Creation and application of intermuscular spineless germplasm for cultured economic fish

By using CRISPR/Cas9 gene editing technology to mutate the runx2b gene of the bighead carp, the problem of difficulty in breeding economic fish without intermuscular spines in existing technologies was solved, and the efficient creation of bighead carp without intermuscular spines was achieved, which has significant application value.

CN115720874BActive Publication Date: 2025-09-30HUBEI HUAHAI TECHNOLOGY CO LTD

Patent Information

Application Number
CN202211292370.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-20
Publication Date
2025-09-30
Estimated Expiration
2042-10-20

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently breed new economic fish varieties without intermuscular spines, especially in important farmed fish such as the bighead carp. The gene editing method is not effective or is not conducive to consumption and processing.

Method used

The runx2b gene of Megalobrama amblycephala was mutated using CRISPR/Cas9 gene editing technology, and sgRNA and zCas9 mRNA were microinjected to prepare a new germplasm of Megalobrama amblycephala without intermuscular spines.

Benefits of technology

It has been achieved that a new breed of bighead carp without intermuscular spines is obtained simply and easily, which has scientific research and application value. The intermuscular spines of the mutated fish completely disappear, making it suitable for consumption and processing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115720874B_ABST
    Figure CN115720874B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of aquatic biological breeding, and specifically relates to a method and application of creating germplasm without intermuscular spines of economic fish for breeding. runx2b The economic fish, Megalobrama amblycephala, is gene-edited using a gene as the target gene. F0 generation fish with mutations are selected and cultured as parent fish. The F1 generation is produced by mating and breeding the F0 generation mutant male and female parents. F1 fish without intermuscular spines are screened and cultured to adult fish for use in cultivating a new germplasm of Megalobrama amblycephala without intermuscular spines. The present invention utilizes a gene mutation method to obtain a new germplasm of the economically cultivated fish, Megalobrama amblycephala, without intermuscular spines. This provides an improved method for solving the problem of the significant impact of intermuscular spines in the muscles of important aquacultured economic fish such as silver carp, bighead carp, carp, crucian carp, and bream in my country on their consumption and processing. It also provides a basis for subsequent research on the molecular formation mechanism of intermuscular spines, and has important scientific research value and industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of aquatic biological breeding, and specifically relates to a method for creating and applying intermuscular spine-free germplasm for economic fish farming. By performing gene mutation using the sequence provided by the present invention as the target sequence, new germplasm for economic fish farming without intermuscular spines can be obtained. Background Art

[0002] Intermuscular bones in fish are small, hard, bony spines formed by the ossification of tendons between the myofascial diaphragms (Patterson and Johnson, 1995; Nie et al., 2021). Most major farmed fish species in my country, such as black carp (Mylopharyngodon piceus), grass carp (Ctenopharyngodon idellus), silver carp (Hypoph thalmichthys molitrix), bighead carp (H. nobilis), and giant bream (Megalobranchus amblycephala), possess a certain number of these bones. These bones significantly hinder the consumption of fresh fish and the processing of surimi products, severely impacting the high-quality development of these fish species and aquaculture industries (Ma Liangxiao et al., 2012; Nie et al., 2020). Therefore, the development of boneless freshwater fish would significantly promote the development of my country's aquaculture seed industry.

[0003] Gene editing technology allows humans to "edit" target genes in species, achieving manipulations such as knockout and knock-in of specific DNA fragments (Wang Feng et al., 2018). Nie et al. (2021) used CRISPR / Cas9 gene editing to generate zebrafish with a scxa gene mutation. Compared to wild-type zebrafish, these mutants lack intermuscular spines on their backs and only have a small number of intermuscular spines in their tails, with the total number reduced by approximately 70% compared to wild-type zebrafish. Xu et al. (2022) used gene editing to generate a zebrafish strain with a bmp6 mutation that completely lacks intermuscular spines. Their patent, "Method for Breeding a New Fish Variety with Normal Development and No Intermuscular Spines," was granted a national invention patent (Patent No.: ZL202011352379.4). Nie et al. (2022) generated a zebrafish strain with a runx2b gene mutation. These mutants completely lack intermuscular spines and exhibit no significant differences in growth, swimming ability, or muscle amino acid and fatty acid content compared to wild-type zebrafish. These studies, which have achieved significant improvements in intermuscular spines, have been limited to the model fish zebrafish. Furthermore, the effectiveness of gene editing is closely related to the location of the mutation. Different mutation locations or sequence changes can result in significantly different phenotypes (Xu et al., 2022), or even no phenotype at all.

