ALV-J-resistant chicken chNHE1 gene-edited cell line and its construction method

Abstract

The present invention discloses an ALV-J-resistant chicken chNHE1 gene-edited cell line and a construction method thereof. The present invention utilizes CRISPR / Cas9 method and flow cytometry screening to mutate the key amino acid site V33 of the ALV-J cell receptor chNHE1 gene and delete W38, and at the same time, in order to facilitate the identification of the later gene editing results, the 34-37 amino acid codons encoded by it are synonymously replaced. The results show that the replacement sequence containing the W38 site deletion and the V33 site mutation can efficiently and point-in replace the corresponding sequence of the chNHE1 gene, and the chNHE1 gene-edited cell line can resist the infection of ALV-J without affecting the cell proliferation level. The present invention establishes an efficient method for constructing a chicken chNHE1 gene-edited cell line by mutating the key amino acid sites of chNHE1 as an ALV-J receptor, laying a foundation for further studying the function of the chNHE1 gene.

Description

Technical Field

[0001] The present invention relates to a chicken chNHE1 gene editing cell line and a construction method thereof, and in particular to an ALV-J-resistant chicken chNHE1 gene editing cell line obtained based on CRISPR / Cas editing technology and a construction method thereof. The present invention belongs to the field of biotechnology. Background Art

[0002] Avian leukosis (AL) is a general term for various tumor diseases of poultry caused by avian leukosis virus (ALV) and avian sarcoma virus (RSV). According to the differences in host range, viral envelope gene and serological cross-reactivity, ALV is currently divided into 10 subgroups A-J. In recent years, a new ALV subgroup has emerged in my country, designated as subgroup K [Cui N, Su S, Chen Z, et al. Genomic sequence analysis and biological characteristics of a rescued clone of avian leukosis virus strain JS11C1, isolated from indigenous chickens [J]. J Gen Virol, 2014, 95 (Pt11): 2512-2522.]. Compared with other subgroups, ALV-J has a wider host range, stronger pathogenicity and mutation ability. The existence of ALV has not only brought serious economic losses to my country's poultry industry, but also seriously threatened the safety of my country's poultry seed sources.

[0003] At present, the main prevention and control measure for ALV is to purify the breeder flock. However, the purification of ALV requires multiple tests on multiple generations of chickens, a process that must be carried out continuously, requires a lot of manpower and material resources, is time-consuming and costly. Therefore, research on new ALV prevention and control technologies is crucial for the prevention and control of ALV. The best way to prevent and eradicate seed-borne diseases is to establish disease-resistant breeding technology, and the combination of viruses and receptors is a key step in establishing infection. Therefore, by cultivating chickens with ALV receptor function defects, the invasion of the virus can be blocked, forming a natural protective barrier for the chickens.

[0004] ALV belongs to the genus α-retrovirus, has a typical avian retrovirus genome structure, and is an enveloped RNA virus. The adsorption and binding of retrovirus virus particles to specific receptors on the surface of host cells is a key step in establishing infection. ALV binds to specific receptors on the surface of host cells through its envelope protein and thus adsorbs to the surface of host cells.+ / H + The exchange protein (chNHE1) is the cell receptor of ALV-J [Chai N, Bates P.Na+ / H+exchanger type1is a receptor for pathogenic subgroup Javian leukosis virus[J].Proceedings of the National Academy of Sciences of the United States of America,2006,103(14):5531-5536.]. NHE1, as a sodium-hydrogen exchange pump, is widely present in mammalian cells and has the functions of regulating intracellular and extracellular pH and maintaining cell morphology. Therefore, chNHE1 is crucial for the normal life activities of cells [Putney LK,Denker SP,Barber DL.The changing face of the Na + / H + exchanger,NHE1:structure,regulation,and cellular actions[J].Annu Rev Pharmacol Toxicol,2002,42:527-552.Kemp G,Young H,Fliegel L.Structure and function of the human Na + / H + exchanger isoform 1[J].Channels(Austin),2008,2(5):329-36.Reddy T,Li X,FliegelL,et al.Correlating structure,dynamics,and function in transmembrane segmentVII of the Na + / H + exchanger isoform 1[J].Biochim BiophysActa,2010,1798(2):94-104.].

