Use of knockdown or knockout of long non-coding RNA CCTT in inhibiting tumor growth

Abstract

The application discloses application of long non-coding RNA CCTT knockdown or knockout in inhibition of tumor growth. The application provides application of a substance capable of inhibiting lncRNA CCTT expression in any one of the following: preparation of a product for inhibiting tumor cell proliferation and / or growth; preparation of a product for reducing tumorigenicity of tumor cells. LncRNA CCTT exhibits strong cancer-promoting function in both in-vivo and in-vitro experiments, and the cancer-inhibiting effect of the inhibition of lncRNA CCTT is obvious, and the clinical significance of high expression of lncRNA CCTT leading to poor prognosis of patients is also very significant. Therefore, lncRNA CCTT knockdown / knockout for inhibiting tumor cell growth can provide a new strategy for tumor targeted therapy.

Description

TECHNICAL FIELD

[0001] The present application relates to the biomedical field, and in particular to application of knockdown or knockout of long non-coding RNA (lncRNA) CCTT in inhibition of tumor growth. BACKGROUND

[0002] Lung cancer is the highest mortality rate of cancer in the world, and the number of people who die of lung cancer each year exceeds one million, and invasion and metastasis and tumor recurrence during lung cancer progression are the main causes of death. Lung cancer can be divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) in histology, SCLC accounts for about 15%, and NSCLC accounts for about 85%, among which adenocarcinoma is the most common. Long non-coding RNA (lncRNA) is a kind of RNA with a length of more than 200 nucleotides, and its abnormal expression is common in various human tumors including lung cancer.

[0003] LncRNA plays an important role in various biological processes, including stress response, development, stem cell pluripotency, alternative splicing, chromatin remodeling and mRNA degradation. In addition, lncRNA is involved in the regulation of many cell behaviors and functions, such as cell cycle, cell survival, cell migration and cell metabolism. More and more evidence shows that lncRNA abnormally expressed in various human tumors can function as a tumor suppressor gene or an oncogene. Although the functional mechanism of most lncRNAs is still unclear, it has become a new regulator of tumor occurrence and development after microRNA, and shows potential application value in clinical diagnosis and treatment.

[0004] Screening of suitable molecular targets is the premise and basis of tumor targeted therapy. How to screen and which molecule to screen are the primary problems of related research. Although there have been many reports on tumor treatment strategies targeting protein-coding genes, due to the high conservation and wide function of protein-coding genes, it is difficult to guarantee the specificity, which may lead to more serious side effects. In contrast, non-coding genes have corresponding advantages due to their low conservation and strong functional specificity. The small molecular weight of RNA is easy to detect and target intervention, which is also an advantage of RNA as a good target for tumor targeted therapy. With the deepening of lncRNA research and the discovery of a batch of oncogenic lncRNAs, it has become a potential new target for tumor treatment. For example, specific targeting of lncRNA SAMMSON by antisense oligonucleotide (ASO) can specifically improve the fragility of melanoma cells, thereby easily killing tumor cells and inhibiting tumor development. SUMMARY

[0005] The purpose of the present application is to provide application of knockdown or knockout of lncRNA CCTT in inhibition of tumor growth.

[0006] In a first aspect, the present application claims to protect the use of a substance capable of inhibiting the expression of lncRNA CCTT in any of the following:

[0007] P1, preparing a product for inhibiting the growth and / or proliferation of tumor cells;

[0008] P2, preparing a product for reducing the tumorigenicity of tumor cells.

[0009] In the specific embodiments of the present application, it can be embodied as: 1) promoting the cell cycle arrest of tumor cells in G0 / G1 phase (reducing the proportion of S phase cells); 2) inhibiting tumor cell colony formation; 3) inhibiting tumor formation in nude mice.

[0010] In a second aspect, the present application claims to protect the use of a substance capable of inhibiting the expression of lncRNA CCTT in preparing a product for inhibiting tumor growth.

[0011] In the above two aspects, the substance capable of inhibiting the expression of lncRNA CCTT can be any substance capable of knocking down or knocking out the expression of the lncRNA CCTT, such as siRNA, shRNA, ASO targeting the lncRNA CCTT or a gene editing system (such as CRISPR / Cas9) for knocking out DNA capable of transcribing the lncRNA CCTT, etc.

[0012] Further, the siRNA targeting the lncRNA CCTT can be as shown in SEQ ID No. 1.

[0013] Further, the ASO targeting the lncRNA CCTT can be as shown in SEQ ID No. 2 or SEQ ID No. 3.