[0004] In terms of improving the intermuscular spines of important aquaculture economic fish, researchers have conducted some research using methods such as selective breeding, hybrid breeding, polyploidy and gynogenetic breeding (Wang Xudong et al., 2021), but the results are not very significant. In terms of gene editing breeding, Zhong et al. (2016) used CRISPR / Cas9 gene editing technology to knock out the sp7a gene in carp. The results showed that sp7a - / - Mutants exhibit a significant shortening of their intermuscular spines. Bao Baolong et al. (invention patent application numbers: CN202010451893.7, CN202010451894.1, CN202010451275.2, CN202010451274.8) used gene editing to knock out the mstn gene in fish such as Erythroculter bream, Megalobrama amblycephala, and Grass carp. They established a molecular breeding method to thicken the intermuscular spines in these fish. However, these thickened intermuscular spines remain in the fish muscle, making them unsuitable for consumption and processing. Currently, there are no official reports on methods for genetically modifying commercial fish to create completely intermuscular spineless varieties. Summary of the Invention

[0005] The purpose of the present invention is to construct a method for creating a new germplasm of cultured economic fish without intermuscular spines. The method comprises mutating the runx2b gene of the cultured economic fish.

[0006] Another purpose of the present invention is to apply the method for creating new germplasm of economic fish without intermuscular spines, and to utilize the method to breed economic fish without intermuscular spines.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] A method for creating new germplasm without intermuscular spines of cultured economic fish comprises mutating the runx2b gene of the cultured economic fish.

[0009] In the above method, preferably, the economic fish species cultured is Megalobrama amblycephala;

[0010] In the above-mentioned method, preferably, the mutation method is CRISPR / Cas9;

[0011] In the method described above, preferably, the target gene of CRISPR / Cas9 is SEQ ID NO.1 or SEQ ID NO.2 or SEQ ID NO.3.

[0012] In the above-mentioned method, preferably, the mutated Megalobrama bream without intermuscular spinies has the gene shown by SEQ ID NO.4 or SEQ ID NO.5 or SEQ ID NO.6.

[0013] The protection content of the present invention also includes: application of the above method in the breeding of economic fish without intermuscular spines.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] The method of the present invention can be used to obtain new germplasm of Megalobrama amblycephala without intermuscular spines. The method is simple and easy to implement. The use of gene mutation to obtain a strain of Megalobrama amblycephala without intermuscular spines has fundamental scientific research value and widespread application value for studying the function of intermuscular spines. This method can become a highly efficient technical means for obtaining new germplasm of economically aquacultured fish without intermuscular spines. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the sequence of the target site and mutation site of the runx2b gene of the amblycephalic bream;

[0017] Yellow indicates the runx2b gene target site, green indicates the PAM sequence, and the red arrow indicates the runx2b gene tar get mutation site.

[0018] Figure 2 Schematic diagram of the whole-body skeleton of wild-type amblycephalic bream (45 days after hatching) stained with alizarin red, with arrows indicating intermuscular spines.

[0019] Figure 3Schematic diagram of X-ray imaging of wild-type amblycephalic bream (135 days after hatching), with arrows indicating intermuscular spines.

[0020] Figure 4 Schematic diagram of whole-body alizarin red skeleton staining of mutant amblycephala (45 days after hatching).

[0021] Figure 5 Schematic diagram of X-ray imaging of mutant amblycephala (135 days after hatching). DETAILED DESCRIPTION

[0022] The technical solutions of the present invention, unless otherwise specified, are conventional methods in the art; the reagents or materials used are

[0023] Unless otherwise specified, all sources are commercially available. This example uses CRISPR / Cas9 to mutate the runx2b gene of Megalobrama amblycephala to produce a species without intermuscular spines. Other farmed economic fish species, or other gene editing methods in the art, can also successfully produce new germplasm of farmed economic fish without intermuscular spines, as long as the mutation is directed against the corresponding runx2b gene.

[0024] Example 1:

[0025] A method for creating a new germplasm without intermuscular spines for cultured economic fish comprises the following steps:

[0026] 1.1 Experimental Materials

[0027] Taking the commercial fish Megalobrama amblycephala as an example, wild-type Megalobrama amblycephala is reared at the Bairong Aquatic Breeding Base in Huanggang City, Hubei Province. The embryos used for microinjection in Megalobrama amblycephala are obtained from artificially spawning sexually mature male and female parents.