[0005] As a new generation of gene editing technology, CRISPR / Cas gene editing technology can achieve "precise" gene editing. CRISPR / Cas9 technology has been successfully used in chickens. Studies have used CRISPR / Cas9 technology to achieve specific gene editing events in chicken somatic cells, chicken immortalized fibroblast cell line DF1 cells, and primordial germ cells. Therefore, the present invention intends to use CRISPR / Cas9 technology to mutate or delete the key amino acid sites of chNHE1 that mediate ALV-J invasion, laying the foundation for further construction of gene-edited chickens resistant to ALV-J. Summary of the invention

[0006] The object of the present invention is to provide an ALV-J-resistant chicken chNHE1 gene-edited cell line and a construction method thereof.

[0007] In order to achieve the above object, the present invention adopts the following technical means:

[0008] In order to construct a cell line resistant to J subgroup avian leukosis virus (ALV-J) infection, the present invention uses CRISPR / Cas9 method and flow cytometry screening to mutate the key amino acid site V33 of the ALV-J cell receptor chNHE1 gene and delete W38. The results show that the replacement sequence containing the W38 site deletion and the V33 site mutation can efficiently replace the corresponding sequence of the chNHE1 gene; the W38 site deletion and V33 site mutation of the chNHE1 gene were detected by sequencing analysis; the chNHE1 gene-edited cell line can resist ALV-J infection without affecting the cell proliferation level. The present invention establishes a method for efficient gene editing of the DF1 gene by mutating the key amino acid sites of chNHE1 as an ALV-J receptor, laying a foundation for further studying the function of the chNHE1 gene.

[0009] In the present invention, firstly, the present invention proposes a mutant avian type I Na+ / H+ exchanger (chNHE1) encoding gene, which is obtained by deleting and mutating the original avian type I Na+ / H+ exchanger (chNHE1) encoding gene, including: deleting and expressing the 38th amino acid encoded by the chNHE1 gene, mutating the 33rd amino acid encoded by the chNHE1 gene from valine to glycine, and in order to facilitate the identification of the later gene editing results, simultaneously performing synonymous replacement on the amino acid codons encoded by the 34th to 37th amino acids, that is, the 34th amino acid codon mutates from TCC to TCG, the 35th amino acid codon mutates from GAG to GAA, the 36th amino acid codon mutates from CCC to CCG, and the 37th amino acid codon mutates from ACC to ACG.

[0010] Among them, preferably, the mutant avian type I Na+ / H+ exchanger (chNHE1) encoding gene has a sequence as shown in SEQ ID NO.2.

[0011] Furthermore, the present invention also proposes the use of the mutant avian type I Na+ / H+ exchanger (chNHE1) encoding gene in constructing an ALV-J-resistant chicken chNHE1 gene-edited cell line.

[0012] Furthermore, the present invention also proposes an ALV-J-resistant chicken chNHE1 gene-edited cell line, wherein the cell line uses CRISPR / Cas9 editing technology to insert a replacement sequence into the chNHE1 gene and replace the sequence at the corresponding position in the original sequence, so that the 38th amino acid of the protein encoded by the replaced chNHE1 gene is deleted and expressed, the 33rd amino acid is mutated from valine to glycine, and the codons encoding the 34th to 37th amino acids are synonymously replaced, that is, the 34th amino acid codon is mutated from TCC to TCG, the 35th amino acid codon is mutated from GAG to GAA, the 36th amino acid codon is mutated from CCC to CCG, and the 37th amino acid codon is mutated from ACC to ACG.

[0013] Among them, preferably, the cell line is chicken fibroblast cell line DF-1.

