCATTCTAGTTGAACGACTGTCGC (Since the nucleotide or amino acid sequence listing computer-readable vector cannot recognize SH-, SEQ ID NO.4 is based on the 5' thiol-modified sequence described herein).

[0080] SEQ ID NO.5: HOOC-TGAGCCACTGGATAC (Since computer-readable vectors cannot recognize HOOC-, SEQ ID NO.5 refers to the 5' carboxyl-modified sequence described herein).

[0081] Of these, SEQ ID NO.1 contains 109 bases; SEQ ID NO.2-4 each contain 84 bases and are all modified with a 5' mercapto group; SEQ ID NO.5 contains 15 bases and is modified with a 5' carboxyl group.

[0082] According to a preferred embodiment, the method for fabricating the DNA tetrahedron-based SPRi sensing chip of the present invention includes the following steps:

[0083] (1) Synthesis of DNA tetrahedrons:

[0084] In DNA tetrahedral synthesis, the first step is to dissolve the single-stranded DNA to prepare a DNA single-stranded stock solution. The lyophilized DNA sequence shown in SEQ ID NO. 1-5 is centrifuged at 3000-5000 rpm for 30-60 seconds. After centrifugation, the tube is slowly opened, and an appropriate amount of deionized water is added to dissolve the DNA single-stranded stock solution to a concentration of 100 μmol / L for later use. Next, the TM buffer solution used in DNA tetrahedral synthesis is prepared by dissolving 1-3 mmol of tris(hydroxymethyl)aminomethane and 2.5-7.5 mmol of magnesium chloride hexahydrate in 50-150 mL of deionized water, adjusting the pH to 7.5-8.5. Then, the five DNA single-stranded stock solutions are diluted in equal proportions in the prepared TM buffer solution at a dilution ratio of 80-120 times. Finally, 60 mmol / L tris(2-chloroethyl)phosphohydrochloride is added to the solution, diluting it 16-24 times. After thoroughly mixing the above solutions, a DNA single-stranded mixed solution was obtained. This DNA single-stranded mixed solution was placed in a PCR thermal cycler, with the heating temperature set to 95℃ and the reaction time to 5-10 min; the cooling temperature was set to 4℃ and the reaction time to 5-10 min. After complete reaction, a DNA tetrahedral solution was obtained.

[0085] (2) Fabrication of the DNA tetrahedral modified SPRi sensor chip:

[0086] Spread the prepared DNA tetrahedron solution evenly on the surface of the SPRi gold-plated chip, ensuring that the DNA tetrahedra cover the entire spotting area. Place a clean culture dish with moistened clean filter paper, and then incubate the chip at 4°C for 10-20 hours to allow the DNA tetrahedra to bond to the gold-plated chip surface through thiol groups. Wash 2-3 times with deionized water to remove excess DNA tetrahedra, thus obtaining the prepared DNA tetrahedron-modified SPRi sensor chip.

[0087] (3) Antibody functionalization of SPRi sensor chip based on DNA tetrahedron:

[0088] First, a carboxyl activator needs to be prepared, comprising 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). Dissolve 4-8 mmol of EDC and 1-2 mmol of NHS in 10-20 mL of deionized water and mix thoroughly to obtain the activator. Immerse the DNA tetrahedral modified SPRi sensor chip in the activator for carboxyl activation for 10-30 min. After complete reaction, wash the chip 2-3 times with deionized water to remove excess activator. Dry the chip with nitrogen gas, and add multiple antibodies to the spotting area of ​​the chip, each antibody added three times, with each drop containing 0.4-0.5 μL. Arrange each antibody in a separate column, ultimately forming a 3×3, 4×4, or 5×5 array. Take a clean culture dish with moistened filter paper at the bottom, place the chip inside, and incubate at 4°C for 10-20 hours. Wash away excess antibody with deionized water. Then immerse the chip in 5% bovine serum albumin (BSA), 5% skim milk powder, or a 1 mol / L ethanolamine hydrochloride solution for 2 hours to block the remaining activated carboxyl groups. After washing and drying, the antibody-functionalized DNA tetrahedron-based SPRi sensing chip is obtained.