[0014] Further, the shRNA targeting the lncRNA CCTT can be as shown in SEQ ID No. 4.

[0015] Further, the CRISPR / Cas9 system for knocking out DNA capable of transcribing the lncRNA CCTT and the knocking out strategy include gRNA, the target sequence of the gRNA can be SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7.

[0016] In a third aspect, the present application claims to protect the use of lncRNA CCTT as a target in preparing a product for treating tumors.

[0017] In a fourth aspect, the present application claims to protect the use of a substance capable of detecting lncRNA CCTT in preparing a product for evaluating the prognosis of tumor patients.

[0018] In the application, the prognosis of the tumor patient with low expression of the lncRNA CCTT is significantly better than that of the tumor patient with high expression of the lncRNA CCTT. The low expression refers to that the expression level of the lncRNA CCTT in the tumor tissue is lower than that in the normal cancer-adjacent tissue; the high expression refers to that the expression level of the lncRNA CCTT in the tumor tissue is higher than that in the normal cancer-adjacent tissue. The good and bad prognosis is reflected in the overall survival rate and survival period.

[0019] In each of the above aspects, the product can be specifically a drug.

[0020] In each of the above aspects, the lncRNA CCTT is specifically the RNA shown in SEQ ID No. 8.

[0021] In each of the above aspects, the tumor cell is a tumor cell with high expression of the lncRNA CCTT; the tumor is a tumor with high expression of the lncRNA CCTT. The high expression of the lncRNA CCTT refers to that the expression level of the lncRNA CCTT in the tumor tissue is higher than that in the normal cancer-adjacent tissue.

[0022] In each of the above aspects, the tumor cell can be a lung cancer cell or a cervical cancer cell; the tumor can be lung cancer or cervical cancer.

[0023] Further, the lung cancer cell can be a lung adenocarcinoma cell; the lung cancer can be lung adenocarcinoma.

[0024] In the specific embodiments of the present application, the lung adenocarcinoma cell is an A549 cell or an H1299 cell; the cervical cancer cell is a HeLa cell.

[0025] Experiments prove that: cell experiments show that knocking down / knocking out the lncRNA CCTT can inhibit the growth of tumor cells, inhibit the proliferation of tumor cells, and reduce the tumorigenicity of tumor cells. Nude mouse tumor formation experiments show that, after 3 weeks of inoculation, the volume and mass of the tumor foci formed by the lncRNA CCTT knockdown cells are significantly smaller than those of the control cells, which confirms that the lncRNA CCTT promotes tumor growth from the in vivo level. Knocking down the lncRNA CCTT significantly inhibits the growth of tumors in vivo, indicating that the lncRNA CCTT is a potential target for targeted inhibition of lung cancer. Clinically, analysis of the expression level of CCTT and the prognosis of lung cancer patients using the TCGA database shows that patients with high expression of lncRNA CCTT have poor prognosis. Similarly, among 26 types of tumors, about 2 / 3 show that high expression of lncRNA CCTT is positively correlated with poor prognosis, suggesting that targeting lncRNA CCTT has wide clinical significance. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1To knock down lncRNA CCTT in A549 cells. Human lung cancer cell line A549 was transfected with 50 mM siRNA (A) or ASO (B) targeting lncRNA CCTT and corresponding control (NC), and the expression level of lncRNA CCTT was detected by qRT-PCR 48 h later. The expression level of lncRNA CCTT in lncRNA CCTT stably knocked down A549 cells was detected by qRT-PCR, and A549 cells infected with empty vector virus were used as control (C). Unpaired t test, **p < 0.01.

[0027] Figure 2 To establish lncRNA CCTT knockout HeLa cells by CRISPR / Cas9. A is a schematic diagram of the strategy for establishing CCTT knockout HeLa cells by CRISPR / Cas9; B is the detection of single clone CCTT + / - and CCTT - / - cells by PCR / RT-PCR; C is the detection of the expression level of lncRNA CCTT in CCTT - / - cells by immunofluorescence in situ hybridization (FISH); D is the detection of the expression level of lncRNA CCTT in CCTT - / - cells by Northern blot.

[0028] Figure 3 To inhibit tumor cell growth by knocking down / knocking out lncRNA CCTT. Growth curves of lncRNA CCTT knocked down A549 cells (A) and lncRNA CCTT knockout HeLa cells (B). Unpaired t test, **p < 0.01, ***p < 0.001.

[0029] Figure 4 To cause cell cycle arrest by knocking down lncRNA CCTT. The proportion of cells in G0 / G1, S, and G2 / M phases was analyzed by PI single staining flow cytometry in A549 cells with lncRNA CCTT knocked down. Unpaired t test, *p < 0.05.