[0014] Furthermore, the present invention also proposes a method for constructing the chicken chNHE1 gene-edited cell line, comprising the following steps:

[0015] (1) Vector construction

[0016] A chNHE1 knockout guide RNA (gRNA) sequence was synthesized, and its nucleotide sequence was shown in SEQ ID NO.1. The sequence was inserted into the pMD-18T vector to construct a chNHE1-sgRNA knockout plasmid; an ssODN sequence was synthesized, and its nucleotide sequence was shown in SEQ ID NO.2;

[0017] (2) Construction and screening of r-chNHE1 cell lines

[0018] The pCas9-GFP plasmid, chNHE1-sgRNA plasmid and ssOND were co-transfected into DF1 cells. After 48 hours of culture, cells with GFP fluorescence were screened using a flow cytometer and inoculated into a 96-well plate at a dilution ratio of 5 cells / well. After 7 days, the monoclonal cell line was screened under an optical microscope and expanded. The genome of the r-chNHE1 cell line was extracted using a genome extraction kit. P1 and P3 were used as primers to identify whether the mutation was successful. P2 and P3 were used as primers to identify whether there was a chNHE1 gene sequence that was not successfully mutated in the r-chNHE1 monoclonal cell. The replacement sequence was amplified using chNHE1-CX-F and chNHE1-CX-R primers, and the amplified product was recovered and connected to pMD-18T for sequencing identification.

[0019] P1:CGCGTGGATCGGAACCGACG

[0020] P2: CGCGTGTCTCCGAGCCCACC

[0021] P3:GTTCAGCGGGTGCACCTCCT

[0022] chNHE1-CX-F:CCCTTCCCTGGGCCTCTGCTGC

[0023] chNHE1-CX-R:TGTTCAGCGGGTGCACCTCC

[0024] The correctly identified monoclonal cell line is the chicken chNHE1 gene-edited cell line.

[0025] Furthermore, the present invention also proposes the use of the ALV-J-resistant chicken chNHE1 gene-edited cell line in constructing ALV-J-resistant gene-edited chickens.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. Although the literature reports that single-point deletion of W38 can resist ALV-J infection, according to our previous research results, in addition to W38, A30, V33 and E39 are all crucial for the binding of ALV-J to the receptor. Compared with the amino acid sequence of the non-susceptible host quail of ALV-J, W38 and V33 are unique to the chNHE1 of chickens. Therefore, the present invention mutates or deletes the 33rd and 38th amino acid sites of chNHE1, and successfully mutates or deletes the 33rd and 38th amino acid sites of chNHE1 using CRISPR / Cas9 technology. The results show that the chNHE1 gene-edited cell line r-chNHE1 can be effectively obtained using CRISPR / Cas9 technology. The results of inoculation show that the chNHE1 gene-edited cell line r-chNHE1 can effectively resist infection by ALV-J strains.

[0028] 2. At present, the construction of DF1 gene-edited cells is mainly carried out by transfecting Cas9 expression plasmids containing resistance and replacement fragments. This method obtains gene-edited cell lines through drug screening, which increases the probability of random integration of exogenous resistance genes into the host genome. This method has certain hidden dangers for the construction of transgenic chickens [Lee HJ, Lee KY, Jung KM, et al. Precise gene editing of chicken Na+ / H+ exchange type1 (chNHE1) confers resistance to avian leukosis virus subgroup J (ALV-J) [J]. Developmental & Comparative Immunology, 2017, 77: 340-349.]. The present invention successfully screened and obtained the chNHE1 gene-edited cell line r-chNHE1 by flow cytometry, reducing the risk of random insertion of transfected plasmids into the host genome.

[0029] 3. At present, the identification of DF1 gene-edited cell lines is mainly carried out by introducing synonymous mutations at adjacent amino acid sites while mutating the target site, making them restriction endonuclease cleavage sites, and finally performing enzyme cleavage identification on the gene-edited cell lines. It is impossible to accurately determine whether there is a trace amount of wild-type cell contamination or reversion mutations in the edited cell line, and this method has certain limitations. The present invention introduces synonymous mutations at multiple adjacent amino acid sites while mutating the target site, and uses the synonymous mutation region sequence as an identification primer to identify the gene-edited cell line. This study provides a new idea for the construction and identification of gene-edited cell lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1PCR identification of r-chNHE1 cell lines;

[0031] Among them, WT: wild-type DF1 cell line, r-chNHE1: r-chNHE1 cell line;

[0032] Figure 2 To identify the genetic stability of the r-chNHE1 cell line;

[0033] Among them, WT: wild-type DF1 cell line, F1: first-generation r-chNHE1 cell line, F5: fifth-generation r-chNHE1 cell line;

