Enzyme mutation expression engineered bacteria for D-psicose synthesis and its application

Abstract

The present invention belongs to the field of microbial technology and discloses an enzyme mutation expression engineered bacterium for synthesizing D-psicose and its application. Thermus oshimai Glucose isomerase and its source Flavonifractor of the lungs A dual-enzyme system DH5α / pHY-P constructed by D-psicose 3-epimerase 43 ‑TogI‑P 43‑ DAEase, and through protein modification, the mutant strain BL10 / pHY-P was constructed to produce glucose isomerase and D-psicose 3-epimerase. 43 ‑TogI 182 ‑P 43 ‑DAEase 38 The strain was used for whole-cell catalysis, and it was able to catalyze the one-pot conversion of 500 g / L glucose into 185 g / L D-psicose, with a conversion rate of up to 35%, which is the highest level of D-psicose production from glucose at present. It greatly reduces production costs and has significant economic benefits.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and specifically relates to an engineered bacterium expressing a mutant enzyme for synthesizing D-psicose and its application. The engineered bacterium provided by the present invention can use glucose as a substrate and a dual-enzyme system to directly convert glucose into D-psicose. Background Art

[0002] Rare sugars are a class of monosaccharides (the smallest unit of sugar) and sugar alcohols that occur in extremely small quantities in nature. They taste similar to sucrose but offer advantages such as low calories, high stability, a harmonious sweetness, non-hygroscopicity, non-cariogenicity, and high tolerability. They can complement the shortcomings of traditional sweeteners and play an important role in improving the diets of special populations. Currently, there are over 50 known rare sugars. Obesity, hyperlipidemia, and diabetes are on the rise worldwide, primarily due to excessive consumption of high-fat and high-carbohydrate foods and lack of exercise. Some relatively rare monosaccharides, such as D-psicose and D-tagatose, have similar sweetness to sucrose but lower calories, making them promising new functional sweeteners for applications in healthcare and dietary applications. In 2002, the International Rare Sugars Society defined rare sugars as monosaccharides and their derivatives that are rare in nature. Low-calorie rare sugars have attracted considerable interest among researchers.

[0003] D-psicose is a functional rare sugar. D-psicose, English name D-allulose, formerly known as D-psicos e2', molecular formula is C6H 12 O6, with a relative molecular mass of 180.16 g / mol, is a C-3 diastereomer of D-fructose. It is a white, odorless, crystalline powder. D-psicose has 70% of the sweetness of sucrose but is low in calories, making it a good sucrose substitute. D-psicose is extremely rare in nature, and chemical synthesis is difficult to separate due to the high impurities and high cost. However, research and development using bioconversion technology has gradually become a hot topic internationally.

[0004] Currently, D-psicose is produced using D-fructose as a raw material via D-psicose 3-epimerase. Since D-psicose epimerase is an intracellular enzyme, the enzyme preparation can be obtained through simple centrifugation or membrane separation, reconstitution in deionized water, and homogenization. This greatly reduces the difficulty and cost of subsequent D-psicose purification, significantly improves the quality of the finished D-psicose product, saves production costs, and reduces power consumption. However, the enzymatic activity of the microorganisms reported to produce D-psicose 3-epimerase is low, and their ability to convert fructose remains poor, increasing the efficiency and difficulty of industrial production of D-psicose. Furthermore, fructose is more expensive than glucose, significantly increasing costs.

[0005] Therefore, constructing a dual-enzyme system for producing D-psicose using glucose as a substrate using Bacillus licheniformis is key to large-scale production and application. However, the current low conversion efficiency from glucose to D-psicose limits the application and promotion of this system. Summary of the Invention

[0006] The present invention aims to address the problems of high cost and low efficiency in the prior art of D-psicose 3-epimerase conversion using fructose as a substrate to prepare D-psicose. The present invention provides an engineered bacterium expressing a mutant enzyme for synthesizing D-psicose.

[0007] Another object of the present invention is to provide a dual-enzyme system for directly converting glucose into D-psicose. This system can catalyze the one-pot conversion of 500 g / L of glucose to 175 g / L of D-psicose, representing the current highest level of D-psicose production from glucose, significantly reducing production costs.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] An engineered strain expressing a mutant enzyme for synthesizing D-psicose, the strain containing recombinant Bacillus licheniformis capable of expressing the proteins shown in SEQ ID NO. 5 and SEQ ID NO. 6;

[0010] Among the above-mentioned strains, preferably, the Bacillus licheniformis is Bacillus licheniformis BL10.