[0030] Figure 5 To inhibit tumor cell colony formation by knocking down / knocking out lncRNA CCTT. Colony formation of lncRNA CCTT knocked down A549 cells (A) and lncRNA CCTT knockout HeLa cells (B). Unpaired t test, **p < 0.01.

[0031] Figure 6Knockdown of lncRNA CCTT inhibits tumor formation in nude mice. A549 cells were injected into nude mice, and the tumor volume (middle) and weight (right) were measured 22 days after inoculation, n = 10. Paired t test, **p < 0.01.

[0032] Figure 7 Knockdown of lncRNA CCTT inhibits tumor growth in vivo. H1299 cells were injected into nude mice bilaterally, and after tumor formation, siRNA targeting lncRNA CCTT and control siRNA (NC) were injected in situ to both sides. 15 pmols / time, injected once every 1 day, for 5 times in succession. During the period, the tumor diameter was continuously measured, and the sample was taken when the tumor diameter reached 1 cm, n = 3. Paired t test, **p < 0.01.

[0033] Figure 8 High expression of lncRNA CCTT is associated with poor prognosis in lung cancer patients. The relationship between the relative expression level of CCTT in tumor and paracancerous tissue and the prognosis of lung cancer samples in TCGA database was analyzed. Statistical differences were analyzed by Logrank test, n = 378. In the figure, CCTT high / low refers to the relative expression level of lncRNA CCTT in tumor and paracancerous tissue.

[0034] Figure 9 High expression of lncRNA CCTT is positively correlated with poor prognosis in various tumors. Cox proportional hazards model was used to analyze the correlation between the prognosis of 26 tumor patients (more than 50 cases) and the expression level of lncRNA CCTT. Statistical differences were analyzed by Logrank test. DETAILED DESCRIPTION

[0035] The application will be further described in detail below with specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0036] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0037] The nucleotide sequence of lncRNA CCTT involved in the following examples is shown in SEQ ID No. 8.

[0038] The conventional test methods involved in the following examples are as follows:

[0039] 1. Cell culture

[0040] Human lung cancer cell line A549, H1299 and human cervical cancer cell line HeLa were cultured in DMEM high glucose medium (Hyclone) containing 10% FBS, and the culture conditions were 37°C and 5% CO2 concentration.

[0041] 2. Cell passage

[0042] (1) Discard the culture medium with a vacuum pump;

[0043] (2) Add 2 ml PBS along the wall of the culture dish to wash the residual culture medium;

[0044] (3) Add 1.5 ml 0.25% trypsin (containing EDTA) and incubate at 37°C for 5 min to digest the cells;

[0045] (4) Add 2 ml complete medium to terminate digestion, and after gentle blowing, transfer the cell suspension to a 15 ml pipette and centrifuge at 1000 rpm for 3 min;

[0046] (5) Discard the supernatant with a vacuum pump, and resuspend the cells with 2 ml of complete medium;

[0047] (6) Count the cell suspension: add 10 ml of diluent to the measuring cup, take 100 μl of cell suspension and add it to the measuring cup, mix well up and down, and put it into the cell counter to count. The measured reading is the number of cells per milliliter, and repeat once to reduce error;

[0048] (7) Seed appropriate cell culture dishes or plates, and the seeding density is determined according to different cell types and experimental requirements.

[0049] 3. Cell transfection

[0050] (1) Dilute the plasmid or siRNA with an appropriate amount of jetPRIME buffer according to the instructions, and the final concentration of plasmid is 500 ng / ml, and the final concentration of siRNA / ASO is 50-100 nM (determined according to experimental requirements);

[0051] (2) Shake for 10 s after adding the corresponding jetPRIME transfection reagent, and centrifuge quickly;

[0052] (3) Incubate at room temperature for 10-15 min;

[0053] (4) Add the transfection mixture to the cells (replace the complete medium in advance);

[0054] (5) Mix well up and down, and incubate at 37°C and 5% CO2 concentration;

[0055] (6) Transfection 4h, change the liquid (optional), the appropriate time point for the next step experiment.