[0034] Figure 3 To identify the proliferation level of r-chNHE1 cell line;

[0035] Figure 4 To detect the level of r-chNHE1 cell line's resistance to ALV-J-GFP strain infection;

[0036] Figure 5 This is a test of the resistance of r-chNHE1 cell line to ALV-J strain infection. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with specific examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, these examples are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0038] Example 1 Construction of chicken chNHE1 gene-edited cell line

[0039] 1 Materials and methods

[0040] 1.1 Main experimental materials

[0041] DF1 cells and recombinant virus ALV-J-GFP and ALV-A-GFP strains expressing green fluorescent protein were preserved in our laboratory; 4A10 mouse-derived Mab was prepared by our laboratory; ALV-J (SH5) was isolated by our laboratory; green fluorescent AlexaFluor 488 goat anti-mouse antibody was purchased from Thermo; TIANamp Genomic DNA extraction kit was purchased from TIANGEN; pMD-18T vector was purchased from TARAKA; pCas9-GFP plasmid was preserved in our laboratory.

[0042] 1.2 Vector construction

[0043] The chNHE1 knockout guide RNA (gRNA) sequence (GCGTGTCTCCGAGCCCACCT, SEQ ID NO. 1) was designed using E-CRISP online software (http: / / www.e-crisp.org / E-CRISP / designcris / html), and the sequence was inserted into the pMD-18T vector to construct the chNHE1-sgRNA knockout plasmid. According to the chNHE1 gene sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / ), ssODN (AGGCCGACGCCACGCGTGGATCGGAACCGACGGAGCAGCCGTGGGGAGAGCCCGGGGGTATCACCGCCGCCCCGCTGGCCACGGCCCAGGAGGTGCACCCGCTG, SEQ ID NO.2) was designed to delete and express the amino acid at position 38 encoded by the chNHE1 gene, mutate and express the amino acid at position 33 (V / G), and perform synonymous substitution on the amino acid codons at positions 34-37, that is, the amino acid codon at position 34 was mutated from TCC to TCG, the amino acid codon at position 35 was mutated from GAG to GAA, the amino acid codon at position 36 was mutated from CCC to CCG, and the amino acid codon at position 37 was mutated from ACC to ACG.

[0044] 1.3 Construction and screening of r-chNHE1 cell lines

[0045] The pCas9-GFP plasmid, chNHE1-sgRNA plasmid and ssOND were co-transfected into DF1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometer and inoculated into a 96-well plate at a dilution ratio of 5 cells / well. After 7 days, the monoclonal cell line (r-chNHE1) was screened under an optical microscope and expanded. The genome of the r-chNHE1 cell line was extracted using a genome extraction kit, and primers were designed in the replacement sequence region. P1 (CGCGTGGATCGGAACCGACG) and P3 (GTTCAGCGGGTGCACCTCCT) were used as primers to identify whether the mutation was successful. P2 (CGCGTGTCTCCGAGCCCACC) and P3 were used as primers to identify whether there was an unsuccessful mutation of the chNHE1 gene sequence in the r-chNHE1 monoclonal cell. The replacement sequence was amplified using primers chNHE1-CX-F (CCCTTCCCTGGGCTCTGCTGC) and chNHE1-CX-R (TGTTCAGCGGGTGCACCTCC), and the amplified product was recovered and connected to pMD-18T for sequencing identification.

[0046] 1.4 Detection of genetic stability of r-chNHE1 cell line

[0047] The genome of the r-chNHE1 cell line cultured to the fifth generation was extracted using a genome extraction kit, and P1 and P3 were used as primers to identify whether the replacement sequence still existed. P2 and P3 were used as primers to identify whether the wild-type reverted chNHE1 gene sequence existed in the r-chNHE1 monoclonal cells.

[0048] 1.5 Detection of proliferation level of r-chNHE1 cell line

[0049] r-chNHE1 cell line and wild-type DF1 cell line were each taken at 2×10 5 The cells were plated in 12-well plates at a density of 10 cells / well. Three parallel wells of the two cell lines were digested with trypsin at 12h, 24h, 36h, 48h and 60h after plating, and each well was resuspended in 1mL of culture medium and counted and analyzed.