[0089] The SPRi sensor chip based on DNA tetrahedrons prepared in this invention, by coupling with antibodies of multiple Alzheimer's disease-related protein biomarkers, can simultaneously detect Alzheimer's disease-related protein biomarkers, featuring high throughput, low cost, and high sensitivity. The application scope of this invention is not limited to this; the SPRi sensor chip based on DNA tetrahedrons can undergo receptor functionalization modification with chemical molecules, antibodies, antigens, peptides, nucleic acids, nucleic acid aptamers, etc., and can be used for simultaneous detection and analysis of multiple indicators in disease diagnosis, prognosis, efficacy prediction, and efficacy tracking.

[0090] The present invention relates to a DNA tetrahedron-based SPRi sensor chip, which involves antibody functionalization modification of a gold-plated chip surface modified with DNA tetrahedrons via an amidation reaction. The SPRi sensor chip prepared by this invention can detect Alzheimer's disease using surface plasmon resonance imaging (SPR), offering advantages such as high throughput, high sensitivity, and chip reusability. Furthermore, this method demonstrates good disease diagnostic performance. In the current lack of early detection methods for Alzheimer's disease, this invention employs a blood-based detection approach, providing a miniaturized device for non-invasive early detection of Alzheimer's disease.

[0091] The DNA tetrahedron-based sensing chip of the present invention may have, but is not limited to, the following beneficial effects:

[0092] 1. This invention successfully prepared an SPRi sensing chip based on DNA tetrahedrons, and modified the chip by antibody functionalization of multiple target sites. The functionalized chip can be used for the simultaneous detection of three Alzheimer's disease protein biomarkers.

[0093] 2. This invention synthesizes a DNA tetrahedral structure with a size similar to that of an antibody. While ensuring maximum space utilization, it provides sufficient space for the antibody coupled to the top of the DNA tetrahedron to bind with the biomarker, fully exposing the antibody's active site and facilitating antibody-biomarker binding. Furthermore, a 15-base DNA chain extends from the top of the DNA tetrahedron structure, providing flexibility for the antibody attached to its tip and facilitating antigen-antibody binding. These measures represent an effort to improve the sensitivity of chip-based detection.

[0094] 3. The SPRi sensor chip based on DNA tetrahedrons can simultaneously couple 3-5 antibodies, which means that it can provide simultaneous detection of multiple disease-related biomarkers, and the accuracy of diagnosis will be improved compared with single-indicator detection methods. Attached Figure Description

[0095] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0096] Figure 1 A schematic diagram of the DNA tetrahedral structure described in Example 1 is shown.

[0097] Figure 2 The agarose gel electrophoresis characterization results of the DNA tetrahedron described in Example 1 are shown.

[0098] Figure 3 The atomic force microscopy characterization results of the DNA tetrahedron in Example 1 are shown.

[0099] Figure 4The SPR-based signal response curves of the DNA tetrahedral-based SPRi sensor chip coupled with the antibody in Example 1 are shown.

[0100] Figure 5 The changes in SPR signal during chip fabrication and biomarker detection in Experiment Example 1 are shown.

[0101] Figure 6 The difference in SPR signal between the antibody-conjugated spotting area and the non-spotting area blocked by BSA is shown in Experimental Example 3.

[0102] Figure 7 The SPR signals of the DNA tetrahedral-based SPRi sensor chip, coupled with antibodies against Aβ42, NFL, and Tau proteins in Experimental Example 3, binding to common plasma proteins IgG, IgM, BSA, and TRF are shown; among them, Figure 7 (a) shows the SPR signal of a DNA tetrahedral-based SPRi sensor chip coupled with an Aβ42 protein antibody binding to common plasma proteins IgG, IgM, BSA and TRF. Figure 7 (b) shows the SPR signal of the DNA tetrahedral-based SPRi sensor chip coupled with the NFL protein antibody and the binding of common plasma proteins IgG, IgM, BSA and TRF. Figure 7 (c) shows the SPR signal of a DNA tetrahedral-based SPRi sensor chip coupled with a Tau protein antibody binding to common plasma proteins IgG, IgM, BSA and TRF.

[0103] Figure 8 The linear relationship between the concentration of Tau protein in diluted plasma and the SPR signal is shown in Experiment Example 4.