[0056] 4、Total RNA extraction

[0057] (1) Use a vacuum pump to suck the base, add 1ml TRIzol to each well, suck into a 1.5ml EP tube, and place on ice;

[0058] (2) Add 200μl chloroform to the EP tube, mix well by inverting, and stand at room temperature for 3min;

[0059] (3) 4℃, 12000rpm centrifugation for 15min;

[0060] (4) Carefully transfer the upper liquid to a new RNase-free EP tube (do not suck and the lower liquid), add 500μl isopropanol to each tube, mix well by inverting, and stand at room temperature for 10min;

[0061] (5) 4℃, 12000rpm centrifugation for 10min;

[0062] (6) Discard the supernatant, add 1ml 75% ethanol (RNase-free, DEPC water preparation) to each tube, resuspend the RNA precipitate at the bottom of the tube, 4℃, 7500rpm centrifugation for 5min;

[0063] (7) Discard the supernatant, and let the EP tube stand naturally (about 2min);

[0064] (8) According to the amount of RNA precipitate, add an appropriate amount of RNase-free water to dissolve the precipitate, and place it in a 55℃ constant temperature water bath for 10min to fully dissolve the RNA;

[0065] (9) Measure the RNA concentration with NanoDrop 2000, and perform subsequent experiments or store at -80℃ for long-term preservation.

[0066] 5、RNA reverse transcription

[0067] Use the genomic DNA reverse transcription kit (Toyobo FSQ-301) to reverse transcribe RNA into cDNA.

[0068] (1) Reaction system (20μl, operate on ice):

[0069] 5×RT mix 4μl; RNA 2μg (calculate the volume according to the concentration); RNase-free water to 16μl.

[0070] (2) Reaction program:

[0071] 37℃ for 15min; 50℃ for 5min; 98℃ for 5min; 4℃ storage.

[0072] After the reaction, 30 μl sterile water was added to dilute the cDNA, which was used for the next step or stored at -20°C.

[0073] 6. Quantitative Real-Time PCR (qRT-PCR)

[0074] (1) The cDNA template and Master Mix (Green Realtime PCR Master Mix Toyobo, stored in the dark) were thawed on ice.

[0075] (2) Reaction system (10 μl):

[0076] cDNA template 1 μl; upstream primer 0.5 μl; downstream primer 0.5 μl; Green Realtime PCR Master Mix 4.5 μl; deionized water 3.5 μl.

[0077] The sequences of the upstream and downstream primers were designed by Primer Premier 5 software, and the main primers were as follows:

[0078] CCTT-F: 5'-CTAAGGATTCGGTGTTGG-3';

[0079] CCTT-R: 5'-CCTGCCAGGTTAGAGGG-3'.

[0080] GAPDH-F: 5'-ACCCAGAAGACTGTGGATGG-3';

[0081] GAPDH-R: 5'-CAGTGAGCTTCCCGTTCAG-3'.

[0082] (3) The prepared reaction mixture was placed in a real-time fluorescent quantitative PCR instrument (ABI 7500 Fast), and the program was as follows:

[0083] 95°C for 60 s;

[0084] 95°C for 15 s, 60°C for 15 s, 72°C for 45 s, 40 cycles.

[0085] (4) After the reaction, the expression level of the target RNA was analyzed according to the formula 2 -△△CT Each experiment required 2-3 replicates, and the results of 3 independent experiments were used for statistical analysis.

[0086] ​7、The sample data of human tumor and paracancerous tissue in the application come from TCGA database, and are analyzed by cBioPortal (http: / / www.cbioportal.org). Survival curve, column chart and difference significance analysis are performed by using GraphPad Prism 5 software. Quantitative data is expressed as mean ± standard error, two-group data test uses two-tailed TTEST, and difference significance is: *p < 0.05, **p < 0.01, ***p < 0.001, statistically significant; ns: p > 0.05, not statistically significant.

[0087] Example 1, Targeted Knockdown of lncRNA CCTT in A549 Cells

[0088] 1. Transient knockdown

[0089] The siRNA or ASO (#1 or #2) targeting lncRNA CCTT was transfected into human lung cancer cell line A549 by using jetPRIME (polyplus, item number: 114-15) transfection reagent (for specific method, see “Cell Transfection” above), and the knockdown efficiency was detected by qRT-PCR 48 h later (for specific method, see “Cell Total RNA Extraction”, “RNA Reverse Transcription” and “qRT-PCR” above).

[0090] The siRNA sequence targeting lncRNA CCTT is as follows:

[0091] 5'-CCAGAUGUCUUCAGCUCCA-3' (SEQ ID No. 1).

[0092] The NC siRNA as a control is a commercial product (item number: siN0000002-1-5).

[0093] The two ASO sequences targeting lncRNA CCTT are as follows:

[0094] #1: 5'-GCTACCAGAAGGGAGCACCA-3' (SEQ ID No. 2);

[0095] #2: 5'-CCAGATGTCTTCAGCTCCAA-3' (SEQ ID No. 3).

