A site for integrating exogenous genes into Eimeria tenella and its application
By constructing a site-specific integration vector at the HG994969.1:2704213-270525 site in the Eimeria tenella genome and using CRISPR/Cas9 technology to achieve precise insertion and stable expression of exogenous genes, the problems of strong random insertion and unstable expression of exogenous genes in existing technologies were solved, and the reproductive capacity and screening efficiency of transgenic coccidia were improved.
Patent Information
- Application Number
- CN202211485870.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-24
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2042-11-24
AI Technical Summary
In the existing technology, the insertion of exogenous genes into Eimeria tenella is highly random, resulting in large differences in expression levels, high difficulty in detection, and easy loss during the passage process, making it difficult to achieve stable expression.
CRISPR/Cas9 technology was combined with the genomic safe harbor HG994969.1:2704213-270525 site to construct a site-specific integration vector to achieve precise insertion and stable expression of exogenous genes. The exogenous gene homology arms and promoter sequences contained in the vector were used to ensure the continued presence of the exogenous gene through flow cytometry screening and drug screening.
The stable insertion and expression of exogenous genes in the coccidia genome were achieved, the fertility and expression consistency of transgenic coccidia were improved, the risk of exogenous gene loss was reduced, and the screening efficiency of transgenic coccidia was improved.
Smart Images

Figure BDA0003962256480000081 
Figure BDA0003962256480000101 
Figure HDA0003962256490000011
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, in particular to an Eimeria tenella site-specific integration exogenous gene site and application thereof. Background Art
[0002] Coccidia are eukaryotic, single-celled parasitic protozoa of the genus Eimeria, phylum Apicomplexa. They reproduce in various parts of the chicken intestine, destroying intestinal epithelial cells and causing digestive and absorptive dysfunction. This leads to reduced feed conversion rates, slowed growth, and, in severe cases, large-scale mortality in chicks. Currently, they remain a major pathogen hindering the intensive development of the domestic poultry industry. There are currently seven recognized species of chicken coccidia, of which Eimeria tenella is the most pathogenic and the most extensively studied transgenic coccidia.
[0003] Transgenic technology is a powerful tool for Eimeria coccidia research, playing a crucial role in the development of live vaccine vectors, regulation of coccidia gene expression, functional genes, and research into drug resistance and novel drug target genes. Currently, transgenic chicken coccidia are primarily engineered using the restriction enzyme-mediated integration (REMI) method, which integrates exogenous vector gene fragments into the coccidia genome. This REMI method can increase the transfection efficiency of Eimeria tenella by over 100-fold. Subsequently, the use of drug selection genes and flow cytometry (FACS) screening can rapidly increase the proportion of transgenic coccidia.
[0004] However, the REMI method causes random integration of exogenous genes into the coccidian genome, leading to significant variability in expression levels among individual transgenic coccidian individuals and cumbersome detection of integration sites and exogenous gene copy numbers. Furthermore, transgenic coccidian cultures have been found to experience partial or even complete loss of exogenous genes after multiple subcultures. In recent years, CRISPR / Cas9 gene editing technology, with its advantages of ease of use and low vector construction costs, has rapidly become a mainstream genome editing technology and has become an essential tool in modern life science experiments.
[0005] The successful application of the CRISPR / Cas9 system in Eimeria tenella has provided a new option for coccidia gene editing. Given its ability to precisely cut the genome, CRISPR / Cas9 has become the preferred method for inserting exogenous genes into the Eimeria tenella genome.
[0006] Coccidia have a complex life cycle, encompassing three reproductive stages: schizogony, gametogony, and sporogenesis. Furthermore, as eukaryotic organisms, coccidia possess genomic repair mechanisms, which allow for the potential for repair even after targeted insertion of exogenous genes, leading to the loss of inserted gene fragments. Therefore, to achieve stable presence and sustained expression of exogenous genes within coccidia, it is necessary to identify genomic safe harbors (GSHs) within the coccidia genome as integration sites for exogenous genes. Locating safe and effective gene insertion sites within the coccidia genome will not only promote further research on coccidia as live vaccine vectors, but will also contribute to the development of functional genomics in coccidia. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to locate a safe and effective foreign gene insertion site in the genome of Eimeria tenella, provide a site-directed integration plasmid vector and its application in integrating foreign genes into the site.
