A method for synthesizing a bose-einstein condensate

Abstract

The application relates to a synthesis method of a Bose factor, which comprises the following process steps: step (1): mixing xylose, acetylacetone and an alkaline substance in a solvent and heating to react to obtain a first intermediate product crude product; step (2): mixing potassium phosphate buffer, the first intermediate product crude product obtained in step (1), a KRED2935 crude enzyme solution, glucose dehydrogenase, glucose and beta-nicotinamide adenine dinucleotide phosphate monosodium salt, and converting at 25-35 DEG C for 1-2 h; after the conversion is completed, adding ethyl acetate to terminate the reaction, extracting, combining the organic phases, adding anhydrous sodium sulfate to dry, and then removing the solvent under reduced pressure through rotary evaporation to obtain the Bose factor. The application can obtain the Bose factor with high stereoselectivity, the conversion rate is high, the obtained product is easy to separate, and the problems of low stereoselectivity and difficult process amplification production in the prior art are overcome.

Description

Technical Field

[0001] This invention relates to a method for synthesizing bosine. Background Technology

[0002] Pro-Xylane™, chemically known as hydroxypropyltetrahydropyranotriol, is a xylose derivative with anti-aging activity, commonly used in cosmetics. Discovered by L'Oréal over many years, Pro-Xylane is a xylose derivative with cosmetic and anti-wrinkle effects, derived from xylose and possessing broad biological activity. Pro-Xylane can directly affect the extracellular matrix in the three layers of the skin, activating or promoting the synthesis of glucosamines (GAGs) in the skin, improving the adhesion between the dermis and epidermis, promoting the regeneration of damaged tissue, and helping to maintain the elasticity of the dermis. It effectively keeps the skin firm and smooth, delaying skin aging.

[0003] Analysis of L'Oréal's published papers and patent applications reveals that the preparation of Bosein involves two steps. Step 1 uses D-xylose as a raw material, sodium bicarbonate as a base, and water as a solvent. The reaction is carried out at 90°C with stirring for 6 hours, resulting in the condensation, cyclization, and subsequent cleavage of acetylacetone and xylose, yielding β-acetone xyloside in high yield. Step 2 involves the reduction of β-acetone xyloside using sodium borohydride to obtain Bosein. The selective reduction of β-acetone xyloside is a significant challenge. Traditional chemical methods for reducing the ketone carbonyl group exhibit poor stereoselectivity, yielding a pair of diastereomers that are difficult to separate. Furthermore, using sodium borohydride or lithium borohydride as reducing agents to reduce the ketone carbonyl group in β-acetone xyloside produces a large amount of boric acid as a byproduct. Boric acid readily binds to the polyhydroxyl-containing Bosein hinge, requiring purification by column chromatography, making mass production difficult. Moreover, these reducing agents are hazardous and introduce substantial amounts of pollutants. If other homogeneous metal catalysts are used, it will inevitably increase the metal residue in the product, and the product will also be difficult to purify. Summary of the Invention

[0004] The purpose of this invention is to provide a method for synthesizing bosine, which utilizes a reductase to stereospecifically reduce β-acetone xyloside to obtain bosine with high conversion rate, mild reaction, and suitability for industrial-scale production.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] A method for synthesizing bosonicine, comprising the following process steps:

[0007] Step (1): Xylose, acetylacetone and alkaline substances are mixed in a solvent and heated to react, and the crude first intermediate product is obtained. Step (2): Potassium phosphate buffer, the crude first intermediate product obtained in step (1), crude reductase KRED2935 enzyme solution, glucose dehydrogenase, glucose and reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) are mixed and converted at 25-35℃ for 1-2 hours. During the reaction, 10% NaOH aqueous solution is added every 30 minutes to adjust the pH of the system to 8.0. After the conversion is completed, ethyl acetate is added to terminate the reaction, the organic phases are extracted, anhydrous sodium sulfate is added to dry, and then the solvent is removed by rotary evaporation under reduced pressure to obtain the Bosein.

[0008] In step (1), the reaction temperature is 60-70℃ and the reaction time is 18-20h. After the heating reaction is completed, the pH value of the reaction solution is adjusted to neutral with 4N HCl, the solvent is removed, and the crude first intermediate product is obtained.

[0009] The solvent mentioned in step (1) is methanol.

[0010] The alkaline substance is one or a mixture of several of sodium bicarbonate, potassium bicarbonate, sodium carbonate, and potassium carbonate.

