Microsatellite Loci Combination, Primer Combination, Kit and Individual Tracing Application of Moschus berezovskii
Through the application of Linmu microsatellite combination, primer combination and kit, PCR amplification technology has been used to achieve high-precision individual tracer of Linmu, solving the problem of inaccurate identification results in the prior art, achieving 99.999% accuracy.
Patent Information
- Application Number
- CN202111081276.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-08-25
- Filing Date
- 2021-09-15
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2041-09-15
AI Technical Summary
The prior art has the problem that the identification results are not accurate enough in individual tracers of musk deer, which is difficult to meet the high-precision individual identification needs of musk deer.
A combination of microsatellite sites, primer combinations, and kits of Linmu. By screening out 8 microsatellite sites that best reflect the characteristics of Linmu. The corresponding primer combinations and kits are given, and high-precision individual traceability of Linmu.
It realizes high-precision individual tracer of musk deer, with an accuracy of 99.999%, and has the advantages of fast, accurate, simple and low cost.
Smart Images

Figure CN115433781B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the microsatellite marker technology of Moschus berezovskii, and particularly relates to a microsatellite locus combination, primer combination, kit and individual tracing application of Moschus berezovskii. Background Art
[0002] Moschus berezovskii belongs to Artiodactyla, Ruminantia, Moschus, and Moschus berezovskii. It is the smallest animal in the genus Moschus and is famous for the precious musk secreted by adult male Moschus berezovskii. Due to the huge economic value of musk, Moschus berezovskii has been poached and killed on a large scale, resulting in a sharp decline in the population of Moschus berezovskii. In 2002, Moschus berezovskii was listed as a first-class protected wild animal in China. In the IUCN Red List of Threatened Species in 2008, Moschus berezovskii was rated as an endangered species. Since the domestication of Moschus berezovskii began in 1958, after more than 60 years of development, the domestication of Moschus berezovskii has become an industry of a certain scale, achieving captive breeding and reproduction, and realizing sustainable artificial musk extraction from live animals at the initial stage of domestication. Thus, the domestication of Moschus berezovskii has become a legal basis for the sustainable supply of musk and an important way for the protection of Moschus berezovskii species.
[0003] There are various traditional individual marking methods. In the breeding of many livestock, the ancient methods of epidermal branding and partial body notching are relatively common. The advantage of these two methods is that for docile and long-domesticated animals, lifelong marking can be achieved without causing fatal harm to the animals themselves. However, for wild animals with a short domestication history and strong stress response, such marking methods are likely to cause lethal stress responses and infections. In the past decade or so, ear tag marking has been developed in the breeding of ungulates, which is conducive to monitoring the quarantine status of animals and individual tracking. For the management of larger animal populations, electronic ear tags have been developed in recent years. Through a reader, the number and quarantine status of marked individuals can be quickly monitored and tracked for classified management and real-time monitoring. The newly developed in vivo implanted capsule chips in recent years have even avoided the problem of easy detachment of external suspension and can be carried for life. However, these marking methods still have insurmountable deficiencies in practical applications. For example, plastic ear tag marking is a currently commonly used marking method, but it still generally has irritation, is easy to fall off and get infected. For individuals without ear tag marking, it is difficult to determine whether they belong to foreign musk sources, which brings inconvenience to protection and supervision, resulting in difficulties in supervision. Using electronic ear tags still has irritation, and tracking and reading are limited by the working status of the instrument. And the in vivo implanted marking is difficult to detect and identify at a long distance. Therefore, in individual tracing (individual identification), a unique biological marker that can be carried for life by an individual is essential.
[0004] The existing microsatellite marker technology is a gene identification technology that can be applied to individual tracing and population relationship research. Its microsatellite DNA is also called short tandem repeat (STR) or simple sequence repeat (SSR). It is a type of simple tandem repeat sequence with nucleotides as the basic unit. Microsatellite DNA consists of a core sequence and conserved sequences on both sides. Among them, the flanking sequence specifically locates the microsatellite DNA in a certain region of the chromosome, while the number of repeats of the core sequence forms the polymorphism of microsatellite DNA. Usually, the core sequence repeat unit is 2 - 6 bases long, such as (CA)n, (GAG)n, (GACA)n, where n is the number of repeats, ranging from 10 to 60 times. Due to different numbers of repeats, it shows rich length polymorphism. Microsatellite DNA is mostly located near the coding region, and can also be located in the intergenic spacer, exon, intron, and regulatory region of the gene, and is evenly distributed. The number of microsatellites in the genome is huge. It is estimated that there is an average of one microsatellite sequence per 6kb in the eukaryotic genome. The higher the polymorphism of microsatellite loci and the more the number of marker loci, the higher the accuracy of individual identification. Microsatellite markers conform to Mendelian genetic characteristics, are passed down from generation to generation, and have a slow mutation frequency. However, each individual is different. Therefore, it is a reliable lifelong genetic marker for individual tracing. For rare species such as Moschidae animals, the development and application research of their microsatellite markers are undoubtedly more urgent, necessary, and meaningful. However, compared with other captive economic animals, there are fewer reports on the development and application of microsatellite markers in forest musk deer, which may be related to factors such as the high protection level, small number, and restricted distribution area of forest musk deer.
