Application of a novel stem mustard miRNA in regulating salt stress in plants
By discovering and overexpressing miR240 in *Mustela stenoptera*, the gap in research on salt stress resistance of *Mustela stenoptera* was filled, the salt stress tolerance of plants was improved, and high-yield and high-quality breeding for agricultural production was promoted.
Patent Information
- Application Number
- CN202210822839.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-12
- Publication Date
- 2026-06-02
- Estimated Expiration
- 2042-07-12
AI Technical Summary
In the current technology, there is a lack of research on the resistance of stem mustard to salt stress, and there is a lack of reports on the participation of miRNA in the stress response, which affects its growth and economic value.
A novel miRNA (miR240) was discovered and overexpressed in *Mustela stenoptera*. By constructing a recombinant expression vector and introducing it into the plant genome, the expression level of miR240 was increased, thereby enhancing the plant's salt stress tolerance.
It has improved the survival ability of plants under salt stress, reduced the economic losses caused by salt stress, provided new genetic resources for salt-tolerant breeding, and promoted high-yield and high-quality breeding in agricultural production.
Smart Images

Figure HDA0003742962210000011 
Figure HDA0003742962210000012 
Figure HDA0003742962210000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and specifically relates to the application of a stem mustard miRNA in regulating plant salt stress tolerance. Background Technology
[0002] It is estimated that over 6% of the world's land and nearly 20% of arable land are affected by salt stress, and soil salinization is increasingly threatening the limited land resources upon which humanity depends for survival. Soil salinization in my country is becoming increasingly severe, posing a serious threat to the country's food security. Most crop varieties are salt-sensitive, and soil salinization hinders crop growth, leading to reduced yields or even crop failure. Breeding salt-tolerant crop varieties is a cost-effective, quick-return, and long-term sustainable method for improving crop yields and economic benefits in saline soils. The discovery of salt-tolerant genes and the creation of salt-tolerant germplasm are crucial guarantees for salt-tolerant breeding.
[0003] Stem mustard, a specialty economic crop in my country, has high economic value due to its enlarged tubers, which are the raw material for pickled mustard tubers. However, stem mustard is constantly affected by abiotic stresses (salt, flooding, low temperature, high temperature, drought, etc.) and biotic stresses (pathogens, etc.) during its growth and development, leading to inhibited plant growth, reduced yield, and poor taste, resulting in significant economic losses. Previous studies have shown that stem mustard has strong resistance to abiotic stresses, and several stress-related genes have been obtained from it, but most are protease genes. MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs with a length of 20-24 nucleotides. Plant miRNAs recognize and degrade target gene mRNAs or inhibit their translation process through base pairing, negatively regulating the expression of target genes. Studies have found that miRNAs participate in regulating plant growth and development, morphogenesis, and stress responses. To date, there are no reports on the role of miRNAs in stress resistance in stem mustard, leaving a significant gap in research. Therefore, research on the stress resistance response of miRNAs in stem mustard is of great significance. Summary of the Invention
[0004] To address the aforementioned problems in existing technologies, the present invention aims to provide an application of *Strombus amurensis* miRNA in regulating plant salt stress tolerance. A novel salt-responsive miRNA has been discovered in *Strombus amurensis*, providing a new gene or target for breeding new salt-tolerant *Strombus amurensis* varieties or other new plant materials, thus filling a research gap.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: the application of a stem-nodular mustard miRNA, or a biological material containing the precursor sequence of the stem-nodular mustard miRNA, in regulating plant salt stress, wherein the mature sequence of the stem-nodular mustard miRNA has the sequence shown in SEQ ID NO.1, and the name of the miRNA is miR240.
[0006] Another object of the present invention is to provide a stem-nodular mustard miRNA, or a biological material containing the precursor sequence of the stem-nodular mustard miRNA, for use in the selection and breeding of salt-tolerant plants, wherein the mature sequence of the stem-nodular mustard miRNA has the sequence shown in SEQ ID NO.1, and the name of the miRNA is miR240.