[0008] In order to solve the above technical problems, the present invention provides the following technical solutions.
[0009] In a first aspect, the present invention provides the use of the Eimeria tenella genomic site HG994969.1:2704213-270525 in the preparation of transgenic coccidia, wherein the Eimeria tenella genomic site HG994969.1:2704213-270525 serves as an exogenous gene integration site. Specifically, the Eimeria tenella genomic site HG994969.1:2704213-270525 serves as a genomic safe harbor for exogenous gene integration.
[0010] The present invention resequencing and analyzing the existing transgenic Eimeria tenella genome in the laboratory, and using chimera reads found that when the exogenous gene is integrated into HG994969.1:2704213-2705255, the exogenous gene can exist stably without affecting the expression of the endogenous gene of the coccidia.
[0011] Then, a site-directed insertion vector was constructed based on the integration site HG994969.1:2704213-2705255, and a site-directed integration transgenic Eimeria strain was constructed using CRISPR / Cas9 technology. It was verified that the transgenic strain constructed based on the site HG994969.1:2704213-2705255 was indeed site-directed integration and the exogenous gene was a single copy. During the subculture process, the proportion of transgenic insects in the strain increased significantly, and no phenomenon of a decrease in the proportion of transgenic insects was found using conventional methods (restriction endonuclease-mediated).
[0012] Using the integration site provided by the present invention as a foreign gene insertion site, the resulting transgenic worms have improved fertility compared to the parent strain. Therefore, this foreign gene integration site can be used as a specific integration site for subsequent transgenic Eimeria tenella.
[0013] In a second aspect, the present invention provides a vector for site-specific integration of exogenous genes, wherein the sequence on the left side of the homologous arm of the exogenous gene contains the sequence of the Eimeria tenella genomic site HG994969.1: 2703603-2704213; the sequence on the right side of the homologous arm of the exogenous gene contains the sequence of the Eimeria tenella genomic site HG994969.1: 2705255-2705961.
[0014] The vector for site-directed integration of foreign genes provided by the present invention comprises: a left sequence of a foreign gene homology arm, a MIC2 promoter, a polyA tail of an Actin gene and a right sequence of a foreign gene homology arm; the foreign gene is located after the promoter.
[0015] In the vector for site-directed integration of exogenous genes provided by the present invention, the sequence on the left side of the homology arm of the exogenous gene is amplified from SEQ ID NOs. 11-12; the sequence on the right side of the homology arm of the exogenous gene is amplified from SEQ ID NOs. 13-14;
[0016] Preferably, in the vector for site-directed integration of exogenous genes provided by the present invention, the sequence on the left side of the homology arm of the exogenous gene is as shown in SEQ ID NO.7; the sequence on the right side of the homology arm of the exogenous gene is as shown in SEQ ID NO.8.
[0017] The backbone of the vector for site-directed integration of exogenous genes provided by the present invention is a Peasy Blunt vector containing gRNA, and the nucleotide sequence of the gRNA is shown in SEQ ID NO.10.
[0018] More specifically, as a specific embodiment of the present invention, the nucleotide sequence of the vector for site-directed integration of exogenous genes provided by the present invention is shown in SEQ ID NO.9.
[0019] In the vector shown in SEQ ID NO. 9 of the present invention, the exogenous genes are a red fluorescent protein encoding gene (mCherry) and a Toxoplasma gondii dihydrofolate reductase (DHFR), a pyrimethamine resistance gene. Positions 243-853 are the left sequence of the homology arm; positions 854-1734 are the Eimeria tenella MIC2 promoter sequence; positions 1735-3566 are the Toxoplasma gondii dihydrofolate reductase sequence; positions 3567-4271 are the mCherry sequence; positions 4275-4887 are the Eimeria tenella Actin sequence; positions 4888-5594 are the right sequence of the homology arm; positions 5595-6192 are the Eimeria tenella U6 promoter sequence; positions 6193-6212 are the gRNA sequence; and positions 6213-6287 are the scaffold sequence.
[0020] In a third aspect, the present invention provides a CRISPR / Cas9 targeting system, wherein the gRNA sequence used in the CRISPR / Cas9 targeting system is TTGCAATTGGAGCTGCGTA GTGG.