[0005] In summary, there is an urgent need for a microsatellite locus combination, primer combination, and kit that can accurately trace individual forest musk deer for applications in aspects such as the breeding and research of forest musk deer. Summary of the Invention
[0006] The purpose of the present invention is to solve the technical problem of inaccurate identification results in the existing forest musk deer gene identification using microsatellite locus marker technology, and provide a microsatellite locus combination, primer combination, kit, and individual tracing application for forest musk deer. By adopting a suitable locus combination with four - base repeats, accurate individual tracing of forest musk deer based on gene identification is achieved.
[0007] To solve the above - mentioned technical problems, the technical solution provided by the present invention is as follows:
[0008] A microsatellite locus combination for forest musk deer, characterized in that:
[0009] It includes 8 microsatellite loci, which are the nucleotide sequences of SEQ ID NO1 - SEQ ID NO8 in the gene sequence list in sequence.
[0010] The present invention also provides a microsatellite primer combination for forest musk deer, which is characterized in that:
[0011] It includes 8 primer pairs corresponding to 8 microsatellite loci in the above-mentioned microsatellite locus combination for forest musk deer, and each primer pair includes 1 upstream primer and 1 downstream primer.
[0012] Further, the nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO1 is tgttcctgggattcttgaag, and the nucleotide sequence R of the downstream primer is cataattgccaaagtgctgt;
[0013] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO2 is ttgatccagttcagcaaagt, and the nucleotide sequence R of the downstream primer is tttgcaacttcaatccactg;
[0014] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO3 is gccaccagatacacaggttaaaa, and the nucleotide sequence R of the downstream primer is aactgactgaaagaccaggaaca;
[0015] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO4 is ccggcctaaagtttaaggtgtat, and the nucleotide sequence R of the downstream primer is atggctataggtggcagaagttt;
[0016] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO5 is acacaaacacagggaattctgtt, and the nucleotide sequence R of the downstream primer is agacaagtcatgctgccatttat;
[0017] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO6 is aggggtgaaaattagttgcctat, and the nucleotide sequence of the downstream primer is R is tatttcaaaggctcaatctgctc;
[0018] The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO7 is gaactgaaatcccacaggtcac, and the nucleotide sequence R of the downstream primer is ggcatgttgattttaccaatctg;
[0019] The upstream primer nucleotide sequence F of the microsatellite locus SEQ ID NO8 is agttgcagctaccagaattcatc, and the downstream primer nucleotide sequence R is gattgaagccagattctcctctt.
[0020] The present invention also provides a microsatellite kit for forest musk deer, which is characterized in that:
[0021] It includes the above-mentioned microsatellite primer combination for forest musk deer.
[0022] The present invention also provides an application of the microsatellite primer combination for forest musk deer, which is characterized in that:
[0023] The above-mentioned microsatellite primer combination for forest musk deer is applied to the individual tracing of forest musk deer.
[0024] Meanwhile, the present invention also provides an application of the microsatellite kit for forest musk deer, which is characterized in that:
[0025] The above-mentioned microsatellite kit for forest musk deer is applied to the individual tracing of forest musk deer.
[0026] The beneficial effects of the present invention compared with the prior art are as follows:
[0027] The microsatellite locus combination, primer combination, kit and individual tracing application for forest musk deer provided by the present invention have screened out 8 microsatellite loci that can best reflect the genetic characteristics of forest musk deer through long-term and large-scale experiments, and given the corresponding primer combination and kit. By using the primer combination and kit to perform PCR amplification on the DNA of forest musk deer, high-precision individual tracing of forest musk deer has been achieved, with an accuracy of 99.999%, and it has the advantages of being fast, accurate, simple and having a relatively low implementation cost. Description of the Drawings
[0028] Figure 1 It is the 1.5% agarose gel electrophoresis diagram of the DNA templates of 10 forest musk deer hair samples and DL 2000 DNA marker in the example;
[0029] Figure 2 It is the agarose gel electrophoresis diagram of the amplification products of 10 forest musk deer hair samples (all using the primer pair corresponding to the microsatellite locus SEQ ID NO5), DL 2000 DNA marker and blank control in the example;
[0030] Figure 3 It is the capillary electrophoresis peak diagram of the amplification obtained after the PCR reaction of the hair sample of forest musk deer No. 3 in the example using the primer pair corresponding to the microsatellite locus SEQ ID NO5. The abscissa in the figure is the DNA fragment length, and the ordinate is the signal intensity. Detailed Embodiments
[0031] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.