[0007] Another object of the present invention is to provide a stem-nodular mustard miRNA, or a biological material containing the precursor sequence of the stem-nodular mustard miRNA, for the application in the improvement of germplasm resources for salt stress tolerance in plants, wherein the mature sequence of the stem-nodular mustard miRNA has the sequence shown in SEQ ID NO.1, and the name of the miRNA is miR240.
[0008] Preferably, the precursor sequence of the stem mustard miRNA has the sequence shown in SEQ ID NO.2.
[0009] Preferably, the biological material is an expression cassette, transposon, vector, host cell, transgenic cell line, or engineered bacteria.
[0010] Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant.
[0011] Preferably, the plant is stem mustard, Arabidopsis thaliana, rapeseed, or Chinese cabbage.
[0012] Another object of the present invention is to provide a method for improving the salt stress tolerance of plants by increasing the expression level of *Streptococcus solani* miRNA in the target plant, wherein the mature sequence of *Streptococcus solani* miRNA is shown in SEQ ID NO.1.
[0013] Preferably, the plant is stem mustard, Arabidopsis thaliana, rapeseed, or Chinese cabbage.
[0014] Preferably, salt-tolerant transgenic plants are obtained by introducing biological materials containing stem mustard miRNA or stem mustard miRNA precursor sequences into plant cells to increase the expression level of miRNA in plants.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] 1. This invention is the first to discover miR240 in *Mustela stenoptera*. After overexpressing the miR240 precursor sequence in plants, salt stress treatment experiments showed that transgenic seedlings exhibited significantly improved salt tolerance. This research demonstrates that miR240 is a positive regulator of salt tolerance, which is beneficial for maintaining crop yield under salt stress conditions and can reduce losses to economic crops caused by salt stress, thus possessing significant economic value.
[0017] 2. This invention provides new gene resources for improving plant stress resistance through molecular means, provides a key gene for improving abiotic stress in plants, and provides strong technical support for new varieties of stem mustard or other new plant materials. It has important theoretical and applied value for achieving high-quality and high-yield breeding in agricultural production. Attached Figure Description
[0018] Figure 1 A schematic diagram of the secondary structure folding of the miR240 precursor sequence.
[0019] Figure 2 This study presents a semi-quantitative PCR analysis of the miR240 precursor sequence in transgenic plants; WT represents wild-type stem mustard plants, and #3 and #4 represent transgenic stem mustard plants.
[0020] Figure 3 The image shows the phenotypic distribution of transgenic lines under salt stress; WT represents wild-type stem mustard lines, and #3 and #4 represent transgenic stem mustard lines. Detailed Implementation
[0021] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings, but the scope of protection of the present invention is not limited to the content described herein. Unless otherwise specified, the raw materials mentioned in the embodiments are all commercially available products. The experimental methods described in the embodiments are not specifically described, and are performed according to conventional molecular biology experimental methods.
[0022] In the early stages, the research group screened a novel miRNA in stem mustard through comparative transcriptome sequencing analysis and named it miR240.
[0023] Example 1 miR240 sequence analysis
[0024] The mature sequence of miR240 of the stem mustard plant of the present invention is 21 bp in length, as shown in SEQ ID NO.1; its precursor sequence is 181 bp in length, as shown in SEQ ID NO.2.
[0025] The secondary structure of the stem mustard miR240 precursor sequence was folded using the online RNAfold software (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), and secondary structure parameters were used to determine whether they possessed typical stem-loop structure characteristics of miRNAs (miRNA and its complementary strand located on opposite arms, less than four base mismatches between the miRNA and its complementary strand, and a folding free energy less than -18 kcal / mol). The study found that... Figure 1 As shown, the miR240 precursor sequence has a typical secondary stem-loop fold structure (the mature miR240 sequence is shown in the box).
[0026] Example 2: Construction and transformation of recombinant expression vector pTF101-miR240-GFP
[0027] (1) Constructing the pTF101-miR240-GFP expression vector
[0028] The miR240 precursor sequence (SEQ ID NO.2) of *Strombyx mori* was extended upward by 200 bp at both ends to obtain SEQ ID NO.3. Based on SEQ ID NO.3, specific PCR primers miR240-F (forward primer) and miR240-R (reverse primer) were designed to amplify the miR240 precursor sequence.