[0104] Figure 9 The receiver operating characteristic (ROC) curves and area under the curve (AUC) analysis results of Aβ42, NFL, and Tau proteins in clinical plasma samples from the AD, MCI, and NC groups in Experiment Example 5 are shown.

[0105] Figure 10 A schematic diagram illustrating the fabrication and detection process of the SPRi sensor chip based on DNA tetrahedrons is shown; wherein, Figure 10 (a) illustrates the fabrication process of the SPRi sensor chip based on DNA tetrahedrons; Figure 10 (b) illustrates the principle of the sensor chip detecting biomarkers in the SPRi system. Detailed Implementation

[0106] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for more detailed and specific illustration and should not be construed as limiting the present invention in any way.

[0107] This section provides a general description of the materials and testing methods used in the experiments of this invention. While many of the materials and methods of operation used to achieve the objectives of this invention are well known in the art, the invention is still described in as much detail as possible herein. It will be apparent to those skilled in the art that, unless otherwise stated in the context, the materials and methods of operation used in this invention are well known in the art.

[0108] The reagents and instruments used in the following examples are as follows:

[0109] Reagents:

[0110] Tris(hydroxymethyl)aminomethane (Tris), human serum albumin (HAS), human serum immunoglobulin G (IgG), human transferrin (TRF), and agarose were purchased from Sigma-Aldrich Trading Co., Ltd.; tris(2-carboxyethyl)phosphohydrochloride (TCEP) was purchased from Taoshu Biotechnology Co., Ltd.; nitrogen-hydroxysuccinimide (NHS) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) were purchased from Aladdin Reagent Co., Ltd.; magnesium chloride hexahydrate and gold-plated chips were purchased from Hualide Technology Co., Ltd.; DNA primers were purchased from Sangon Biotech (Shanghai) Co., Ltd.; β-amyloid 1-42 antibody (Anti-Aβ42), 68kDa neurofibril light chain protein antibody (Anti-NFL), 68kDa neurofibril light chain protein (NFL), and human immunoglobulin M (IgM) were purchased from Abogen Trading Co., Ltd.; β- Amyloid 1-42 (Aβ42) was purchased from Guoping Pharmaceutical Co., Ltd.; Tau protein antibody (Anti-Tau) and Tau protein were purchased from Sinopharm Biotechnology Co., Ltd.

[0111] instrument:

[0112] Real-time dynamic scanning probe microscopy system (model: Fast scan Bruker, manufacturer: Bruker Technologies, Germany), electrophoresis apparatus (model: DYY-6C, manufacturer: Beijing Liuyi Instrument Factory, China), gel imaging analyzer (model: G:BOX Chemi XL1.4, manufacturer: Bio-Rad Laboratories, USA), PCR thermal cycler (model: VeritiFAST, manufacturer: Langji Scientific Instruments, USA), and high-throughput biomolecular interaction analyzer (model: PlexArrayTMHT, manufacturer: Plex Biotechnology, USA).

[0113] Example 1

[0114] This embodiment illustrates the preparation method of the SPRi sensing line based on DNA tetrahedrons according to the present invention, including the following steps:

[0115] (1) Synthesis of DNA tetrahedrons

[0116] The DNA single-strand sequence of the present invention is the DNA sequence shown in SEQ ID NO.1-5.

[0117] In DNA tetrahedral synthesis, the first step is to dissolve single-stranded DNA to prepare a DNA single-stranded stock solution. A lyophilized sample of the DNA sequence shown in SEQ ID NO. 1-5 is centrifuged at 4000 rpm for 30 seconds. After centrifugation, the centrifuge tube is slowly opened, and an appropriate amount of deionized water is added to dissolve the DNA single-stranded stock solution to a concentration of 100 μmol / L for later use. Next, the TM buffer solution used in DNA tetrahedral synthesis is prepared by dissolving 2 mmol of tris(hydroxymethyl)aminomethane and 5 mmol of magnesium chloride hexahydrate in 100 mL of deionized water and adjusting the pH to 8. Then, the five DNA single-stranded stock solutions are diluted in the prepared TM buffer solution at a volume ratio of 1:1:1:1:1, resulting in a final concentration of 1.0 μmol / L for each DNA single strand. Subsequently, 60 mmol / L tris(2-chloroethyl)phosphohydrochloride is added to the solution, resulting in a final concentration of 3 mmol / L for tris(2-chloroethyl)phosphohydrochloride. The solution is then thoroughly mixed to obtain a mixed DNA single-stranded solution. The above DNA single-stranded mixed solution was placed in a PCR thermal cycler. The heating temperature was set to 95°C and the reaction time to 8 min; the cooling temperature was set to 4°C and the reaction time to 8 min. After the reaction was complete, a DNA tetrahedral solution was obtained.