[0096] The NC ASO as a control is a commercial product (item number: lnc6N0000001-1-10).

[0097] All of the above are products of Guangzhou Ribobio Biotechnology Co., Ltd. (Ribobio).

[0098] 2. Stable knockdown (construction of stable cell line)

[0099] (1) The lncRNA CCTT shRNA (SEQ ID No. 4) was packaged into retrovirus pQCXIP-sh-CCTT using retrovirus expression vector pQCXIP (Biovector, Cat No: 3558629).

[0100] The shRNA sequence targeting lncRNA CCTT is as follows: 5'- CCAGATGTCTTCAGCTCCATTCAAGAGAACCTCGACTTCTGTAGACCTTTTTT-3' (SEQ ID No. 4).

[0101] (2) 2x10 5 A549 cells were seeded into 6-well plates and grown adherently to 70% confluence.

[0102] (3) The cells were infected with pQCXIP-sh-CCTT retrovirus, with empty virus as a control (1 ml virus + 1 ml DMEM medium incubated for 12 h, then replaced with DMEM complete medium).

[0103] (4) After 48 h, puromycin (3 μg / ml) was added for screening, and the surviving cells were expanded to establish cell lines after 3 d.

[0104] (5) The lncRNA CCTT knockdown efficiency was detected by cell RNA qRT-PCR.

[0105] The results showed that in human lung cancer A549 cells, lncRNA CCTT was knocked down, and the specific siRNA or ASO targeting lncRNA CCTT caused its expression level to be down-regulated to 30-40%, and the lncRNA CCTT stable knockdown A549 cell line was successfully constructed ( Figure 1 ), and could be used for subsequent functional evaluation.

[0106] Example 2, lncRNA CCTT knockout HeLa cell line established by CRISPR / Cas9

[0107] Since the complete deletion of lncRNA CCTT significantly inhibits cell growth and survival, an lncRNA CCTT inducible knockout HeLa cell line was established by CRISPR / Cas9 and Cre-Loxp system, and the strategy was divided into three steps:

[0108] Firstly, lncRNA CCTT single allele large fragment deletion heterozygote cells were established. HeLa cells stably expressing Cas9 were established by lentivirus pLenti-U6-spgRNA v2.0-CMV-Puro-P2A-3Flag-spCas9 (Genechem, Cat No. H7548) infection. gRNAs targeting the upstream and downstream of lncRNA CCTT gene (5'-GATGGGGCTAGCAGAGGCCTTGG-3' (SEQ ID No. 5); 5'-GGCTGCCTTCACCCCC ACCAAGG-3' (SEQ ID No. 6)) were designed, transfected (Lipofectamine 2000, Thermofisher, Cat No. 11668-027) into HeLa cells expressing Cas9 after in vitro transcription, and mediated large fragment deletion of lncRNA CCTT gene. Through single clone screening, PCR and sequencing identification, lncRNA CCTT single allele large fragment deletion heterozygote cells (CCTT + / - , Figure 2 A and B in the middle).

[0109] Secondly, LoxP anchor lncRNA CCTT remaining allele first exon conditional knockout cells were established. The vector (Loxp anchor lncRNA CCTT first exon and homologous arm) was constructed, and gRNA (5'-GGGACTCCTGAATCTAGGAGGAG-3' (SEQ ID No. 7)) was used to target knock-in the other allele of lncRNA CCTT to establish Cre recombinase-mediated conditional knockout cells. Through single clone screening, PCR and sequencing identification, lncRNA CCTT conditional knockout cells (CCTT flox / - , Figure 2 A and B in the middle).

[0110] Thirdly, lncRNA CCTT complete knockout was mediated by adenovirus Cre. lncRNA CCTT conditional knockout cells were treated with adenovirus Cre (pADV-CMV-Cre, Genechem, Cat No. K0024) for 12-24 h to obtain lncRNA CCTT complete knockout cells. RT-PCR, in situ hybridization and Northern blot were used to verify the loss of lncRNA CCTT expression (CCTT - / - , Figure 2 A-D in the middle).

[0111] Figure 2 The specific information of the five primers involved in the middle is as follows:

[0112] Primer 1 is a 5' end primer for screening lncRNA CCTT complete knockout cells:

[0113] F: 5'-CCTGGCTCTTGCTCTTCC-3';

[0114] R: 5'-CTTGGTGCTCCCTTCTGG-3'.

[0115] Primer 2 is a 3' end primer for screening lncRNA CCTT completely knockout cells:

[0116] F: 5'-CGAGGAACATGGCGAAAC-3';

[0117] R: 5'-GCCCTGCAACACGTCAGT-3'.