[0021] In a fourth aspect, the present invention provides the use of the above-mentioned vector or the above-mentioned CRISPR / Cas9 targeting system in improving the efficiency of preparing transgenic coccidia.
[0022] In a fifth aspect, the present invention provides a method for integrating an exogenous gene into the genome of a coccidia.
[0023] Using CRISPR / Cas9 technology, the exogenous gene was inserted into the coccidia genome site HG994969.1:2704213-270525.
[0024] More specifically, the method provided by the present invention for integrating an exogenous gene into the coccidian genome comprises: introducing the exogenous gene into the above-mentioned vector, linearizing the vector and evenly mixing it with a circular plasmid containing spCas9 to construct a site-directed integration vector; transfecting the constructed site-directed integration vector into Eimeria tenella sporozoites, and screening to obtain a positive population.
[0025] The beneficial effects of the present invention are:
[0026] (1) The present invention provides a site for the site-specific integration of exogenous genes in Eimeria tenella. After the exogenous gene is inserted into the site, it can continue to exist and express, which is beneficial to the subsequent screening and identification of transgenic coccidia. The reproductive capacity of transgenic Eimeria tenella with the exogenous gene inserted into the site is also improved to a certain extent. The exogenous gene integration site can serve as an ideal integration site for subsequent transgenic Eimeria tenella.
[0027] (2) The vector provided by the present invention includes: a homologous left arm of the site-specific integration site, an exogenous gene and a homologous right arm of the site-specific integration site. The vector is designed based on the CRISPR / Cas9 targeting system, which can accurately introduce the exogenous gene into HG994969.1:2704213-2705255 of the Eimeria tenella genome to solve the problems of low efficiency of traditional coccidian transgenic technology, random integration of exogenous genes, large differences in expression levels among different individuals, difficulty in detecting the integration position, and exogenous gene deletion. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0029] Figure 1 This is the insertion site sequence information obtained after aligning the genome resequencing data. Capital letters represent vector sequences (green area) and lowercase letters represent genome sequences (gray area). The upper figure shows the 3' insertion site analysis, and the lower figure shows the 5' insertion site analysis.
[0030] Figure 2 This is the electrophoresis diagram for identification of the insertion site of transgenic Eimeria tenella.
[0031] Figure 3 This is the mass spectrum of the Eimeria tenella site-directed integration vector containing two homology arms.
[0032] Figure 4 Schematic diagram of the principle of site-directed integration of Eimeria tenella.
[0033] Figure 5 This is the electrophoresis diagram for identification of the insertion site of transgenic coccidia with site-directed integration.
[0034] Figure 6 This is a comparison chart of the oocyst excretion of site-specifically integrated transgenic coccidia and the maternal strain. DETAILED DESCRIPTION
[0035] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0036] The present invention provides a plasmid vector for site-directed integration of Eimeria tenella and its use in targeted site-directed integration of exogenous genes. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0037] The pEASY-Blunt Simple Cloning Vector, Trans5α competent cells, and pEASY-UniSeamless Cloning and Assembly Kit used in the following examples were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; DNA molecular markers were purchased from Beijing Adlai Biotechnology Co., Ltd., and Q5 ultra-fidelity DNA polymerase was purchased from New England Biolabs. TAE buffer was prepared according to a conventional recipe. Instruments used in the following examples included a PCR instrument, a 37°C constant temperature shaker, a 37°C incubator, a gel imager, and a gel electrophoresis apparatus.
[0038] Example 1 Analysis and Identification of Eimeria tenella High-Efficiency Insertion Sites
[0039] The laboratory maintains transgenic strains of Eimeria tenella. These strains were constructed using restriction endonuclease-mediated integration and were obtained by propagation of single-sporangial progeny, making them considered monoclonal strains. Research has revealed that one transgenic strain exhibits improved fecundity compared to the parent strain, and the proportion of transgenic strains has remained high after multiple subcultures. Therefore, the integration site of the exogenous gene in this transgenic coccidia can be considered a candidate GHS site.