[0118] Figure 1 This is a schematic diagram of the DNA tetrahedron structure in this invention. The structure is approximately 10 nm long and 6 nm high. Each of the three vertices of the bottom triangle has a thiol group. A 15-base-pair (bp) DNA strand extends from the top of the DNA tetrahedron, with a carboxyl group at the top, which can be used for antibody conjugation.

[0119] Figure 2The images show the agarose gel electrophoresis results of the DNA tetrahedrons prepared in this invention. From left to right, the images represent: a ladder band, a band containing only the A strand, a band containing only the A and B strands, a band containing only the A, B, and C strands, a band containing only the A, B, C, and D strands, and a band containing the A, B, C, D, and L strands (DNA tetrahedrons). Because the DNA tetrahedron has the most base pairs (bp), it moves the slowest in the agarose gel and is located at the top of the bands. Furthermore, the DNA tetrahedron bands in the images are located in the 150-200 bp range, consistent with the theoretical base pair count of 170 bp for a DNA tetrahedron. These results support the conclusion that the DNA tetrahedrons were successfully prepared.

[0120] Figure 3 The images show the atomic force microscopy characterization results of the DNA tetrahedra prepared in this invention. The images illustrate the triangular planar structure of the prepared DNA tetrahedra, which is substantially uniform in size and shape and dispersed evenly on the substrate. These results support the conclusion that the DNA tetrahedra were successfully prepared.

[0121] (2) Fabrication of the DNA tetrahedral modified SPRi sensor chip:

[0122] The prepared DNA tetrahedral solution was spread evenly on the surface of the SPRi gold-plated chip, ensuring that the DNA tetrahedra covered the entire spotting area. A clean culture dish was placed with moistened clean filter paper, and the chip was then incubated at 4°C for 12 hours to allow the DNA tetrahedra to bond to the gold-plated chip surface via thiol groups. The chip was then washed three times with deionized water to remove excess DNA tetrahedra, thus obtaining the DNA tetrahedral modified SPRi sensor chip.

[0123] (3) Antibody functionalization of SPRi sensor chip based on DNA tetrahedron:

[0124] First, a carboxyl activator needs to be prepared, comprising 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). 6 mmol of EDC and 1.5 mmol of NHS are dissolved in 15 mL of deionized water and thoroughly mixed to obtain the activator. The DNA tetrahedral modified SPRi sensor chip is then immersed in the activator for carboxyl activation for 15 min. After the reaction is complete, the chip is washed three times with deionized water to remove excess activator. The chip is dried using nitrogen gas, and multiple antibodies are added to the spotting area of ​​the chip. In this example, the antibodies used are Anti-Aβ42, Anti-NFL, and Anti-Tau. Each antibody is added three times, with each drop containing 0.4 μL. Each antibody is arranged in a separate column, ultimately forming a 3×3 array. Take a clean culture dish with moistened filter paper at the bottom, place the chip inside, and incubate at 4°C for 12 hours. Then wash away excess antibody with deionized water. Next, immerse the chip in 5% bovine serum albumin (BSA) for 2 hours to block the remaining activated carboxyl groups. After washing and drying, the antibody-functionalized DNA tetrahedron-based SPRi sensing chip is obtained.

[0125] Figure 4 The image shows the SPR signal response curve when an antibody is conjugated to the DNA tetrahedron-based SPRi sensor chip. As the antibody is injected, the SPR signal gradually increases and eventually stabilizes at a certain value. This curve demonstrates that the DNA tetrahedron-based SPRi sensor chip prepared using the above method can achieve antibody conjugation.