[0011] The protection scope of the present invention also includes: the use of the above-mentioned enzyme mutation expression engineered bacteria in the synthesis of D-psicose.

[0012] The above application is specifically to prepare D-psicose by directly using glucose as a substrate and catalyzing the reaction using the above recombinant Bacillus licheniformis.

[0013] Compared with the prior art, the present invention has the following advantages:

[0014] The dual enzyme system DH5α / pHY-P constructed by the glucose isomerase from Thermus oshimai and the D-psicose 3-epimerase from Flavonifractor plautii is 43 -TogI-P 43- DAEase, and through protein modification, a mutant strain BL10 / pHY-P was constructed to produce glucose isomerase and D-psicose 3-epimerase. 43 -TogI 182 -P 43 -DA Ease 38The strain was used for whole-cell catalysis, and it was able to catalyze the "one-pot" conversion of 500g / L glucose into 175g / L D-psicose, with a conversion rate of up to 35%. This is higher than the conversion rate of traditional single-enzyme systems, and glucose can be directly converted into D-psicose, which is the highest level of D-psicose production from glucose at present. It greatly reduces production costs and has significant economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of the difference in D-psicose production between the original dual-enzyme expression bacteria and the mutant strain. DETAILED DESCRIPTION

[0016] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field; the reagents or materials described are all from commercial channels unless otherwise specified.

[0017] Example 1:

[0018] Construction of a dual-enzyme expression vector for glucose isomerase and D-psicose 3-epimerase

[0019] Using the PHY300PLK plasmid as a template, primers (Amp-PHY-GJ-F, Amp-PHY-GJ-R) were used to PCR amplify the vector DNA sequence to obtain the vector backbone sequence to be cloned.

[0020] Thermus oshimai genomic DNA (NC_019386.1) was used as a template, and primers (togI-F, togI-R) were used to PCR amplify the complete nucleotide sequence of the TogI gene (shown in SEQ ID NO.1) to obtain the complete sequence of glucose isomerase. The expression cassette and the vector backbone were homologously recombined using a recombination cloning kit and transformed into Escherichia coli DH5α. The bacteria were spread on a culture plate containing Tet resistance for screening and cultured in a 37°C incubator. The transformants were verified by colony PCR using primers Amp-pHY-F and Amp-pHY-R. If the target size was correct, the next step of sequencing could be performed. The vector nucleotide sequence determination was completed by Wuhan Qingke Biotechnology Co., Ltd.; the sequencing results were analyzed. If the sequence was consistent with the design, the free expression vector DH5α / Amp-pHY-P was obtained. 43 -TogI. The primers used are as follows:

[0021] Amp-pHY-F:tattgaaaaaggaagagt

[0022] Amp-pHY-R:tatgagtaaacttggtctgacag

[0023] AMP-PHY-GJ-F: CCTTTTAGGGGTTCGGGGATGAAAGAGCAGAGAGGACGGATTTC C

[0024] AMP-PHY-GJ-R:CGGGTTTAGGTTCGTACATTGATCCTTCCTCCTTTAG

[0025] togI-F:ATGTACGAACCTAAACCG

[0026] togI-R: TCATCCCCGAACCCCTAAAAGG

[0027] Using vector DH5α / pHY-P 43 -TogI was used as a template and primers (PHY-GJ-F, PHY-GJ-R) were used to amplify the vector DNA sequence by PCR to obtain the vector backbone sequence to be cloned. Using Dorea sp. genomic DNA (NZ_ASTD01000000) as a template, primers (DAEase-F, DAEase-R) were used to PCR amplify the complete DAEase gene nucleotide sequence (shown in SEQ ID NO. 2) to obtain the complete sequence of D-psicose 3-epimerase. The expression cassette and vector backbone were homologously recombined using a recombinant cloning kit and transformed into Escherichia coli DH5α. The bacteria were spread on culture plates containing Tet resistance for screening and cultured in a 37°C incubator. The transformants were verified by colony PCR using primers pHY-F and pHY-R. If the target size was correct, the next step of sequencing could be performed. The vector nucleotide sequence was determined by Wuhan Qingke Biotechnology Co., Ltd. The sequencing results were analyzed. If the sequence was consistent with the design, the dual-enzyme free expression vector DH5α / pHY-P was obtained. 43 -TogI-P 43- DAEase. The primers used are as follows:

[0028] pHY-F:gtttattatccatacccttac

[0029] pHY-R:cagatttcgtgatgcttgtc

[0030] PHY-GJ-F: AAGAGCAGAGAGGACGGATTTCCTG

[0031] PHY-GJ-R:TATATATTCCTCCTTTCT

[0032] DAEase-F:AGAAAGGAGGAATATATAATGAAACACGGAATTTAC

[0033] DAEase-R: TCAGGAAATCCGTCCTCTCTGCTCTTTTATTTCCAATCCAACAT

[0034] Example 2:

[0035] Construction of dual enzyme mutant expression vector

[0036] Using vector pHY-P 43 -TogI-P 43 -DAEase was used as a template and designed mutation primers were used to amplify the mutant backbone. The designed mutation primer sequences are as follows:

[0037] K182P-TogI-F:GCCCTCGAGCCACCGCCGAACGAACCAAGGGGGGATATC

[0038] K182P-TogI-R:GGTTCGTTCGGCGGTGGCTCGAGGGCAAAACGATAGCCG

[0039] The target backbone DNA was separated by lipose gel electrophoresis and purified using OMEGA's Gel Extraction Kit. A small amount of mutant backbone DNA was then added to the competent E. coli DH5α, and the mutant vector was circularized using the strain's own repair system. The bacteria were plated on a culture plate containing Tet resistance for screening and cultured in a 37°C incubator. The transformants were verified by colony PCR using primers Amp-pHY-F and Amp-pHY-R. If the target size was correct, the next step was sequencing. The vector nucleotide sequence was determined by the Wuhan branch of Beijing Qingke Biotechnology Co., Ltd. The sequencing results were analyzed. If the sequence was consistent with the design, the mutant vector DH5α / pHY-P 43 -TogI 182 -P 43 -DA Ease was successfully constructed, and the expression vector expressed the glucose isomerase mutant (shown in SEQ ID NO.5).

[0040] Using vector DH5α / pHY-P 43 -TogI 182 -P 43 -DAEase was used as a template and designed mutation primers were used to amplify the mutant backbone. The designed mutation primer sequences are as follows:

[0041] A38E-DAEase-F:GGAAATCGGGGCTGAACCATTGCCGGAGTATAGC

[0042] A38E-DAEase-R:CCGGCAATGGTTCAGCCCCGATTTCCAGAAG

[0043] The target backbone DNA was isolated by agarose gel electrophoresis and purified using OMEGA's Gel Extraction Kit. A small amount of mutant backbone DNA was then added to competent E. coli DH5α cells, and the mutant vector was circularized using the strain's own repair system. The cells were plated on Tet-resistant culture plates for screening and cultured in a 37°C incubator. Transformants were verified by colony PCR using primers pHY-F and pHY-R. If the target size was correct, sequencing was performed. The vector nucleotide sequence was determined by the Wuhan branch of Beijing Qingke Biotechnology Co., Ltd. The sequencing results were analyzed. If the sequence was consistent with the design, the D-psicose 3-epimerase mutant vector DH5α / pHY-P was confirmed. 43 -TogI 182 -P 43 -DAEase 38 The construction was successful, and the dual-enzyme mutant expression vector expressed a glucose isomerase mutant (shown in SEQ ID NO. 5) and a D-psicose 3-epimerase mutant (shown in SEQ ID NO. 6).

[0044] Example 3:

[0045] Construction of enzyme-expressing engineered bacteria and enzyme-mutant-expressing engineered bacteria

[0046] The correct vector pHY-P was verified by sequencing. 43 -TogI 182 -P 43 -DAEase 38 and the original expression vector pHY-P 43 -TogI-P 43-DAEase electroporated into Bacillus licheniformis BL10 (CN104630124A). Inoculate Bacillus licheniformis BL10 in 5 mL of LB medium and culture overnight at 37°C, 230 rpm. Transfer to 50 mL of Bacillus licheniformis electroporation growth medium and incubate at 230 rpm at 37°C for 3 hours (OD value is 0.8-0.9). Place the shake flask in an ice bath for 10 minutes. Centrifuge at 7500 rpm for 7 minutes to collect the cells. Wash the cells three times with Bacillus licheniformis electroporation wash medium (30 mL of wash solution / time). Finally, resuspend in 1 mL of wash medium and quickly aliquot into 1.5 mL centrifuge tubes, 100 μL per tube. Store at -80°C to obtain competent cells. Take a tube of competent cells and add 5uL plasmid DNA (50ng / uL), transfer the cells to a pre-cooled electroporation cup (0.2cm), ice bath for 1-1.5min, and electroporate once at 2.4kV using an electric pulse converter. After the electroporation, quickly add 800uL of Bacillus licheniformis electroporation recovery medium, incubate at 37℃, and then recover the culture on a shaker at 110r / min for 3h. Apply a tetracycline resistance plate containing 20ug / mL and incubate at 37℃ overnight to screen the transformants.