[0028] 1.2 Experimental methods

[0029] 1.2.1 Determine sgRNA target site

[0030] Three runx2b sgRNA target sites were selected:

[0031] runx2b-1target:5'GGGCTCCTACCAGTTCTCCA3',

[0032] runx2b-2target:5'GGGCTCAATCTTCCCCACCT'3,

[0033] runx2b-3target:5'GGCCGACCACCCCGCCGAAC'3

[0034] 1.2.2 In vitro synthesis of sgRNA

[0035] sgRNA was expressed using a conservative downstream primer Scaffold (GATCCGCACCGACTCGGTGCCACTTTTTC AAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) and an upstream primer containing the target sequence with a T7 promoter. Overlap PCR amplification was performed. The PCR system was as follows: Primer star Mix 10.5 μL, Scaffold 5 μL, sgRNA 5 μL, ddH2O 4.5 μL. PCR reaction conditions were 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 60°C annealing for 10 s, and 72°C extension for 15 s, for 45 cycles, followed by an additional extension at 72°C for 5 min. 5 μL of PCR product was subjected to 2% agarose gel electrophoresis. After band size verification, the PCR product was purified and recovered, and its concentration was measured using a Nanodro p 2000 (Thermo Scientific, USA). RNA was in vitro transcribed according to the Transcriptaid T7 high-yield transcription kit (Thermo Scientific, USA), and the sgRNA was purified and recovered using lithium chloride precipitation. 1 μL of RNA was removed for RNA concentration, and its quality was checked by 1.5% agarose gel electrophoresis. The RNA was then stored at -80°C until use, thus providing the sgRNA.

[0036] 1.2.3 In vitro transcription of zCas9 mRNA

[0037] The pT3TS-nCas9n plasmid was linearized using the XbaI restriction endonuclease (NEB, USA). Complete linearization was confirmed by 1% agarose gel electrophoresis and recovered using a Gel Extraction Kit (Omega, USA). zCas9 mRNA was in vitro transcribed according to the T3mMESSAGE mMACHINE (Invitrogen, USA) instructions, purified and recovered using lithium chloride precipitation, dissolved in enzyme-free water, and measured using a Nanodrop 2000 (Thermo Scientific, USA). The transcribed mRNA quality was checked by 1.5% agarose gel electrophoresis and stored in a separate device at -80°C until use.

[0038] 1.2.4 Microinjection

[0039] The night before injection, male and female amblycephalic bream (Gibberish) were separated in a 3:1 or 5:2 ratio in separate cement tanks or culture tanks. In the evening, the female parent received a first injection of luteinizing hormone-releasing hormone A2 (1 μg / kg) for 12 hours (this injection period could be shortened or extended depending on water temperature). Male parents were then given a second injection of the oxytocin (half the dose given to the female parent). The effect of the oxytocin injection typically lasted for 6 hours (this duration was closely related to water temperature and could be extended accordingly). The eggs of the Gibberish bream were then manually removed and placed in a dry centrifuge tube, while the sperm of the male fish was manually removed and placed in a centrifuge tube containing 10 mL of Hank's solution for in vitro fertilization. Microinjection began 10 minutes after artificial insemination. An injection system was prepared using a mixture of three sgRNAs and zCas9 mRNA, with a final concentration of 100-200 ng / μL for sgRNA and 500-1000 ng / μL for zCas9 mRNA. Phenol red was added at a final concentration of 0.2% as an indicator. The experimental samples were injected into one-cell-stage Megalobrama amblycephala embryos using a Picoliter Microinjector (Warner, PL-100A, USA). After injection, the embryos were cultured in methylene blue medium and placed in water at 20-25°C, with the water for the embryos being changed promptly.

[0040] 1.2.5 Detection of target mutation rate

[0041] Thirty embryos 48 hours after injection were selected and genomic DNA was rapidly extracted from the embryos using the lysis method. The embryos to be lysed were placed in a 96-well 200 μL plate and 50 μL Lysis buffer (10 mmol / L Tris + 50 mmol / L KCl + 1.5 mmol / L MgCl2 + 0.3% Tween-20 + 0.3% Nonident P-40) was added. PCR was performed at 94°C for 20 minutes and then at 55°C for termination. The cells were then placed on ice and vortexed with 5 μL of PK enzyme (10 mg / ml). PCR was then performed at 55°C for 60 minutes, followed by 20 minutes at 94°C and then at 16°C for termination.

[0042] The target gene sequence near the target site was amplified using target amplification detection primers (runx2b-1F: 5'TGTCGGTGAAGATGAATGA / R: 5'CTCCAATGAGAAGGCAAAA; runx2b-2F: 5'TTTACCTGCGAGTGTTGC / R: 5'AGAGCGGAGTGG TGGAGT; runx2b-3F: 5'AGCGGACCCTTCCAGAGCA / R: 5'CGGGAGGTTCGGATT GA).