[0040] The integration site information of the transgenic insect strain was analyzed by whole genome resequencing technology. A sequencing depth of 100× was used to minimize the random errors caused by random primer amplification. Fastp was used to perform strict data quality control on the raw data to remove low-quality reads and ensure the accuracy of subsequent analysis. The data that passed the quality control filter was compared with the vector sequence. Statistics showed that the average coverage of the vector-specific sequence was about 1 / 2 of the average coverage of the vector and host homologous regions, which means that the number of inserted T-DNA copies is 1, so there is only one T-DNA insertion site. The aligned bam file was then aligned with the vector sequence to screen for chimera reads that were not completely aligned with the vector sequence. The results are as follows Figure 1The sequence of the chimeric part was then aligned with the Eimeria tenella genome sequence, and it was finally found that the T-DNA may have been inserted into the genome at HG994969.1:2704213-270525.
[0041] After obtaining the exogenous gene integration site through resequencing data analysis, PCR identification primers SEQ ID NO.1-2 and SEQ ID NO.3-4 were designed to further verify the resequencing analysis results. The electrophoresis detection results of the PCR amplified fragments are as follows Figure 2 As shown, the T-DNA integration site was finally confirmed. This site is located in the intergenic region between two genes, which means that the insertion of the foreign gene did not destroy the original gene, and therefore this site has the potential to serve as a genomic safe haven.
[0042] Example 2 Construction and Identification of Transgenic Coccidia with Localized Integration of Exogenous Genes in Eimeria tenella
[0043] To further verify the feasibility of this site as a subsequent Eimeria tenella GSH (genomic safe harbor), a site-specific integration vector for Eimeria tenella was designed and constructed, such as Figure 3 The specific steps are as follows:
[0044] 1. Design gRNA for site-directed integration
[0045] According to the genomic loci identified in Example 1, the spCas9 gRNA sequence was designed using the ToxoDB database (https: / / toxodb.org / toxo / app), with the base sequence SEQ ID NO.10 (TTGCAATTGGAGCTGCGTAGTGG). The gRNA and the sequences of the U6 Promoter and scaffold homology arms were synthesized at both ends. The U6 Promoter was then connected to the gRNA and scaffold in sequence by Overlap PCR. The PCR reaction system was as follows: 1 μL each of the upstream and downstream primers, 1 μL of the gRNA template, 1 μL of the scaffold template, 1 μL of the U6 Promoter template, 0.5 μL of Q5 ultra-fidelity DNA amplification enzyme, 10 μL of 5× reaction buffer, 1 μL of dNTPs, and 50 μL was made up with ddH2O.
[0046] PCR reaction program: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 15 s; annealing at 65°C for 20 s; extension at 72°C for 30 s; 35 cycles; final extension at 72°C for 10 min.
[0047] PCR product gel electrophoresis: Prepare a 1% gel block, run at 120V for 15 minutes, and image the gel. After excising the band, recover the fragment and ligate it into the pEASY-Blunt Simple Cloning Vector. Transform the fragment into competent Trans5α cells, plate the fragment onto a culture plate containing 20μg / ml ampicillin, and incubate overnight at 37°C. Single clones were identified by PCR, and positive clones were selected and sequenced by Beijing Ruibo Xingke Biotechnology Co., Ltd.
[0048] 2. Amplification of homology arms of site-directed integration vectors
[0049] HG994969.1:2703603-2704213 was selected as the left homology arm; HG994969.1:2705255-2705961 was selected as the right homology arm, and PCR primers were used for amplification from the genome. The primer sequences are shown in Table 1.
[0050] Table 1 Primer sequences for PCR amplification of the left homology arm and the right homology arm
[0051]
[0052] Q5 super-fidelity enzyme was used to amplify the homology arm fragments on both sides. The PCR reaction system was as follows: 1 μL of upstream and downstream primers, 1 μL of DNA template, 0.5 μL of Q5 enzyme, 1 μL of dNTP, 5.5 μL of ddH2O3, and 10 μL of 5× reaction buffer, with a total volume of 50 μL.
[0053] PCR reaction program: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 15 s; annealing at 65°C for 20 s; extension at 72°C for 30 s; 35 cycles; final extension at 72°C for 10 min.
[0054] After gel electrophoresis detection of the PCR products, ligation and transformation were performed, and positive clones were selected and sequenced by Beijing Ruibo Xingke Biotechnology Co., Ltd.