[0047] Pick a single transformant colony and streak it on a plate containing antibiotics. Culture overnight. Pick an appropriate number of colonies into a 1.5mL EP tube containing 30uL of the solution, mix well, and place in a boiling water bath for 20 minutes. After removal, centrifuge at 10,000 rpm for 30 seconds. The supernatant is collected and used as a template for colony PCR. PCR and sequencing confirm the positive clones, thus obtaining the dual enzyme expression engineered bacteria BL10 / pHY-P. 43 -TogI-P 43 -DAEase (the strain contains the sequences shown in SEQ ID NO. 1 and 2), dual enzyme mutant engineered bacteria BL10 / pHY-P 43 -TogI 182 -P 43 -DAEase 38 (The strain contains the sequences shown in SEQ ID NOs. 3 and 4, and encodes the proteins shown in SEQ ID NOs. 5 and 6).

[0048] Example 4:

[0049] Shake flask fermentation of dual-enzyme expression engineered bacteria and dual-enzyme mutation engineered bacteria

[0050] 1. Strain activation

[0051] The dual enzyme expression engineering bacteria BL10 / pHY-P 43 -TogI-P 43 -DAEase and dual enzyme mutant engineered bacteria BL10 / pHY-P 43 -TogI182 -P 43 -DAEase 38 , streak onto tetracycline-resistant plates and incubate at 37°C for 12-14 hours. Pick a single colony and inoculate it into 5 mL of LB medium (containing tetracycline resistance) and incubate it at 37°C, 220 rpm, and shake for 12-14 hours. Then, transfer the cultured bacteria into 20 mL of seed medium (containing tetracycline resistance) and incubate it at 37°C, 220 rpm, and shake for 12-14 hours.

[0052] The seed culture medium is LB medium: 10 g / L peptone; 5 g / L yeast extract powder; 10 g / L sodium chloride; pH 7.0-7.2.

[0053] Seed culture: 250 mL Erlenmeyer flask, 20 mL liquid volume, culture temperature 37 ° C, shaker speed 220 r / min, culture to OD 600 is 1.0.

[0054] 2. Liquid fermentation culture

[0055] Liquid fermentation medium: yeast powder 24g / L, peptone 12g / L, glycerol 5g / L, K2HPO4·3H2O 16.43g / L, KH2PO4 2.31g / L

[0056] Liquid fermentation culture conditions: 250 mL Erlenmeyer flask, 50 mL liquid volume, fermentation temperature 37°C, shaker speed 230 r / min, fermentation time 24 h, centrifugation to obtain wet cells for use in the following examples.

[0057] Example 5:

[0058] Whole cells catalyze the production of D-psicose from glucose

[0059] The whole-cell reaction was carried out for 8 hours using 500 g / L glucose as the substrate, 40 g / L wet cells, and phosphate buffer pH 6.5. The product was centrifuged, passed through a membrane, and diluted to a certain concentration before detection by high-performance liquid chromatography. Detection conditions: Waters 2695 HPLC, Waters Sugar-PakⅠ column, Waters differential refractive index detector, column temperature 30°C, mobile phase 75% acetonitrile, flow rate 0.8 mL / min. For the determination of D-psicose, it can be seen that the dual-enzyme expression control strain BL10 / pHY-P 43 -TogI-P 43 -DAEas, the conversion rate of glucose to D-psicose was 25% by liquid phase calculation, while the dual enzyme mutant engineered bacteria BL10 / pHY-P 43 -TogI 182 -P 43 -DAEase38 The D-psicose production was 175 g / L, and the conversion rate was 35%, which was 10 percentage points higher than that of the control strain (see Figure 1 ), which is the highest level of direct conversion of glucose into D-psicose so far, indicating that this scheme has significant application prospects in improving the conversion efficiency of D-psicose.

Claims

1. A strain of engineered bacteria expressing a mutant enzyme for synthesizing D-psicose, wherein the strain is a recombinant Bacillus licheniformis that expresses the proteins shown in SEQ ID NO. 5 and SEQ ID NO.

6.

2. The engineered bacteria according to claim 1, wherein the Bacillus licheniformis is Bacillus licheniformis BL10.

3. Use of the engineered bacteria according to claim 1 in synthesizing D-psicose.

4. The use according to claim 3, wherein glucose is used as a substrate and catalyzed by the recombinant Bacillus licheniformis according to claim 1 to produce D-psicose.

Images