[0126] Experimental Example 1

[0127] This experimental example is used to test the binding of relevant reagents on the chip surface during the fabrication of the DNA tetrahedron-based SPRi sensor chip, as well as the binding of biomarkers to the antibody-functionalized chip.

[0128] (1) The prepared DNA tetrahedrons were modified on the surface of the gold-plated chip, washed and dried with nitrogen gas, and then capped to obtain the DNA tetrahedron modified SPRi sensor chip.

[0129] (2) Install the chip obtained in step (1) on the SPRi instrument and perform the measurement.

[0130] (3) Enzyme-free PBS was selected as the buffer to obtain a stable SPR baseline signal.

[0131] (4) The carboxyl activator, BSA blocking agent, antibody diluted 1000 times and protein diluted 100 times were injected sequentially according to the method in Example 1. The flow rate was set to 0.2 μL / s, the binding time to 900s and the dissociation time to 300s.

[0132] Figure 5 The results show that the SPR signal increases during the key processes of antibody conjugation and biomarker detection and eventually stabilizes at a certain value. The above curve changes further demonstrate that antibody-chip conjugation and antibody-functionalized chips can achieve the detection of corresponding antigens.

[0133] Experimental Example 2

[0134] This experimental example is used to test the affinity of the DNA tetrahedral-based SPRi sensor chip for binding with biomarkers. The specific steps are as follows:

[0135] (1) The DNA tetrahedron-based SPRi sensor chip prepared by the method in Example 1 was installed on the SPRi instrument for measurement. Relevant monitoring points were selected in the detection area, namely sample points (based on the real field of view of the chip sampling area presented by the software, the area where the previously added conjugated antibody can be seen from the field of view is called a sample point, and each sample point only contains the area where the antibody is conjugated) and non-sample points (non-sample points only contain the area where the antibody is not conjugated). The flow rate of the mobile phase was set to 2 μL / s.

[0136] (2) Enzyme-free PBS was selected as the buffer to obtain a stable SPR baseline signal.

[0137] (3) Aβ42 with concentrations of 0.64 nM, 1.29 nM, 2.58 nM, 5.15 nM and 10.31 nM were injected sequentially, with the binding time set to 300 s and the dissociation time set to 300 s. A phosphate solution diluted 1:500 (volume ratio) was introduced between each concentration for regeneration.

[0138] (4) NFL with concentrations of 2.96 nM, 5.92 nM, 11.84 nM, 23.68 nM and 47.36 nM were injected sequentially, with the binding time set to 300 s and the dissociation time set to 300 s. A 1:500 (volume ratio) diluted phosphoric acid solution was introduced between each concentration for regeneration.

[0139] (5) Tau was injected in sequence at concentrations of 1.03 nM, 2.06 nM, 4.13 nM, 8.26 nM and 16.51 nM, with a binding time of 300 s and a dissociation time of 300 s. A 1:500 (volume ratio) diluted phosphoric acid solution was introduced between each concentration for regeneration.

[0140] The SPR curves from the above experiments were fitted to obtain the equilibrium dissociation constants K of Aβ42, NFL, and Tau proteins. D The values ​​are 1.68 × 10 -8 mol / L, 7.28×10 -9mol / L, 1.22×10 -9 mol / L.

[0141] Experimental Example 3

[0142] This experimental example illustrates the specific recognition capability of the DNA tetrahedron-based SPRi sensor chip in detecting Alzheimer's disease-related biomarkers in a plasma environment. The specific steps are as follows:

[0143] (1) The DNA tetrahedron-based SPRi sensor chip prepared by the method in Example 1 was installed on the SPRi instrument for measurement. Relevant monitoring points were selected in the detection area, namely sample points (based on the real field of view of the chip sampling area presented by the software, the area where the previously added conjugated antibody can be seen from the field of view is called a sample point, and each sample point only contains the area where the antibody is conjugated) and non-sample points (non-sample points only contain the area where the antibody is not conjugated). The flow rate of the mobile phase was set to 2 μL / s.

[0144] (2) Enzyme-free PBS was selected as the buffer to obtain a stable SPR baseline signal.