[0118] Primer 3 is a large fragment deletion primer for screening lncRNA CCTT completely knockout cells:

[0119] F: 5'-CCACATTTACCCACCCACG-3';

[0120] R: 5'-CCCAGTGCCTACTTGCTTCTA-3'.

[0121] Primer 4 is a large fragment primer for screening lncRNA CCTT inducible knockout cells:

[0122] F: 5'-ACACCCTACCCACTCTGTAC-3';

[0123] R: 5'-GCTTCTCCACCTTCTGACACT-3'.

[0124] Primer 5 is a qRT-PCR primer for identifying lncRNA CCTT transcript:

[0125] F: 5'-CTAAGGATTCGGTGTTGG-3';

[0126] R: 5'-CCTGCCAGGTTAGAGGG-3'.

[0127] Example 3, Knocking down / knocking out lncRNA CCTT leads to tumor cell growth arrest

[0128] Test cells: lncRNA CCTT knockdown A549 cells prepared in Example 1 (introducing siRNA shown in SEQ ID No. 1, setting up control cells transfected with negative control siRNA) and lncRNA CCTT knockout HeLa cells prepared in Example 2 (setting up lncRNA CCTT wild type control cells).

[0129] 1. According to different cell types, the appropriate density of cells is inoculated in a 24-well plate, cultured at 37℃ and 5% CO2 concentration, and the initial cell number (0d) is recorded.

[0130] 2. At appropriate time points (such as 1d, 2d, 3d, etc.), the cell number of the control group and the experimental group is recorded by a cell counter.

[0131] 3. According to the cell number at each time point, a cell growth curve is drawn, and three independent repeated experiments are performed for statistical analysis.

[0132] Cell growth curve analysis shows that knockdown / knockout of lncRNA CCTT leads to cell growth arrest. Figure 3 ).

[0133] Example 4, Knockdown of lncRNA CCTT leads to tumor cell cycle arrest

[0134] Test cells: lncRNA CCTT knockdown A549 cells prepared in Example 1 (introducing siRNA shown in SEQ ID No. 1, setting control cells transfected with negative control siRNA).

[0135] The proportion of cells in G0 / G1, S, and G2 / M phases is analyzed by PI single staining flow cytometry. The specific operation is as follows:

[0136] 1. Prepare lncRNA CCTT knockdown A549 cells, and use corresponding NC siRNA transfected cells as controls. After 48h, 0.25% trypsin digestion;

[0137] 2. Wash with 1xPBS for three times, resuspend as a single cell suspension, and adjust the density to 5x10 6 / ml;

[0138] 3. Centrifuge and discard the supernatant, add pre-cooled ethanol, and incubate at 4℃ overnight;

[0139] 4. Centrifuge and discard the ethanol, and wash with 1xPBS;

[0140] 5. Add RNAse, and incubate at 37℃ for 30min;

[0141] 6. Add PI staining solution, and incubate at 4℃ in the dark for 30min;

[0142] 7. Detect on a flow cytometry analyzer, and analyze the proportion of cells in G0 / G1, S, and G2 / M phases;

[0143] 8. Repeat the experiment three times, and perform statistical analysis.

[0144] The results show that: flow analysis confirmed that knocking down lncRNA CCTT caused the proportion of G0 / G1 phase cells to rise from 78.0% to 87.1%, while the proportion of S phase cells decreased from 18.0% to 9.7%, indicating that knocking down lncRNA CCTT inhibited cell proliferation Figure 4 ).

[0145] Example 5, LncRNA CCTT knockdown inhibits tumor cell colony formation

[0146] Test cells: lncRNA CCTT stably transfected knockdown A549 cells prepared in Example 1 (using empty virus infected cells as control cells) and lncRNA CCTT knockout HeLa cells prepared in Example 2.

[0147] 1. Take the logarithmic growth period of each group of cells, trypsinize and blow into single cells, centrifuge, and resuspend with serum-containing medium.

[0148] 2. Count the cells, and inoculate 50, 100, and 200 cells per dish in a gradient into 10 cm culture dishes to disperse the cells evenly, and place them in a 37°C, 5% CO2 concentration for 2-3 weeks.

[0149] 3. Observe regularly and change the liquid, when visible colonies appear in the culture dish, terminate the culture. Discard the supernatant and wash twice with PBS. Add 4% paraformaldehyde to fix the cells, and incubate at room temperature for 15 min.

[0150] 4. Discard the fixing solution, add an appropriate amount of crystal violet staining solution and incubate at room temperature for 20 min, then wash off the staining solution with running water slowly, and air dry.