[0032] The present invention provides a combination of microsatellite loci for forest musk deer, including 8 microsatellite loci, which are successively the nucleotide sequences of SEQ ID NO1 to SEQ ID NO8 in the gene sequence list; it also provides a combination of microsatellite primers for forest musk deer, including 8 primer pairs corresponding to the 8 microsatellite loci in the combination of microsatellite loci for forest musk deer, and each primer pair includes 1 upstream primer and 1 downstream primer; it also provides a microsatellite kit for forest musk deer, including the above-mentioned combination of microsatellite primers for forest musk deer, and the individual tracing application of the above-mentioned combination of microsatellite primers for forest musk deer, or the microsatellite kit for forest musk deer.
[0033] Individual tracing is a process of judging whether the samples that appear twice or multiple times before and after belong to the same individual by testing the microsatellite markers of forest musk deer samples. Through the use of high-throughput RAD sequencing methods, a large number of SSR loci have been analyzed and experimented, and highly polymorphic loci suitable for forest musk deer have been screened out. Preparing the corresponding combination of microsatellite primers into a kit for identifying forest musk deer individuals can be used for rapid and effective individual tracing of forest musk deer, that is, using the products of the present invention to identify forest musk deer individuals, which has the advantages of being rapid, accurate, simple and having a relatively low implementation cost.
[0034] The kit is composed of primer combinations corresponding to the microsatellite loci of SEQ ID NO1 to SEQ ID NO8, and the accuracy of identifying forest musk deer individuals based on genotype identification of this kit reaches 99.999%.
[0035] The identification of forest musk deer individuals (individual tracing) includes the following steps:
[0036] 1) DNA template extraction
[0037] Collect samples, extract the DNA of forest musk deer from the hair samples of forest musk deer as a template;
[0038] 2) PCR amplification
[0039] Using the above-mentioned combination of microsatellite primers for forest musk deer, or the above-mentioned microsatellite kit for forest musk deer, and the DNA template obtained in step 1), perform a PCR amplification reaction to obtain an amplification product;
[0040] 3) Detection of amplification products
[0041] Perform 1.5% agarose gel electrophoresis detection on the amplification products to obtain electrophoretic bands with a single, clear band and a length within the corresponding base range;
[0042] 4) Send the amplification products to Shanghai Sangon Biotech Co., Ltd. for fluorescence capillary electrophoresis detection;
[0043] 5) Use Gene Mapper ID V3.2 software to perform genotyping on the results of fluorescence capillary electrophoresis detection, and then use Cervus 3.0 software to analyze the genotyping results.
[0044] The specific process is as follows:
[0045] 1. Experimental part
[0046] 1.1 Reagents and materials
[0047] The kit for microextraction of hair sample DNA and 10,000×Gene Green were both purchased from Tian Gen Company. 2×SanTaq PCR Mix, Agarose, sterilized double-distilled water (ddH2O), DL2000 DNA Marker, and 6×DNA Loading Buffer were all purchased from Shanghai Sangon Biotech Co., Ltd. 8 pairs of fluorescence primers (i.e., the 8 primer pairs in the present invention, and the specific information is shown in the microsatellite primer sequences of forest musk deer in Table 1 (i.e., the nucleotide sequences of microsatellite primers of forest musk deer)) were synthesized by Shanghai Sangon Biotech Co., Ltd. Dithiothreitol (DTT) and other reagents were all of analytical pure grade. All experimental water was ultrapure water treated by Milli-Q pure water system (Millipore Company, USA).