[0145] (3) Aβ42, NFL, Tau protein, IgG, IgM, HAS and TRF were injected sequentially at a concentration of 3.2 μg / mL. The binding time was set to 300 s and the dissociation time was set to 300 s. A phosphate solution diluted 1:500 (volume ratio) was passed between each sample for regeneration.

[0146] Figure 6 The diagram shows a significant difference in SPR signal when Tau protein is bound in the region conjugated with Tau protein antibody (sample spot) and the region occupied by the blocking agent but not conjugated with antibody (non-sample spot), indicating that the sample spot region of the DNA tetrahedron-based SPRi sensor chip prepared in this invention exhibits good specificity in detecting biomarkers.

[0147] Figure 7 (a) shows that the sample spot region conjugated with Anti-Aβ42 exhibits good specificity for Aβ42 in the detection of Aβ42 and plasma-concentrated IgG, IgM, HAS, and TRF. Similarly, Figure 7 (b) and (c) demonstrate that Anti-NFL and Anti-Tau exhibit good specificity for their respective target proteins. The SPRi sensor chip based on DNA tetrahedrons is almost unaffected by IgG, IgM, HAS, and TRF when used to detect Alzheimer's disease-related biomarkers, indicating that the chip exhibits good specificity when detecting biomarkers in a plasma environment.

[0148] Test Example 4

[0149] This experimental example is used to test the linearity curve of the SPRi sensor chip based on DNA tetrahedrons in detecting biomarkers. The specific operation steps are as follows:

[0150] (1) Install the DNA tetrahedron-based SPRi sensor chip prepared by the method in Example 1 on the SPRi instrument and perform the measurement. Select the relevant monitoring points in the detection area, namely the sample points (according to the real field of view of the chip sampling area presented by the software, the area where the previously added conjugated antibody can be seen from the field of view is called the sample point, and each sample point only contains the area where the antibody is conjugated). Set the flow rate of the mobile phase to 2 μL / s.

[0151] (2) Enzyme-free PBS was selected as the buffer to obtain a stable SPR baseline signal.

[0152] (3) Tau protein prepared from diluted plasma at concentrations of 1 nmol / L, 10 nmol / L, 20 nmol / L, 40 nmol / L, 80 nmol / L and 100 nmol / L was injected sequentially. The binding time was set to 300 s and the dissociation time was set to 300 s. A 1:500 (volume ratio) diluted phosphate solution was introduced between each concentration for regeneration.

[0153] Figure 8 The linear dependence of Tau protein concentration in diluted plasma with SPR signal was shown. The concentration of Tau protein could be quantified by the detected SPR signal in the range of 1-100 nmol / L.

[0154] Experimental Example 5

[0155] This experimental example illustrates the signal differences in plasma dilutions from Alzheimer's disease patients (including AD and MCI) and healthy controls detected by the DNA tetrahedron-based SPRi sensor chip. The specific steps are as follows:

[0156] (1) Install the DNA tetrahedron-based SPRi sensor chip prepared by the method in Example 1 on the SPRi instrument and perform the measurement. Select the relevant monitoring points in the detection area, namely the sample points (according to the real field of view of the chip sampling area presented by the software, the area where the previously added conjugated antibody can be seen from the field of view is called the sample point, and each sample point only contains the area where the antibody is conjugated). Set the flow rate of the mobile phase to 2 μL / s.

[0157] (2) Enzyme-free PBS was selected as the buffer to obtain a stable SPR baseline signal.

[0158] (3) Plasma dilution (1:500) from different patients (including AD and MCI) and healthy control groups was injected sequentially. The binding time was set to 300s and the dissociation time was set to 300s. 20mmol / L sodium hydroxide was introduced between each sample for regeneration.

[0159] Based on the analysis of SPR signal detection results from different samples, receiver operating characteristic (ROC) curves for Aβ42, NFL, and Tau proteins in clinical plasma samples from the AD, MCI, and NC groups were plotted, and the area under the curve (AUC) was obtained. Figure 9 As shown, when differentiating between AD and NC groups, the multi-target detection method simultaneously introducing Aβ42, NFL, and Tau proteins can achieve 100% diagnostic sensitivity and 93.3% diagnostic specificity [95% confidence interval (0.918–1.000)], with an area under the curve of 0.973; for the differentiation between MCI and NC groups, which are of great interest, the multi-target detection method can achieve 53.3% diagnostic sensitivity and 100% diagnostic specificity [95% confidence interval (0.641–0.959)], with an area under the curve of 0.800.