[0029] The primer sequences are as follows:
[0030] miR240-F: CCCGGGCCTCCGGAAAACCTTTTCACCATCT
[0031] miR240-R: GGATCCGTCCATCATATGATTAAATGATAAT
[0032] In this context, the underlined sequence in miR240-F represents the SmaI restriction site, while the underlined sequence in miR240-R represents the BamHI restriction site.
[0033] PCR reaction system: 0.5 μL of high-fidelity amplification enzyme PrimeSTAR HS (R010A, TaKaRa), 5x PrimeSTAR Buffer (Mg... 2+ Plus) 10 μL, forward primer (10 μM) 1 μL, reverse primer (10 μM) 1 μL, template (50-fold diluted plasmid) 1 μL, dNTP (2.5 mM) 4 μL, sterile ddH2O to make up to 50 μL.
[0034] PCR reaction conditions: pre-denaturation 95℃, 5 min; 95℃, 30 s; 58℃, 30 s; 72℃, 40 s, 35 cycles; 72℃, 10 min.
[0035] The PCR amplification products were detected by agarose gel electrophoresis. The amplified target fragment was the same size as the expected fragment, and was recovered and purified according to the instructions of the gel extraction kit (9672, Takara) to obtain the target gene fragment.
[0036] The pTF101-GFP expression vector was treated with double digestion of SmaI and BamHI. The digestion system was as follows: 5 μL pTF101-GFP vector; 0.5 μL SmaI; 0.5 μL BamHI; 2 μL Buffer 10XK; and sterile ddH2O to a final volume of 20 μL; incubation was carried out at 37°C for 3 h. After digestion, the pTF101-GFP vector fragment was recovered using a Takara agarose gel extraction kit.
[0037] The pTF101-miR240-GFP expression vector was constructed using T4 DNA Ligase (FL101, Trans).
[0038] The connection reaction system is as follows:
[0039] Purified PCR fragment (recovered miR240 target fragment) 50 ng; Linearized vector (pTF101-GFP vector) 100 ng; 5x T4 DNA Ligase Buffer 2 μL; T4 DNA Ligase 0.5 μL; Sterile ddH2O to a final volume of 10 μL. Incubate at 25°C for 30 min. Following molecular cloning guidelines, the above recombinant reaction system was transformed into *E. coli* DH5α and plated on a selection plate containing spectinomycin resistance (75 mg / L). Positive clones were sequenced to obtain the correct recombinant expression vector pTF101-miR240-GFP containing the miR240 precursor sequence. In the recombinant expression vector, the reporter gene GFP is fused to the 5' end of the target gene miR240, located downstream of the constitutive promoter P35S, forming a fusion expression. The 3' end of miR240 is equipped with a NOS terminator, which effectively terminates the transcription of the fusion gene. The reporter gene GFP emits green fluorescence upon blue light excitation without the need for cofactors or substrates, and can be used as a reporter gene to detect the expression of target genes.
[0040] (2) Agrobacterium-mediated genetic transformation of stem mustard
[0041] The recombinant expression vector pTF101-miR240-GFP was transformed into Agrobacterium strain GV3101 using a conventional freeze-thaw method, and positive clones were screened by PCR. Then, Agrobacterium carrying the pTF101-miR240-GFP vector was introduced into *Agrobacterium tumefaciens* using hypocotyl stable genetic transformation. The expression levels of the miR240 gene in the phenotypically well-developed transgenic lines overexpressing miR240 (#3 and #4) and the wild type were identified by semi-quantitative RT-PCR. Total RNA was extracted from *Agrobacterium tumefaciens* leaves using Trizol reagent (Invitrogen™) according to the manufacturer's instructions. Residual DNA was removed using DNase I (Invitrogen™), and first-strand cDNA was synthesized using cDNA reverse transcription reagent (Takara) according to the manufacturer's instructions.