[0048] Table 1: Microsatellite primer sequences of forest musk deer
[0049]
[0050]
[0051] 1.2 Experimental instruments
[0052] Electric blast drying oven: Shanghai Yiheng Scientific Instrument Co., Ltd.; Vertical high-pressure sterilizer LDZX-50KBS: Shanghai Shen'an Medical Instrument Factory; Ultra-speed refrigerated centrifuge Centrifuge 5810R: Eppendorf Company, Germany; PCR instrument Veriti96-well: Applied Biosystems Company, USA; Centrifuge Centrifuge 5425: Eppendorf Company, Germany; Ultra-clean workbench: Thermo Scientific Company, USA; GIS gel imaging processing system GBOX F3: Gene Co., Ltd. Constant temperature metal bath CHB-100: Hangzhou BoRi Technology Co., Ltd.; Electrophoresis apparatus DYY-6C type: Beijing Liuyi Instrument Factory; Electrophoresis device DYCZ-24A: Beijing Liuyi Biotechnology Co., Ltd.; Vortex oscillator QL-901: Qilinbeier Instrument Manufacturing Co., Ltd., Haimen; Nucleic acid protein analyzer Nanodrop spectrophotometer (i.e., ultra-micro spectrophotometer): DeNovix Company, USA.
[0053] 1.3 Research objects and hair sampling
[0054] Collect the hair samples of forest musk deer in captive forest musk deer companies and farms in Shaanxi Province. Fix the dry end of the hair on the self-adhesive label, leaving the follicle end free. Finally, seal the hair samples in an envelope bag, and record information such as the individual number, gender, sampling time, and number of hairs of the sample on the envelope bag. Store them in the dark at room temperature and dry them with discolored silica gel.
[0055] 1.4 Extraction and detection of genetic sample DNA
[0056] Extract DNA from the collected hair samples of forest musk deer. Use the TIANamp Micro DNA Kit (TIANamp Micro DNA Kit, China) of Tian Gen Company to extract the DNA of hair samples, and aliquot the successfully extracted DNA template and store it at -80°C.
[0057] The obtained DNA was detected for concentration and quality using a nucleic acid protein analyzer Nanodrop spectrophotometer and 1.5% agarose gel electrophoresis respectively. In the agarose gel electrophoresis results under the same conditions, the closer the DNA band is to the loading point, the larger its fragment; the higher the brightness of the DNA band, the higher its concentration. After the DNA extraction work, in order to test the quality of the DNA extracted from the forest musk deer, take 2 μL of DNA template and mix it with 0.4 μL of 6×DNA Loading Buffer. Stain the agarose gel with TianGen GeneGreen, and electrophorese it in a 1.5% agarose gel at a voltage of 160 V for 20 min. After electrophoresis, use a UV gel imager to take pictures and observe the PCR electrophoresis effect. As Figure 1 shown, 1-10 in the figure represent the DNA templates of 10 forest musk deer DNA samples, and M is DL 2000 DNA marker (used for marking the DNA length).
[0058] 1.5 PCR reaction and detection of PCR amplification products
[0059] Using the primer pairs corresponding to 8 microsatellite loci respectively, PCR reactions were carried out with the DNA template of the forest musk deer hair samples (PCR amplification reaction, that is, in each reaction tube, a primer pair corresponding to 1 microsatellite locus was used to amplify the DNA template of a forest musk deer hair sample). The total volume of the PCR reaction system was 25 μL, including 2 μL of DNA template, 1 μL of upstream primer (10 μmol / L), 1 μL of downstream primer (10 μmol / L), 12 μL of PCR Mix (i.e., SanTaq PCR Mix), and 6 μL of dd H2O. After preparation, a small amount of liquid paraffin was added to prevent liquid evaporation. The PCR reaction program was pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 45 s, annealing at 50 - 61 °C for 45 s, extension at 72 °C for 1 min 30 s; 30 cycles (i.e., three steps including denaturation, annealing, and extension were repeated 30 times), and finally extension at 72 °C for 10 min; stored at 4 °C.
[0060] The 8 PCR amplification products were detected by 1.5% agarose gel electrophoresis. Specific operation: Use a pipette to take 2 μL of the PCR amplification product and add it into the sample well. Take 2.5 μL of 2000 bp DNA Marker and add it into the sample well. After loading the samples, cover the electrophoresis tank tightly, connect the power supply, with a voltage of 160 V, and electrophoresis for 20 min. The electrophoresis results were observed under ultraviolet transillumination in the gel imaging system. As Figure 2 shown, there was no band in the blank control, and the electrophoresis bands corresponding to the amplification products of the samples were clear and within the predetermined range. In the figure, 1 - 10 represent the samples of 10 forest musk deer PCR amplification products, M is the DL 2000 DNA marker, and the blank is the blank control. The amplification products were sent to Sangon Biotech in Shanghai for fluorescence capillary electrophoresis detection. Figure 3 For the hair sample of forest musk deer No. 3 in the example, after PCR reaction using the primer pair corresponding to the microsatellite locus SEQ ID NO5, the obtained capillary electrophoresis peak map of the amplification showed a double peak, indicating that the corresponding amplification product was a heterozygote.