[0055] 3. Amplification of exogenous genes in site-directed integration vectors
[0056] The Et.MIC2 promoter plasmid, Tg.DHFR-Ts pyrimethamine drug screening gene plasmid, mCherry red fluorescent protein plasmid and Et.Actin polyA plasmid stored in the laboratory were used as templates and Q5 super-fidelity enzyme was used to amplify each fragment.
[0057] The reaction system and reaction procedure were the same as in step 1. The PCR products were detected by gel electrophoresis and then ligated and transformed. Positive clones were selected and sequenced by Beijing Ruibo Xingke Biotechnology Co., Ltd.
[0058] 4. Construction of site-specific integration vector and sequencing
[0059] After sequencing confirmed the sequences of each fragment, reverse PCR primers were designed to linearize the plasmid connecting U6, gRNA, and scaffold. The reaction system and reaction procedure were the same as in step 1. The PCR product was detected by gel electrophoresis and then recovered from the gel. The pEASY-Uni Seamless Cloning and Assembly Kit was used to connect the fragments. The reaction system is shown in Table 2. The schematic diagram of the principle of site-directed integration of Eimeria tenella is shown in Figure 4 .
[0060] Table 2 Reaction system for constructing site-directed integration vector
[0061] Components Volume (μL) 2×Assembly Mix 10 U6+Vector 1 Et.Actin 1 Et.MIC2 1 Tg.DHFR-Ts 1 mCherry 1 Left homology arm 1 Right homology arm 1 <![CDATA[ddH2O]]> 3 Total volume 20
[0062] Add all components to a PCR tube, mix thoroughly, and react at 50°C for 15 minutes. Then, transform the product into competent cells, following the same steps as in step 1. Select positive clones identified by PCR and entrust Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing.
[0063] 5. Transfection and subculture of Eimeria tenella
[0064] Extract 5×10 Eimeria tenella sporozoites 6 Resuspend in PBS phosphate buffer and refrigerate at 4°C until ready for use. Thaw components I and II of the nuclear transfer buffer at room temperature and mix thoroughly to prepare the nuclear transfer buffer. Mix the linearized plasmid identified and sequenced in the previous step and the circular plasmid containing spCas9. The transfection system is shown in Table 3. After plasmid transfer into sporozoites using a nuclear transfer apparatus, add 1 mL of 42°C preheated DMEM and inoculate coccidia-free chickens via the cloaca.
[0065] Table 3 Transfection system
[0066]
[0067] After confirming the presence of coccidia expressing a fluorescent reporter gene in the first generation of oocysts expelled after transfection, the cells were then subjected to flow cytometry screening and continuous subculture under pyrimethamine selection pressure, rapidly increasing the proportion of transgenic coccidia. After three consecutive subcultures and expansions after transfection, the proportion of transgenic coccidia expressing the fluorescent protein reached 70%, confirming that the coccidia genomic locus HG994969.1:2704213-270525 provided by the present invention serves as a genomic safe harbor for exogenous gene integration.
[0068] 6. Identification of site-specific integration sites and fecundity determination of transgenic Eimeria
[0069] After the coccidian oocysts were purified, an appropriate amount of oocysts was taken and the oocyst walls were crushed with 2 mm glass beads. The oocysts were digested with decysting buffer at 42°C for 1 h. The genome was extracted using a blood, cell, and tissue DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) as follows:
[0070] Take an appropriate amount of digested sporozoites (at least 10 6 ) Add 200 μL of buffer GA and 20 μL of proteinase K and mix thoroughly. After incubating at 56°C for 30 minutes, add 200 μL of buffer GB and mix thoroughly by inversion. Incubate at 70°C for 10 minutes, add 200 μL of anhydrous ethanol, and shake thoroughly for 15 seconds. Add the resulting solution and flocculent precipitate to an adsorption column CB3 and centrifuge at 12,000 rpm for 30 seconds. Add 500 μL of buffer GD to the adsorption column CB3 and centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid and repeat this process. Return the adsorption column CB3 to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid and let it stand at room temperature for several minutes. Transfer the adsorption column CB3 to a clean centrifuge tube and dropwise add 100 μL of elution buffer TE to the middle of the adsorption membrane. Let it stand at room temperature for 3 minutes. Centrifuge at 12,000 rpm for 2 minutes. Collect the solution in a centrifuge tube and store in a -20°C refrigerator until needed.