[0011] The alkaline substance is sodium carbonate, and the molar ratio of xylose to sodium carbonate is 1:1.2~2.

[0012] The molar ratio of xylose to acetylacetone is 1:1.2~1.5.

[0013] The specific method of step (2) is as follows: 20g of the crude first intermediate product obtained in step (1), 10g of crude reductase KRED2935 enzyme solution, 5000U glucose dehydrogenase, 30g of glucose, and 2.0g of reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) were added sequentially to 1L 0.1M, pH 8.0 potassium phosphate buffer. The reaction was carried out at 28℃ for 1.5h. During the reaction, 10% NaOH aqueous solution was added every 30min to adjust the pH of the system to 8.0. After the conversion was completed, ethyl acetate was added to terminate the reaction, the organic phases were extracted, and the organic phases were combined. Anhydrous sodium sulfate was added for drying, and then the solvent was removed by rotary evaporation under reduced pressure to obtain the Bosein.

[0014] The synthetic route of this method is as follows:

[0015]

[0016] Compared with the prior art, the advantages of the present invention are as follows:

[0017] 1. This invention uses reductase KRED2935 to reduce the first intermediate product, β-acetone xyloside, to obtain bosine with high stereoselectivity and high conversion rate and efficiency. 20g of crude β-acetone xyloside can be completely converted within 1.5h. The obtained product is easy to separate, overcoming the problems of low stereoselectivity and difficulty in scaling up existing processes.

[0018] 2. Furthermore, by utilizing the reductase KRED2935, and with the action of glucose dehydrogenase, glucose, and reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH), the entire reaction can efficiently prepare Bosein without the need for additional reducing agents, thus reducing production costs. Moreover, the entire reaction is mild, using almost no highly polluting or hazardous reagents, making it suitable for the industrial-scale production of Bosein. Detailed Implementation

[0019] The present invention will be described in detail below with reference to embodiments:

[0020] Example 1: Preparation of β-acetone xyloside (i.e., the first intermediate product):

[0021] Add 180 mL of methanol, 38.16 g (0.36 mol) of sodium carbonate, and 30 g of xylose to the reaction flask in sequence.

[0022] 0.2 mol of acetylacetone (26 g, 0.24 mol) was reacted at 65 °C for 20 hours. The pH was adjusted to 7 with 4 N HCl, and the mixture was evaporated to dryness to obtain the crude first intermediate product, β-acetone xyloside. MS (ESI): m / z: 191.11 [M+H] + .

[0023] Example 2: Preparation of Bosein:

[0024] The specific method for step (2) is as follows: 20g of the crude first intermediate product obtained in step (1), 10g of crude reductase KRED2935 enzyme solution, 5000U of glucose dehydrogenase, 30g of glucose, and 2.0g of reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) were added sequentially to 1L of 0.1M, pH 8.0 potassium phosphate buffer. The mixture was converted at 28℃ for 1.5h. During the reaction, 10% NaOH aqueous solution was added every 30min to adjust the pH of the system to 8.0. After the conversion was completed, ethyl acetate was added to terminate the reaction. The mixture was extracted, the organic phases were combined, and anhydrous sodium sulfate was added for drying. The solvent was then removed by rotary evaporation under reduced pressure to obtain 18.5g of the bosine. MS (ESI): m / z: 193.03 [M+H] +Referring to traditional conversion rate detection methods and product ee value determination methods, it was found that the reaction could completely convert 20g of crude β-acetone xyloside within 1.5h, and the product's ee value was greater than 99.9%.

[0025] The gene sequence and amino acid sequence of the reductase KRED2935 are as follows:

[0026] Gene sequence of reductase KRED2935:

[0027] ATGAACAGAAAAAATGAATATGCGCTGGTTACGGGAGCAACCAGCGGGATCGGCTATGAACTTGCAAAACAGTTTGCAAGCAACGGATATGATCTTGTGATGGTTGCCCGCAATCATGATGAGCTGAAAACAAGAGCCGATGAATTTAAA AGTTTCGGCA TTAATGTAAT TACCATCGCTAAAAATCTTT TTATTGAAGA AGACGCCTATTCTTTATATTCTGAATTAAAATTAAACGGTATCAGTCCTTCAATCCTTGTGAACGATGCAGGGCAGGGCGTTTATGGAAAATTTCAGGATACGGATCTGCACCGTGAAGTAGATATTGTTAATCTGAATATCGTTTCTGTCCTTATTTTGACCAAAATGTTTTTGAAAGACCGCTTACCGAAAGGTTCCGGAAAGATCCTGAATCTGGCTTCTATTGCAAGTAAGGCTCCGGGTCCGTGGCATTCGGTGTATCATGGGACCAAAGCATTTGTTTTATCTTGGTCGGAAGCCATTAGAGAAGAATTGAAAGATACCGGAATTACAGTAACAGCCTTATTAC CCGGGCCTAC GGATACGGATTTCTTCAATAAAGCAGATATGAATGAAAGTAAGATCCTGGAAGATAAGGACAATCTTGCATCACCGGAAGAAGTAGCTATTGATGGTTTTAATGCCTTAATGAATGGTGATGACAAAGTAGTTTCGGGATTAAAAAATAAACTCACCGTAGCCATGTCGAATATTGCAACAGACAGCATGGCCGCACACA GAATGGGAGA AATGCAAAAACCGGTCAATG AAAAATAG (SEQ ID NO.1).

[0028] Amino acid sequence of reductase KRED2935:

[0029] Met Asn Arg Lys Asn Glu Tyr Ala Leu Val Thr Gly Ala Thr Ser Gly IleGly Tyr Glu Leu Ala Lys Gln Phe Ala Ser Asn Gly Tyr Asp Leu Val Met Val AlaArg Asn His Asp Glu Leu Lys Thr Arg Ala Asp Glu Phe Lys Ser Phe Gly Ile AsnVal Ile Thr Ile Ala Lys Asn Leu Phe Ile Glu Glu Asp Ala Tyr Ser Leu Tyr SerGlu Leu Lys Leu Asn Gly Ile Ser Pro Ser Ile Leu Val Asn Asp Ala Gly Gln GlyVal Tyr Gly Lys Phe Gln Asp Thr Asp Leu His Arg Glu Val Asp Ile Val Asn LeuAsn Ile Val Ser Val Leu Ile Leu Thr Lys Met Phe Leu Lys Asp Arg Leu Pro LysGly Ser Gly Lys Ile Leu Asn Leu Ala Ser Ile Ala Ser Lys Ala Pro Gly Pro TrpHis Ser Val Tyr His Gly Thr Lys Ala Phe

[0030] Val Leu Ser Trp Ser Glu Ala Ile Arg Glu Glu Leu Lys Asp Thr Gly IleThr Val Thr Ala Leu Leu Pro Gly Pro Thr Asp Thr Asp Phe Phe Asn Lys Ala AspMet Asn Glu Ser Lys Ile Leu Glu Asp Lys Asp Asn Leu Ala Ser Pro Glu Glu ValAla Ile Asp Gly Phe Asn Ala Leu Met Asn Gly As Valp Asp Lys Val Ser Gly LeuLys Asn Lys Leu Thr Val Ala Met Ser Asn Ile Ala Thr Asp Ser Met Ala Ala HisArg Met Gly Glu Met Gln Lys Pro Val Asn Glu Lys (SEQ ID NO. 2).

[0031] The corresponding sequence of reductase KRED2935 was synthesized by a gene synthesis company, and an E. coli expression system was constructed using conventional techniques. Overexpression of reductase KRED2935 was obtained in wet cells. Fresh reductase KRED2935 cells were resuspended in potassium phosphate buffer (0.1M, pH 8.0), homogenized, and centrifuged at 15000 rpm for 30 min at 4°C. The resulting supernatant was the crude reductase KRED2935 enzyme solution.

[0032] Example 3: Comparative Experiment:

[0033] The inventors of this invention also attempted to reduce the crude first intermediate product using other reductases to prepare bosine. Examples include reductases ChKRED20 (NCBI accession number: KC342020), ChKRED07 (NCBI accession number: KC342007), and ChKRED03 (NCBI accession number: KC342003).

[0034] The inventors commissioned a gene synthesis company to synthesize the sequences corresponding to the aforementioned enzymes, and constructed an E. coli expression system using conventional techniques. After quantitative expression, wet cells overexpressing the corresponding enzymes were obtained. Then, the corresponding bacterial cells were used to prepare crude reductase solutions. The crude reductase solutions were then used to reduce the first intermediate product, as described in Example 2.