[0160] Although the invention has been described to a certain extent, it is apparent that appropriate variations can be made to the various conditions without departing from the spirit and scope of the invention. It is understood that the invention is not limited to the described embodiments, but falls within the scope of the claims, which include equivalent substitutions for each of the elements. sequence list <110> National Center for Nanoscience and Technology <120> A DNA tetrahedron-based sensor chip, its fabrication method and system <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 109 <212> DNA <213> Artificial Sequence <400> 1 gcctggagat acatgcacat tacggctttc cctattagaa ggtctcaggt gcgcgtttcg 60 gtaagtagac gggaccagtt cgcctttttt ttttgtatcc agtggctca 109 <210> 2 <211> 84 <212> DNA <213> Artificial Sequence <400> 2 cgcgcacctg agaccttcta atagggtttg cgacagtcgt tcaactagaa tgccctttgg 60 gctgttccgg gtgtggctcg tcgg 84 <210> 3 <211> 84 <212> DNA <213> Artificial Sequence <400> 3 ggccgaggac tcctgctccg ctgcggtttg gcgaactggt cccgtctact taccgtttcc 60 gacgagccac acccggaaca gccc 84 <210> 4 <211> 84 <212> DNA <213> Artificial Sequence <400> 4 gccgtaatgt gcatgtatct ccaggctttc cgcagcggag caggagtcct cggcctttgg 60 gcattctagt tgaacgactg tcgc 84 <210> 5 <211> 15 <212> DNA <213> Artificial Sequence <400> 5 tgagccactg gatac 15

Claims

1. The application of a DNA tetrahedron-based sensor chip in the fabrication of a detection device for Alzheimer's disease, characterized in that, The DNA tetrahedron-based sensing chip is prepared by attaching the DNA tetrahedron to the surface of the sensing chip and then functionalizing it with antibodies; wherein: The DNA tetrahedron is a tetrahedral structure formed by DNA strands, and each side of the DNA tetrahedron has 26 base pairs. The triangles forming the DNA tetrahedron have the same planar dimensions and are uniformly dispersed on the substrate. Each of the three vertices of the bottom triangle of the DNA tetrahedron carries a thiol group, and a DNA strand extends from the top. The DNA strand extending from the top is a double-stranded DNA with carboxyl group modification. The number of base pairs of the DNA strand extending from the top is 15 bp, and the number of DNA strands extending from the top is 1. The sequences of the DNA strands forming the DNA tetrahedron include: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5; The sensor chip is an SPR imaging sensor chip; the antibody is selected from one or more of the following: Anti-Aβ42, Anti-NFL, and Anti-Tau.

2. A device for detecting Alzheimer's disease, characterized in that, The Alzheimer's disease detection device includes a DNA tetrahedron-based sensing chip, which is prepared by combining the DNA tetrahedron with the surface of the sensing chip and then functionalizing it with antibodies; wherein: The DNA tetrahedron is a tetrahedral structure formed by DNA strands, and each side of the DNA tetrahedron has 26 base pairs. The triangles forming the DNA tetrahedron have the same planar dimensions and are uniformly dispersed on the substrate. Each of the three vertices of the bottom triangle of the DNA tetrahedron carries a thiol group, and a DNA strand extends from the top. The DNA strand extending from the top is a double-stranded DNA with carboxyl group modification. The number of base pairs of the DNA strand extending from the top is 15 bp, and the number of DNA strands extending from the top is 1. The sequences of the DNA strands forming the DNA tetrahedron include: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5; The sensor chip is an SPR imaging sensor chip; the antibody is selected from one or more of the following: Anti-Aβ42, Anti-NFL, and Anti-Tau.

3. The application according to claim 1 or the detection device according to claim 2, characterized in that, The method for fabricating the DNA tetrahedron-based sensor chip includes: The DNA tetrahedron is bound to the surface of a sensor chip and then functionalized with an antibody, wherein the binding is a thiol bond and the antibody functionalization is an amidation reaction.