[0042] The primers for detecting the target gene are:
[0043] miR240-RT-F: CCTCCGGAAAACCTTTTCACCATCT
[0044] miR240-RT-R: GTCCATCATATGATTAAATGATAAT
[0045] The internal reference primer is:
[0046] RT-BjuACTIN3-F:GGCTACTCTTTCACCACGAC
[0047] RT-BjuACTIN3-R:GGATACCAGCATTCTCCATAC
[0048] The results are as follows Figure 2 As shown, the target gene miR240 was upregulated in both transgenic lines (#3 and #4), while miR240 expression was almost undetectable in wild-type plants (WT) (expression level was too low), indicating that miR240 has been introduced into the genome of *Strombyx mori* and successfully transcribed and expressed.
[0049] Example 3: Phenotypic observation and analysis of transgenic stem mustard
[0050] Wild-type WT seeds and the obtained transgenic lines #3 and #4 seeds were disinfected, sterilized, and vernalized before germination on water-soaked filter paper. Four days after germination, the seedlings were transferred to saturated pots containing a growing medium (vermiculite: nutrient soil = 3:1) and placed in a plant culture room with a photoperiod of 16h:8h day:night and a temperature of 22℃. One week later, both wild-type and transgenic seedlings were simultaneously watered with aqueous solutions containing 0 or 200 mM NaCl, and plant growth was observed until a difference in growth between the transgenic and wild-type plants became apparent. Each transgenic and wild-type plant was tested in triplicate, with 25 plants selected from each experimental group for stress treatment. The results are as follows: Figure 3 As shown.
[0051] The results showed that in the water-only control, there was no significant difference in growth between wild-type and transgenic seedlings; however, under 200 mM NaCl treatment, wild-type plants exhibited yellowing and leaf drop, stem yellowing, and even death; while transgenic plants retained their seed pods and stems. This indicates that overexpression of miR240 from *Strombax cuneata* helps improve the survival rate of plants under salt stress.
[0052] The specific sequences described in the above embodiments are as follows:
[0053] Sequence 1: SEQ ID NO.1 miR240 mature sequence, 21 bp in length
[0054] TTCGACTGCGGTCTAGTAGGC
[0055] Sequence 2: SEQ ID NO.2 miR240 precursor sequence, 181 bp in length
[0056] CGACTAGGCCGCAGTTGAAGCGTTACATCGCTCGGTCCTCTTCCGGGCCGAACCTCTTAATTTTTCACCCTTCATCTATAATATTGCCTTTAAGCGAAATTATAGATAAGAACGAAAAATTAAGAGGTTCAGATAGGGAGTGGACTGAGCGACGTGATGCTTCGACTGCGGTCTAGTAGGC
[0057] Sequence 3: Extended sequence of the miR240 precursor sequence of SEQ ID NO.3, 581 bp in length.
[0058] CCTCCGGAAAACCTTTTCACCATCTCGTCGTGAGACCAGAAGAAGAAGCTTAGTCACCAGATCAGACTCCTCTTGAGCCGAGCGAAGTCGGGAACCAAAACCCTAACCAGTATCACGAGCATGTCGACTTGGAAAGAGAGACGGGAGGCGGAGCAAAGGGAAGACAAGTAAGGAGGAGAAATGTAATATCCCGATCCCACCGACTAGGCCGCAGTTGAAGCGTTACATCGCTCGGTCCTCTTCCGGGCCGAACCTCTTAATTTTTCACCCTTCATCTATAATATTGCCTTTAAGCGAAATTATAGATAAGAACGAAAAATTAAGAGGTTCAGATAGGGAGTGGACTGAGCGACGTGATGCTTCGACTGCGGTCTAGTAGGCCGGATCATAGTGTTACAAAAAAGTTGCATCTGGTTTCGGTGTCAGTACTCACAGGCGCTAGGCGGACGTCGGAGCATATCTGCACAAGTGTTGCTTGAGAAGTTTAGGAGAAAGAGTGAGTTTTAGAATTGTAGCCACTCTGAATCAACCTGATACTAAAATTGTTGGTTGTTACATTATCATTTAATCATATGATGGAC
[0059] Sequence 4: SEQ ID NO.4 miR240-F nucleotide sequence, 31 bp in length
[0060] CCCGGGCCTCCGGAAAACCTTTTCACCATCT
[0061] Sequence 5: SEQ ID NO.5 miR240-R nucleotide sequence, 31 bp in length
[0062] GGATCCGTCCATCATATGATTAAATGATAAT
[0063] Sequence 6: SEQ ID NO.6 miR240-RT-F nucleotide sequence, 25 bp in length
[0064] CCTCCGGAAAACCTTTTCACCATCT
[0065] Sequence 7: SEQ ID NO.7 miR240-RT-R nucleotide sequence, 25 bp in length
[0066] GTCCATCATATGATTAAATGATAAT
[0067] Sequence 8: SEQ ID NO.8 RT-BjuACTIN3-F nucleotide sequence, 20 bp in length.