[0043] The PCR reaction system is: PCR Master Mix (Yisheng, Shanghai) 10 μL, upstream and downstream primers 0.5 μL each, genomic DNA template 2 μL, sterile water 7 μL.

[0044] PCR reaction conditions were: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30 seconds, 54°C annealing for 30 seconds, 72°C extension for 30 seconds, 35 cycles, and 72°C extension for 5 minutes. Ten μL of PCR product was subjected to 3% agarose gel electrophoresis. Individual F0 fish that showed double bands near the PCR product and double peaks at the sequencing target site were selected and cultured to adulthood.

[0045] 1.2.6 Obtaining F1 Megalobrama amblycephala without intermuscular spines

[0046] Mutant F0-generation female and male individuals of the bream were crossed to produce the F1 generation. F1 embryonic DNA was extracted as described above. PCR products were amplified using target detection primers. F1 heterozygous mutants were screened by 3% agarose gel electrophoresis and sequencing (Qingke Biotechnology Co., Ltd., Wuhan). Sequences of each individual were analyzed and compared with wild-type, normal gene sequences to identify the target mutation in the mutant.

[0047] 1.2.7 Genotypic and phenotypic analysis of new germplasm of Megalobrama amblycephala without intermuscular spines

[0048] The target site gene sequence comparison results of wild-type amblycephalic bream and ablycephalic bream mutant are shown in Figure 2. Figure 1 As shown: the wild-type target site sequence shown in SEQ ID NO.1 mutates into the sequence shown in SEQ ID NO.4; the wild-type target site sequence shown in SEQ ID NO.2 mutates into the sequence shown in SEQ ID NO.5; the wild-type target site sequence shown in SEQ ID NO.1 mutates into the sequence shown in SEQ ID NO.6.

[0049] In order to observe the intermuscular spine phenotype of the F1 generation mutant of the amblycephalic bream, the intermuscular spine phenotype of the amblycephalic bream was observed by whole-body bone staining with alizarin red. Figure 2 As shown, the number of intermuscular spines is significant; the overall intermuscular spine phenotype of runx2b mutant bream (bream with mutant genotypes shown in SEQ ID NO.4 to SEQ ID NO.6, respectively) is as follows Figure 4 As shown, the intermuscular spines of mutants with three genotypes have all disappeared.

[0050] The alizarin red whole bone staining method is as follows: 45dph amblycephalus is fixed in 4% paraformaldehyde for 48 hours, rinsed in ddH2O water overnight; then bleached in a mixed solution of equal volumes of 3% H2O2 and 1% KOH for 4 hours; rinsed in ddH2O for 30 minutes; treated in a 30% saturated borax solution for 12 hours; rinsed in ddH2O for 30 minutes; stained in a mixed solution of 1% Alizarin Red S (Sigma) and 1% KOH for 12 hours; excess Alizarin Red dye was washed in 1% KOH solution; rinsed in a mixed solution of 1% trypsin (Solarbio) and 2% saturated borax for 3-5 days to remove impurities; gradient transparentized in 50% and 100% glycerol, and stored.

[0051] In order to obtain and preserve the parent of Megalobrama amblycephala without intermuscular spines, the F1 generation of juvenile fish were cultured to about four months old (body length 10-15 cm), and the intermuscular spines of Megalobrama amblycephala were scanned using a portable X-ray imager (Version 90, Aolong, China). Figure 3 As shown, there are mutants of Megalobrama amblycephala without intermuscular spines, such as Figure 5 As shown, the bighead carp without intermuscular spines and with normal activities were selected and continued to be cultivated until sexual maturity to reproduce the next generation.

Claims

1. A method for creating a new germplasm without intermuscular spines of a cyprinid economic fish, the method comprising mutating the runx2b gene of the cyprinid economic fish.

2. The method according to claim 1, wherein the economic fish species of the Cyprinidae family is Megalobrama amblycephala.

3. The method according to claim 2, wherein the mutation method is CRISPR / Cas9.

4. The method according to claim 3, wherein the target gene of CRISPR / Cas9 is SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.

3.

5. The method according to claim 3, wherein the target genes of CRISPR / Cas9 are SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

Citation Information

Patent Citations

  • Breeding methods for new varieties of normally developed fish without intermuscular bones

    CN112772468B

  • Application of one segment of separated nucleotide sequence in construction of mineralized intermuscular bone-free danio rerio

    CN112226465A

Cited By

  • Application of crucian carp wisp1 gene in regulation and control of development of fish intermuscular spines

    CN120905318A

  • Application of the crucian carp wisp1 gene in regulating intermuscular spine development in fish

    CN120905318B