[0035] 20g of the crude first intermediate product prepared as described in Example 1, 10g of crude reductase solution, 4000U of glucose dehydrogenase, 50g of glucose, and 2.0g of reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) were added sequentially to 1L of 0.1M pH 8.0 potassium phosphate buffer. The reaction was carried out at 28℃ for 1.5h. During the reaction, 10% NaOH aqueous solution was added every 30min to adjust the pH of the system to 8.0. After the conversion was completed, ethyl acetate was added to terminate the reaction, and the organic phases were extracted and combined. The organic phases were dried with anhydrous sodium sulfate, and then the solvent was removed by rotary evaporation under reduced pressure. Isopropanol (HPLC grade) was added to dissolve the corresponding product. After high-speed centrifugation, the conversion rate and ee value of the product were determined by HPLC. The conversion rate and ee value are shown in Table 1 below.

[0036] Table 1

[0037]

[0038] The data above show that all the aforementioned reductases can reduce the first intermediate to BOXO, but the conversion efficiency and stereoselectivity of each reductase vary significantly. Among them, reductase KRED2935 exhibits the highest stereoselectivity and conversion rate, making it effective for BOXO preparation and overcoming the problems of low stereoselectivity and difficulty in scaling up existing processes. The inventors also conducted similar tests on other enzymes besides reductases ChKRED20 (NCBI accession number: KC342020), ChKRED07 (NCBI accession number: KC342007), and ChKRED03 (NCBI accession number: KC342003), but the results were not as good as those of reductase KRED2935. Therefore, reductase KRED2935 shows promise as a highly efficient reductase in BOXO preparation, enabling large-scale production of BOXO.

[0039] Furthermore, by utilizing the reductase KRED2935, and with the aid of glucose dehydrogenase, glucose, and reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH), the entire reaction can efficiently prepare Bosein without the need for additional reducing agents, thus reducing production costs. Moreover, the entire reaction is mild, using almost no highly polluting or hazardous reagents, making it suitable for the industrial production of Bosein.

[0040] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method for synthesizing bosonicine, characterized in that: It includes the following process steps: Step (1): Xylose, acetylacetone, and alkaline substances are mixed in a solvent and heated to react, yielding the first intermediate crude product, namely crude β-acetone xyloside; Step (2): Potassium phosphate buffer, the first intermediate crude product obtained in step (1), crude reductase KRED2935 enzyme solution, glucose dehydrogenase, glucose, and reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) are mixed and converted at 25-35℃ for 1-2 hours. During the reaction, 10% NaOH aqueous solution is added every 30 minutes to adjust the pH of the system to 8.

0. After the conversion is completed, ethyl acetate is added to terminate the reaction, and the organic phases are extracted, combined, dried with anhydrous sodium sulfate, and then the solvent is removed by rotary evaporation under reduced pressure to obtain the bosine; The amino acid sequence of the reductase KRED2935 is shown in SEQ ID NO.

2.

2. The method for synthesizing Bosein according to claim 1, characterized in that: The reaction temperature in step (1) is 60-70℃ and the reaction time is 18-20h. After the heating reaction is completed, the pH value of the reaction solution is adjusted to neutral with 4N HCl, the solvent is removed, and the crude first intermediate product is obtained.

3. The method for synthesizing Bosein according to claim 1, characterized in that: The solvent mentioned in step (1) is methanol.

4. The method for synthesizing Bosein according to claim 1, characterized in that: The alkaline substance is one or a mixture of several of sodium bicarbonate, potassium bicarbonate, sodium carbonate, and potassium carbonate.

5. The method for synthesizing Bosein according to claim 4, characterized in that: The alkaline substance is sodium carbonate, and the molar ratio of xylose to sodium carbonate is 1:1.2~2.

6. The method for synthesizing Bosein according to claim 1, characterized in that: The molar ratio of xylose to acetylacetone is 1:1.2~1.

5.

7. The method for synthesizing Bosein according to claim 1, characterized in that: The specific method of step (2) is as follows: 20g of the crude first intermediate product obtained in step (1), 10g of crude reductase KRED2935 enzyme solution, 5000U glucose dehydrogenase, 30g of glucose, and 2.0g of reduced β-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) are added sequentially to 1L 0.1M, pH 8.0 potassium phosphate buffer. The reaction is carried out at 28℃ for 1.5h. During the reaction, 10% NaOH aqueous solution is added every 30min to adjust the pH of the system to 8.

0. After the conversion is completed, ethyl acetate is added to terminate the reaction, the organic phases are extracted, combined, dried with anhydrous sodium sulfate, and then the solvent is removed by rotary evaporation under reduced pressure to obtain the Bosein.

Images