[0068] GGCTACTCTTTCACCACGAC
[0069] Sequence 9: SEQ ID NO.9 RT-BjuACTIN3-R nucleotide sequence, 21 bp in length.
[0070] GGATACCAGCATTCTCCATAC
[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. Application of overexpression of *Strombus haematocephala* miRNA in improving salt tolerance of *Strombus haematocephala*, wherein the mature sequence of the *Strombus haematocephala* miRNA is shown in SEQ ID NO.1, the precursor sequence of the *Strombus haematocephala* miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
2. Application of overexpression of stem mustard miRNA in the selection and breeding of salt-tolerant stem mustard, wherein the mature sequence of the stem mustard miRNA is shown in SEQ ID NO.1, the precursor sequence of the stem mustard miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
3. Application of overexpression of *Strombus styrax* miRNA in the improvement of germplasm resources to withstand salt stress in *Strombus styrax*, wherein the mature sequence of the *Strombus styrax* miRNA is shown in SEQ ID NO.1, the precursor sequence of the *Strombus styrax* miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
4. Application of biological materials overexpressing the precursor sequence of stem mustard miRNA in improving salt stress tolerance of stem mustard, wherein the mature sequence of the stem mustard miRNA is shown in SEQ ID NO.1, and the precursor sequence of the stem mustard miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
5. Application of biological materials overexpressing the precursor sequence of stem mustard miRNA in the selection and breeding of salt-tolerant stem mustard, wherein the mature sequence of the stem mustard miRNA is shown in SEQ ID NO.1, the precursor sequence of the stem mustard miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
6. Application of biological materials overexpressing the precursor sequence of *Strombus styrax* miRNA in the improvement of germplasm resources for salt stress tolerance in *Strombus styrax*, wherein the mature sequence of the *Strombus styrax* miRNA is shown in SEQ ID NO.1, and the precursor sequence of the *Strombus styrax* miRNA is shown in SEQ ID NO.2, and the name of the miRNA is miR240.
7. The application according to any one of claims 4 to 6, characterized in that, The biological material is an expression cassette, transposon, vector, or engineered bacteria.
8. A method for improving salt stress tolerance in stem mustard, characterized in that, The expression level of *Strombyx mori* miRNA was increased in the target plant, wherein the mature sequence of *Strombyx mori* miRNA is shown in SEQ ID NO.1 and the precursor sequence is shown in SEQ ID NO.
2.
9. The method according to claim 8, characterized in that, By introducing biological materials containing *Strombus haematocephala* miRNA or *Strombus haematocephala* miRNA precursor sequences into *Strombus haematocephala* cells, the expression level of miRNA in *Strombus haematocephala* is increased, thus obtaining salt-tolerant transgenic plants.
Citation Information
Patent Citations
Plant salt tolerance related miRNA (microribonucleic acid)(tsa-miRn280) and application thereof
CN103114090A
Application of BjuEAR1 gene of tumorous stem mustard in regulating stress resistance of plants
CN113025626A