[0151] 5. Invert the plate, count the number of colonies in each group, and calculate the colony formation rate = (number of colonies / number of inoculated cells) x 100%.

[0152] The results show that: using plate colony formation experiment to investigate the long-term effect of lncRNA CCTT on cell proliferation. After 3 weeks of single cell inoculation, the number of colonies of lncRNA CCTT knockdown A549 cells was 38.4% lower than that of control cells, confirming that lncRNA CCTT promotes long-term proliferation of A549 cells Figure 5 ).

[0153] Example 6, LncRNA CCTT knockdown reduces the tumor-forming ability of tumor cells in nude mice

[0154] Test cells: lncRNA CCTT stably transfected knockdown A549 cells prepared in Example 1 (using empty virus infected cells as control cells).

[0155] 1. Prepare 6-8 weeks old BALB / c male nude mice (Vivianlihua Company) and raise them in SPF level animal room.

[0156] 2. Culture stable cell lines (i.e. test cells) in 15 cm dishes, including control and experimental groups, to the appropriate density.

[0157] 3. Digest the cells and resuspend them in 1x PBS to make a 1x10 7 / ml density suspension.

[0158] 4. Use a pre-cooled gun head to suck 100 μl of cell suspension and add 100 μl of Matrigel dilution, mix well.

[0159] 5. Anesthetize the nude mice and place them on the operating table. Inject the control and experimental cell suspensions into the nude mice subcutaneously on the left and right sides of the back with a microsyringe. See the bulge and prevent the liquid from flowing out.

[0160] 6. Observe the state of the nude mice: within 1 week of inoculation, the bulge is absorbed, and 2-3 weeks of tumor formation, measure the tumor diameter regularly.

[0161] 7. Sacrifice the nude mice at the appropriate time point (poor state or tumor diameter reaches 1 cm), dissect and observe the size of the tumor, and take pictures.

[0162] The results show that after 3 weeks of inoculation, the volume and mass of the tumor formed by lncRNA CCTT knockdown cells are significantly smaller than those of control cells, which confirms that lncRNA CCTT promotes tumor growth in vivo. Figure 6 ).

[0163] Example 7, LncRNA CCTT knockdown inhibits tumor growth in vivo

[0164] Inoculate 5x10 5 human lung cancer cells H1299 into the left and right sides of the back of BALB / c nude mice symmetrically, and about 1 week later, when the tumor masses on both sides are formed and uniform in size, inject siRNA targeting lncRNA CCTT (SEQ ID No. 1) and negative control siRNA (RiboBio, item number: siN0000002-1-5) into the tumor bodies in situ on both sides. 15 pmols / time, inject every 1 day, for a total of 5 times. During this period, continuously measure the tumor diameter, and when the tumor diameter reaches 1 cm, take the material.

[0165] The results show that knocking down lncRNA CCTT significantly inhibits tumor growth in vivo, indicating that lncRNA CCTT is a potential target for targeted inhibition of lung cancer. Figure 7 ).

[0166] Example 8, Analysis of lung cancer clinical survival curve

[0167] The expression level of lncRNA CCTT in tumor and paracancerous tissue of lung cancer patients was obtained from TCGA database (n=378), and survival curve analysis was performed by Cox proportional hazards model, and statistical difference was analyzed by Logrank test.

[0168] The results show that: the analysis of lncRNA CCTT expression level and prognosis of lung cancer patients in TCGA database shows that the prognosis of patients with high expression of lncRNA CCTT is poor. Figure 8 ).

[0169] Example 9, LncRNA CCTT high expression and a variety of tumor adverse prognosis positive correlation

[0170] The correlation between the prognosis of 26 tumor patients (more than 50 cases) and the expression level of lncRNA CCTT was analyzed by Cox proportional hazards model. Statistical difference was analyzed by Logrank test.

[0171] The results show that: in 26 tumor types, about 2 / 3 show that high expression of lncRNA CCTT (the expression level of lncRNA CCTT in tumor is relatively higher than that in paracancerous tissue) is positively correlated with poor prognosis ( Figure 9 ), which suggests that targeting lncRNA CCTT has potential clinical significance.