[0050] 1.6 Detection of the resistance of r-chNHE1 cell line to ALV-J-GFP infection

[0051] r-chNHE1 cell line and wild-type DF1 cell line were each taken at 5×10 5 The cells were plated in 12-well plates at a density of 10 cells / well. After 16 hours, ALV-J-GFP strain (10 5.2 TCID50 / mL) and ALV-A-GFP strain (10 5.8 TCID50 / mL) 100 μL / well, three parallel wells were set. 72 hours after infection, the GFP fluorescence ratio was observed by inverted fluorescence microscope to detect the ratio of r-chNHE1 cell line and wild-type DF1 cell line infected with ALV-J-GFP strain and ALV-A-GFP strain.

[0052] 1.7 Detection of the resistance of r-chNHE1 cell line to infection by wild-type ALV-J-GFP strain

[0053] r-chNHE1 cell line and wild-type DF1 cell line were each taken at 5×10 5 The cells were plated in 12-well plates at a density of 10 cells / well. After 16 h, ALV-J (SH5) strain (10 5.5TCID50 / mL) / well, with 3 parallel wells in each group. After 72 hours of infection, the cells were fixed with 4% paraformaldehyde, and 4A10 mouse MAb (1:100 dilution) was used as the primary antibody, and Alexa Fluor488 goat anti-mouse antibody (1:1000 dilution) was used as the secondary antibody. IFA was used to detect the proportion of r-chNHE1 cell line and wild-type DF1 cell line infected with ALV-J (SH5) strain.

[0054] 2 Results

[0055] 2.1 Construction and screening of r-chNHE1 cell lines

[0056] The replacement sequence was inserted into the chNHE1 gene by the CRISPR / Cas9 method, resulting in the deletion of the amino acid at position 38, the mutation of the amino acid at position 33 (V / G), and the synonymous substitution of the codons encoding the amino acids at positions 34-37. The genome of the r-chNHE1 cell line was extracted, and the r-chNHE1 cell line was amplified and identified by PCR amplification. Using the genome of the r-chNHE1 cell line as a template, an upstream primer P1 was designed within the replacement sequence for PCR amplification verification. The results showed that among the 48 monoclonal cell lines, 13 strains successfully obtained sequence insertion, with an insertion efficiency of approximately 27%. An upstream primer P2 was designed within the gene encoding the 33rd-38th amino acids of the chNHE1 gene, and one of the monoclonal cell lines was selected for further PCR verification. The results showed that the wild-type DF1 cell line could amplify a PCR product of about 548 bp, while the r-chNHE1 cell line could not amplify a PCR product of about 548 bp, indicating that the selected monoclonal cell line was not contaminated by wild-type DF1 cells ( Figure 1 ). Further sequencing analysis showed that the replacement sequence was successfully inserted into the chNHE1 gene, indicating that the r-chNHE1 cell line was successfully obtained.

[0057] 2.2 Genetic stability test of r-chNHE1 cell line

[0058] The r-chNHE1 cell line was continuously passaged to the fifth generation, and the cells were collected. The genome of the fifth generation r-chNHE1 cell line was used as a template and the r-chNHE1 cell line identification primers (P1+P3, P2+P3) were used for identification. The results showed that the replacement sequence of the fifth generation r-chNHE1 cell line did not undergo a reversion mutation ( Figure 2 ).

[0059] 2.3 Detection of proliferation level of r-chNHE1 cell line

[0060] The r-chNHE1 cell line and the wild-type DF1 cell line were inoculated into 12-well plates, and the cells were counted and analyzed every 12 hours. The results showed that there was no difference in the proliferation level between the r-chNHE1 cell line and the wild-type DF1 cell line. Figure 3 shown.

[0061] 2.4 Detection of the resistance of r-chNHE1 cell line to ALV-J-GFP infection

[0062] The r-chNHE1 cell line and the wild-type DF1 cell line were inoculated into 12-well plates, and 16 hours later, they were infected with ALV-J-GFP and ALV-A-GFP strains, respectively. The GFP fluorescence ratio was observed 72 hours after infection. The results showed that compared with wild-type DF1 cells, the r-chNHE1 cell line had no GFP fluorescence after being infected with the ALLV-J-GFP strain, while the wild-type DF1 cell line and the r-chNHE1 cell line had GFP fluorescence after being infected with the ALV-A-GFP strain. This shows that the r-chNHE1 cell line can resist the infection of the ALV-J-GFP strain without affecting the infection of the ALV-A-GFP strain. The results are shown in Figure 4 shown.