[0061] 1.6 Data analysis
[0062] (1) Microsatellite genotyping
[0063] Using the Gene Mapper ID V3.2 software, the capillary electrophoresis results were automatically interpreted to obtain the allele lengths. The obtained allele lengths were real numbers. Since all the selected loci were tetra-nucleotide repeat loci, in most cases, rounding could be performed based on 4. For alleles with a difference of more than 1 bp before and after rounding, the peak map needed to be manually checked to correct the misinterpretation. To prevent genotyping errors, for false homozygotes and false alleles, at least 3 independent repeated experiments were required for heterozygotes, and at least 2 independent repeated experiments were required for homozygotes.
[0064] (2) Individual tracer data analysis
[0065] Individual tracing is a process of determining whether samples that appear twice or multiple times before and after belong to the same individual by testing genetic markers of forest musk deer samples.
[0066] 2. Results section
[0067] This kit was developed using software Cervus 3.0 and SHEsis to calculate the Hardy-Weinberg equilibrium and linkage disequilibrium test for each locus to ensure that each locus plays a role in individual tracing. Genotype data was obtained using Gene Mapper ID V3.2 software, and the Identity analysis program in Cervus 3.0 was used to identify all genotyped individuals. This kit uses primer pairs corresponding to 8 microsatellite loci to identify individual forest musk deer in Shaanxi Province. The test results for a large number of individual forest musk deer samples show that the combination of 8 microsatellite loci of the present invention has an exclusion probability (CPE I ) as high as 99.999%.
[0068] DNA contains all the genetic information of each individual, which is inherent and remains unchanged throughout life. Therefore, each individual should have only one locus genotype. When two individual genotypes are detected to be the same, these two individuals are the same individual.
[0069] When using the microsatellite primer combination or kit of the present invention, samples of captive forest musk deer in Shaanxi Province under the same environment are collected each time, and other factors are excluded as much as possible. The measured samples are repeated three times to determine the accuracy of the genotype.
[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. For those of ordinary skill in the art, the specific technical solutions recorded in the foregoing embodiments can be modified, or some of the technical features can be equivalently replaced. These modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions protected by the present invention.
Claims
1. A microsatellite primer combination for Moschus berezovskii, characterized in that: It includes 8 primer pairs corresponding to 8 microsatellite loci respectively, and each primer pair includes 1 upstream primer and 1 downstream primer; among them, the 8 microsatellite loci are nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 8 in the gene sequence list in sequence; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 1 is tgttcctgggattcttgaag, and the nucleotide sequence R of the downstream primer is cataattgccaaagtgctgt; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 2 is ttgatccagttcagcaaagt, and the nucleotide sequence R of the downstream primer is tttgcaacttcaatccactg; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 3 is gccaccagatacacaggttaaaa, and the nucleotide sequence R of the downstream primer is aactgactgaaagaccaggaaca; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 4 is ccggcctaaagtttaaggtgtat, and the nucleotide sequence R of the downstream primer is atggctataggtggcagaagttt; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 5 is acacaaacacagggaattctgtt, and the nucleotide sequence R of the downstream primer is agacaagtcatgctgccatttat; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 6 is aggggtgaaaattagttgcctat, and the nucleotide sequence of the downstream primer R is tatttcaaaggctcaatctgctc; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 7 is gaactgaaatcccacaggtcac, and the nucleotide sequence R of the downstream primer is ggcatgttgattttaccaatctg; The nucleotide sequence F of the upstream primer of microsatellite locus SEQ ID NO: 8 is agttgcagctaccagaattcatc, and the nucleotide sequence R of the downstream primer is gattgaagccagattctcctctt.
2. A microsatellite kit for Moschus berezovskii, characterized in that: It includes the microsatellite primer combination of claim 1.
3. An application of the microsatellite primer combination for Moschus berezovskii, characterized in that: The microsatellite primer combination of claim 1 is applied to the individual tracing of Moschus berezovskii.
4. An application of the microsatellite kit for Moschus berezovskii, characterized in that: The microsatellite kit for Moschus berezovskii of claim 2 is applied to the individual tracing of Moschus berezovskii.
Citation Information
Patent Citations
Forest musk deer microsatellite site combination, primer combination, kit and paternity identification application
CN114317764A