[0172] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims. <110> Academy of Military Medical Sciences, Chinese PLA; Institute of Biophysics, Chinese Academy of Sciences <120> Application of knockdown or knockout of long non-coding RNA CCTT in inhibition of tumor growth <130> GNCLN212031 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> RNA <213> Artificial sequence <400> 1 ccagaugucu ucagcucca 19 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 gctaccagaa gggagcacca 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 ccagatgtct tcagctccaa 20 <210> 4 <211> 53 <212> DNA <213> Artificial sequence <400> 4 ccagatgtct tcagctccat tcaagagaac ctcgacttct gtagaccttt ttt 53 <210> 5 <211> 23 <212> DNA <213> Artificial sequence <400> 5 gatggggcta gcagaggcct tgg 23 <210> 6 <211> 23 <212> DNA <213> Artificial sequence <400> 6 ggctgccttc acccccacca agg 23 <210> 7 <211> 23 <212> DNA <213> Artificial sequence <400> 7 gggactcctg aatctaggag gag 23 <210> 8 <211> 730 <212> RNA <213> Artificial sequence <400> 8 cuuuuugagg cagcuaccag aagggagcac caagcagaug cagcuccccu ucccucccau 60 uccaccaucc acugucccca gcaagaaccu gcgggagggu ggcccaaugg ggagaaaacu 120 aaggauucgg uguugggacc acuccugccc ugaccugccc ugugacuccg ucauacucuc 180 caaaggccag acccuccuag accagcugga accaccauca agaugucccc agccauguca 240 gacucugggg ccccaggcgg agggcaacca gaugucuuca gcuccaaguc uggccucucc 300 ucccagcaag cagccaacug cagagaccuu ggaaaggauc aaccauauac aauguccauu 360 uccugcccuc uaaccuggca ggggagcaag gcccagccaa ggaguuacag aaacugaggc 420 uuggccaggc gugguggcuc acaccugcaa ucucagcacu gggaggccaa ggugggcaga 480 ucgcuugagc ccaggaguuu gagaccagcc cgaggaacau ggcgaaaccc caucucuaca 540 Aaaaaauacag aaauuagcca aguguggugg cacgugucug uaguuucagc uacucaggag 600 Gcuuaggugg gaggaucacc ugagccuggg agguagaggu ugcaaugagc agagauugcu 660 Cuccagccag ggagacagag ugagacccug ucccaaaaua aauaaauaaa uaagaauaaa 720 Auuaaaaaaa 730

Claims

1. A substance capable of inhibiting the expression of lncRNA CCTT for use in any one of the following: P1. The preparation of a drug for inhibiting the growth and / or proliferation of tumor cells; P2. The preparation of a drug for reducing the tumorigenicity of tumor cells; the lncRNA CCTT is the RNA as shown in SEQ ID No. 8; the tumor cells are lung cancer cells or cervical cancer cells; the substance capable of inhibiting the expression of lncRNA CCTT is an siRNA, an ASO, an shRNA targeting the lncRNA CCTT or a gene editing system for knocking out the DNA capable of transcribing the lncRNA CCTT; the siRNA targeting the lncRNA CCTT is as shown in SEQ ID No. 1; the ASO targeting the lncRNA CCTT is as shown in SEQ ID No. 2 or SEQ ID No. 3; the shRNA targeting the lncRNA CCTT is as shown in SEQ ID No. 4; the gene editing system for knocking out the DNA capable of transcribing the lncRNA CCTT is a CRISPR / Cas9 system comprising a gRNA, the target sequence of the gRNA being SEQ ID No. 5 or SEQ ID No. 6 or SEQ ID No.

7.

2. A substance capable of inhibiting the expression of lncRNA CCTT for use in the preparation of a drug for inhibiting the growth of a tumor; the lncRNA CCTT is the RNA as shown in SEQ ID No. 8; the tumor is lung cancer or cervical cancer; the substance capable of inhibiting the expression of lncRNA CCTT is an siRNA, an ASO, an shRNA targeting the lncRNA CCTT or a gene editing system for knocking out the DNA capable of transcribing the lncRNA CCTT; the siRNA targeting the lncRNA CCTT is as shown in SEQ ID No. 1; the ASO targeting the lncRNA CCTT is as shown in SEQ ID No. 2 or SEQ ID No. 3; the shRNA targeting the lncRNA CCTT is as shown in SEQ ID No. 4; the gene editing system for knocking out the DNA capable of transcribing the lncRNA CCTT is a CRISPR / Cas9 system comprising a gRNA, the target sequence of the gRNA being SEQ ID No. 5 or SEQ ID No. 6 or SEQ ID No.

7.

3. Use according to claim 1 or 2, characterized in that: the lung cancer cells are lung adenocarcinoma cells; the lung cancer is lung adenocarcinoma.

4. Use according to claim 1, characterized in that: the lung cancer cells are A549 cells or H1299 cells; the cervical cancer cells are HeLa cells.

Images