[0063] 2.5 Detection of the resistance of r-chNHE1 cell line to ALV-J wild-type virus infection

[0064] The r-chNHE1 cell line and the wild-type DF1 cell line were inoculated into 12-well plates, and were inoculated with the ALV-J wild-type strain 16 hours later. Indirect immunofluorescence assay was performed 72 hours after infection. The results showed that compared with wild-type DF1 cells, the r-chNHE1 cell line was not infected with the ALLV-J wild-type strain (green fluorescence), indicating that the r-chNHE1 cell line can resist infection with the ALV-J wild-type strain. Figure 5 shown. Sequence Listing <110> Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Harbin Branch of China Animal Health and Epidemiology Center) <120> ALV-J-resistant chicken chNHE1 gene-edited cell line and its construction method <130> KLPI210140 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <400> 1 gcgtgtctcc gagcccacct 20 <210> 2 <211> 104 <212> DNA <213> artificial sequence <400> 2 aggccgacgc cacgcgtgga tcggaaccga cggagcagcc gtggggagag cccgggggta 60 tcaccgccgc cccgctggcc acggcccagg aggtgcaccc gctg 104

Claims

1. A method for constructing an ALV-J-resistant chicken chNHE1 gene-edited cell line, characterized in that: The following steps are involved: (1) Vector construction A chNHE1 knockout guide RNA sequence was synthesized, and its nucleotide sequence was shown in SEQ ID NO.

1. The sequence was inserted into the pMD-18T vector to construct a chNHE1-sgRNA knockout plasmid; an ssOND sequence was synthesized, and its nucleotide sequence was shown in SEQ ID NO.2; (2) Construction and screening of r-chNHE1 cell lines The pCas9-GFP plasmid, chNHE1-sgRNA plasmid and ssOND were co-transfected into DF1 cells. After 48 hours of culture, cells with GFP fluorescence were screened using a flow cytometer and inoculated into a 96-well plate at a dilution ratio of 5 cells / well. After 7 days, the monoclonal cell line was screened under an optical microscope and expanded. The genome of the r-chNHE1 cell line was extracted using a genome extraction kit. P1 and P3 were used as primers to identify whether the mutation was successful. P2 and P3 were used as primers to identify whether there was a chNHE1 gene sequence that was not successfully mutated in the r-chNHE1 monoclonal cell. The replacement sequence was amplified using chNHE1-CX-F and chNHE1-CX-R primers, and the amplified product was recovered and connected to pMD-18T for sequencing identification. P1:CGCGTGGATCGGAACCGACG P2: CGCGTGTCTCCGAGCCCACC P3:GTTCAGCGGGTGCACCTCCT chNHE1-CX-F:CCCTTCCCTGGGCCTCTGCTGC chNHE1-CX-R:TGTTCAGCGGGTGCACCTCC The correct monoclonal cell line was identified as the ALV-J-resistant chicken chNHE1 gene-edited cell line.

2. The ALV-J-resistant chicken chNHE1 gene-edited cell line constructed according to the method of claim 1 is characterized in that: The cell line is produced by inserting a replacement sequence into the chNHE1 gene and replacing the sequence at the corresponding position in the original sequence through CRISPR / Cas9 editing technology, so that the 38th amino acid of the protein encoded by the replaced chNHE1 gene is deleted and expressed, the 33rd amino acid is mutated from valine to glycine, and the codons encoding the 34th to 37th amino acids are synonymously replaced, that is, the 34th amino acid codon is mutated from TCC to TCG, the 35th amino acid codon is mutated from GAG to GAA, the 36th amino acid codon is mutated from CCC to CCG, and the 37th amino acid codon is mutated from ACC to ACG.

3. Use of the ALV-J-resistant chicken chNHE1 gene-edited cell line according to claim 2 in constructing ALV-J-resistant gene-edited chickens.

Images