4. The application or detection device according to claim 3, characterized in that, The preparation method includes the following steps: (1) Prepare a DNA single-strand mixed solution, and then obtain a DNA tetrahedral solution after annealing; (2) The DNA tetrahedral solution prepared in step (1) is bonded to the sensor chip to obtain a DNA tetrahedral modified sensor chip; and (3) After activating the DNA tetrahedral modified sensor chip prepared in step (2), add antibody for incubation, wash and dry to obtain antibody-functionalized DNA tetrahedral based sensor chip.

5. The application or detection device according to claim 4, characterized in that: The step (1) further includes: first preparing a DNA single-strand mother liquor from the DNA single strand, and then mixing the DNA single-strand mother liquor with a buffer solution to obtain a DNA single-strand mixed solution.

6. The application or detection device according to claim 5, characterized in that: The sequences of the single-stranded DNA include: SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5; The buffer solution is a TM buffer solution, and the pH value of the buffer solution is 7.5–8.5; and / or The concentration of the single DNA strands in the DNA single-strand mixture is 0.4–5.0 μmol / L.

7. The application or detection device according to claim 6, characterized in that: The pH value of the buffer solution is 8; and / or The concentration of the single DNA strands in the DNA single-strand mixture is 0.4–2.0 μmol / L.

8. The application or detection device according to claim 7, characterized in that, The concentration of the single DNA strands in the DNA single-strand mixture is 1.0 μmol / L.

9. The application or detection device according to claim 4, characterized in that: In step (1), the annealing process includes a heating reaction and a cooling reaction.

10. The application or detection device according to claim 9, characterized in that: In step (1): The reaction temperature for the heating reaction is 95°C; The heating reaction time is 2–10 min; The cooling reaction time is greater than 30 seconds; and / or The reaction temperature for the cooling reaction is 4°C.

11. The application or detection device according to claim 10, characterized in that: In step (1): The heating reaction time is 4–9 min; and / or The cooling reaction takes more than 3 minutes.

12. The application or detection device according to claim 11, characterized in that: In step (1): The heating reaction time is 8 minutes; and / or The cooling reaction time is 8 minutes.

13. The application or detection device according to claim 4, characterized in that: Step (2) further includes: spreading the DNA tetrahedral solution prepared in step (1) on the surface of the sensor chip, incubating it to bond the DNA tetrahedrals with the sensor chip, washing it, and obtaining a DNA tetrahedral modified sensor chip.

14. The application or detection device according to claim 13, characterized in that: In step (2), the incubation time is 10 to 25 hours.

15. The application or detection device according to claim 14, characterized in that: In step (2), the incubation time is 10 to 20 hours.

16. The application or detection device according to claim 15, characterized in that: In step (2), the incubation time is 12 hours.

17. The application or detection device according to claim 4, characterized in that: Step (3) further includes: immersing the DNA tetrahedral modified sensor chip prepared in step (2) in an activator for hydroxyl activation, washing and drying, and adding antibody for incubation.

18. The application or detection device according to claim 17, characterized in that, In step (3): The activator is a mixed solution of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and nitrogen-hydroxysuccinimide (NHS); The volume of the antibody added to each sample spot is 0.4–1.0 μL; and / or The incubation time is 10–25 hours.

19. The application or detection device according to claim 18, characterized in that, In step (3): The volume of the antibody added to each sample drop is 0.4–0.5 μL; and / or The incubation time is 10 to 20 hours.

20. The application or detection device according to claim 19, characterized in that, In step (3): The volume of the antibody added to each sample spot is 0.4 μL; and / or The incubation time is 12 hours.

21. The application or detection device according to claim 4, characterized in that: Step (3) after incubation also includes: cleaning the chip and blocking the remaining activated carboxyl groups, and after washing and drying, obtaining the antibody-functionalized DNA tetrahedral-based sensor chip.

22. The application or detection device according to claim 21, characterized in that: In step (3), the solution used to block the remaining activated carboxyl groups is selected from one or more of the following: bovine serum albumin, skim milk powder, and ethanolamine.

23. The application or detection device according to claim 22, characterized in that: In step (3), the solution used to block the remaining activated carboxyl groups is bovine serum albumin.