[0071] Select the primer pair SEQ ID NO.1 and SEQ ID NO.5 to identify the 5' insertion site, and the primer pair SEQ ID NO.4 and SEQ ID NO.6 to identify the 3' insertion site. PCR reaction system: 1 μL each of upstream and downstream primers, 1 μL DNA template, 25 μL Taq enzyme, and make up to 50 μL with deionized water.
[0072] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 30 s; 35 cycles; final extension at 72°C for 10 min.
[0073] The results of PCR product gel electrophoresis are as follows Figure 5 As shown, the cells were then ligated and transformed, and positive clones were selected and sequenced by Beijing Ruibo Xingke Biotechnology Co., Ltd. Sequence comparison confirmed that the transgenic gene was integrated into the expected site.
[0074] Thirty AA broiler chickens aged 7 to 14 days without coccidia were randomly divided into 6 groups, with 5 chickens in each group. Three of the groups were inoculated with site-specifically integrated transgenic Eimeria, with each group inoculated with 5×10 3 , and each of the other three groups was inoculated with the maternal strain (wild type), and each was also inoculated with 5×10 3 The total amount of oocysts discharged from 5.5 to 8.5 days after inoculation was counted. Figure 6The results showed that the reproductive capacity of the transgenic insect strain was slightly improved compared with the maternal insect strain.
[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. Use of the Eimeria tenella genomic segment HG994969.1: 2704213-2705255 in preparing transgenic coccidia, wherein the Eimeria tenella genomic segment HG994969.1: 2704213-2705255 serves as an exogenous gene integration site.
2. A vector for site-directed integration of exogenous genes, characterized in that: In the vector, the sequence on the left side of the homology arm of the exogenous gene is the sequence of the Eimeria tenella genome segment HG994969.1: 2703603-2704213; the sequence on the right side of the homology arm of the exogenous gene is the sequence of the Eimeria tenella genome segment HG994969.1: 2705255-2705961.
3. The carrier according to claim 2, characterized in that include: The left sequence of the homologous arm of the exogenous gene, the MIC2 promoter, the polyA tail of the Actin gene and the right sequence of the homologous arm of the exogenous gene.
4. The carrier according to claim 2, characterized in that The left sequence of the homologous arm of the exogenous gene is amplified from SEQ ID NO.11-12; the right sequence of the homologous arm of the exogenous gene is amplified from SEQ ID NO.13-14.
5. The carrier according to claim 2, characterized in that The sequence on the left side of the homology arm of the exogenous gene is shown as SEQ ID NO.7; the sequence on the right side of the homology arm of the exogenous gene is shown as SEQ ID NO.
8.
6. The carrier according to claim 2, characterized in that The backbone of the vector is a PeasyBlunt vector containing gRNA, and the gRNA nucleotide sequence is shown in SEQ ID NO.
10.
7. The carrier according to claim 6, characterized in that The nucleotide sequence of the vector is shown in SEQ ID NO.
9.
8. A CRISPR / Cas9 targeting system, characterized in that: The CRISPR / Cas9 targeting system includes a targeted integration vector and gRNA, the gRNA sequence used is TTGCAATTGGAGCTGCGTAGTGG, and the targeted integration vector used is the vector according to any one of claims 2 to 7.
9. Use of the vector according to any one of claims 2 to 7 or the CRISPR / Cas9 targeting system according to claim 8 in improving the efficiency of producing transgenic coccidia.
10. A method for integrating an exogenous gene into the genome of Eimeria tenella, characterized in that: Using CRISPR / Cas9 technology, the exogenous gene was inserted into the HG994969.1: 2704213-2705255 site of the Eimeria tenella genome.
11. The method according to claim 10, characterized in that The exogenous gene is introduced into the vector according to any one of claims 2 to 7, the vector is linearized and evenly mixed with the circular plasmid containing spCas9 to construct a site-specific integration vector; the constructed site-specific integration vector is transfected into Eimeria tenella sporozoites, and a positive population is obtained by screening.