Molecular markers closely linked to wheat thousand kernel weight gene qtl and its application
By developing the tightly linked molecular marker KaspAX-108927771 for the QTGW.haust-1A gene on wheat chromosome 1A, the problem of inaccurate selection of QTL markers for wheat thousand-grain weight was solved, achieving efficient molecular marker-assisted breeding and improving breeding efficiency.
Patent Information
- Application Number
- CN202211097720.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-08
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2042-09-08
AI Technical Summary
In existing technologies, QTL markers related to the thousand-grain weight of wheat are too far from the genes, resulting in inaccurate selection and a lack of universality. The complex genome structure of common wheat limits the application of QTLs in breeding.
A tightly linked molecular marker, KaspAX-108927771, for the QTGW.haust-1A gene on wheat chromosome 1A was developed and converted into a KASP marker. PCR amplification was performed using primers A, B, and C, and genotyping was conducted using a fluorescent multi-microplate reader and Klustercaller v3.4 software.
Stable identification of the thousand-grain weight trait under multiple environmental conditions was achieved, explaining 26.27-29.64% of phenotypic variation, providing an accurate selection method for molecular marker-assisted breeding.
Smart Images

Figure CN115747366B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to identification of a new wheat thousand grain weight gene QTL (Quantitative Trait Locus) and a linked KASP (Kompetitive Allele-Specific PCR) marker. BACKGROUND
[0002] Wheat is one of the most important crops in the world. Improving thousand grain weight (TGW) is an important goal of wheat breeding for high yield. Thousand grain weight is controlled by multiple microgenes and is easily affected by the environment. Therefore, exploring QTLs that are stable in the environment and developing economic and efficient molecular markers can reduce investment and improve breeding efficiency, which is of great significance for wheat yield improvement.
[0003] The broad-sense heritability of thousand grain weight is relatively large, and selection can be performed in early generations (Gao et al., 2015; Mcintyre et al., 2010). Many genetic studies have taken thousand grain weight and its constituent factors as the main research object. So far, more than 400 thousand grain weight QTLs and nearly 200 grain length and grain width QTLs have been found, distributed on 21 chromosomes. There are 10-37 grain weight QTLs, 2-15 grain length or grain width QTLs on each chromosome, and more grain weight QTLs (>30) on chromosomes 6A, 5B, 2B, 2D, 4B and 5A. Although many QTLs related to grain weight have been located, their application in breeding has rarely been reported. The main reasons are as follows: (1) the markers linked to QTLs are too far from the genes, and they cannot be accurately selected, so the markers are not universal and are only effective for materials related to the mapping population (Liu et al., 2012); (2) common wheat is an allohexaploid formed by multiple hybridizations, with ABD three subgenomes, and the genome is large and complex (Peng et al., 2011).
[0004] KASP markers have been widely used to detect SNP sites in wheat, rice and corn (Ertiro et al., 2015; Chandra et al., 2016; Steele et al., 2018), and do not require electrophoresis, enabling high-throughput genotyping. Using genotype data from wheat SNP chips for QTL mapping and genome-wide association analysis, the linked SNPs are converted into KASP markers (Liu et al., 2016; Rasheed, 2017; Jia 2018; Fu et al., 2020; Jiang et al., 2021), which can be directly applied to molecular marker-assisted selection breeding. SUMMARY
[0005] In order to solve the above problems, the present application aims to provide a molecular marker closely linked to the wheat thousand kernel weight gene QTL, a primer for amplifying the above-mentioned molecular marker, a kit containing the above-mentioned primer, a method for identifying the wheat thousand kernel weight trait genotyping, and the application of the above-mentioned molecular marker, primer, kit or method in molecular marker assisted breeding.
[0006] In order to achieve the above-mentioned purposes, the specific schemes adopted by the present application are as follows:
[0007] In the first aspect of the present application, a molecular marker closely linked to the wheat thousand kernel weight gene QTL is provided, the QTL is located on the wheat 1A chromosome, named QTGW.haust-1A, the flanking markers are 3950546 and 1213099, and the physical interval is 14.56-49.30 Mb;
[0008] The molecular marker is KaspAX-108927771, which is closely linked to QTGW.haust-1A.
[0009] The molecular marker KaspAX-108927771 is amplified by the primer pair as shown in SEQ ID NO: 01-03.
[0010] In the second aspect of the present application, a primer for amplifying the above-mentioned molecular marker is provided, which is a complete set of primers consisting of primer A, primer B and primer C.
[0011] The nucleotide sequence of the primer A is shown in SEQ ID NO: 01.
[0012] The nucleotide sequence of the primer B is shown in SEQ ID NO: 02.
[0013] The nucleotide sequence of the primer C is shown in SEQ ID NO: 03.
[0014] In the third aspect of the present application, a kit containing the above-mentioned primer is provided.
[0015] In the fourth aspect of the present application, a method for identifying the wheat thousand kernel weight trait genotyping is provided, which comprises the following steps:
[0016] Step one, extracting the DNA of the wheat to be identified;
[0017] Step two, using the DNA extracted in step one as a template, and performing PCR amplification by using the primers as shown in SEQ ID NO: 01-03.
[0018] Step three, the amplified product obtained in step two is placed in an automatic focusing fluorescence multifunctional enzyme label instrument to read fluorescence data, and then the data is imported into Klustercaller v3.4 software to genotype according to the fluorescence color.
[0019] In a fifth aspect, the application provides use of the molecular marker, the primer, the kit or the method described above in any one of the following:
[0020] (1) use in identifying or assisting in identifying the genotyping of the thousand-grain weight trait of wheat;
[0021] (2) use in molecular marker-assisted breeding.
[0022] Beneficial effects: in this study, 23536 probes covering the whole genome of wheat are used for DArT marker detection, and a QTL that is stable under multiple environmental conditions is detected by using the genetic map constructed by the molecular marker to analyze the QTL of the RIL population thousand-grain weight, which is located on the 1AL chromosome, and the flanking markers are 3950546 and 1213099, the physical interval is 14.56-49.30Mb; can explain 26.27-29.64% of the phenotypic variation, and is temporarily named as QTGW.haust-1A. The 660K chip of wheat is used to detect the Avocet and Chilero genotypes, AX-108927771 exists difference between parents, is located on the 1A chromosome 14.84Mb position, and is closely linked with QTGW.haust-1A, which is converted into KASP marker KaspAX-108927771, and can be used for molecular marker-assisted breeding. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 is the QTGW.haust-1A curve diagram positioned by the Avocet x Chilero RIL population;
[0024] Figure 2 is the KASP marker KaspAX-108927771 genotyping result diagram of 111 wheat varieties. DETAILED DESCRIPTION
[0025] The application relates to a new thousand-grain weight gene QTL and a molecular marker linked therewith, which can be used for molecular marker-assisted selection of the thousand-grain weight in breeding.
[0026] The application provides the KASP marker Kasp AX-108927771 for screening the closely linked QTL of the thousand-grain weight, and the sequence is shown in the primer sequence table (table 1).
[0027] Principle of KASP: three primers are needed for amplification, two forward competitive primers (the 5' end of the primer has base sequence complementary to fluorescent group HEX and FAM, other sequences only differ at the 3' end SNP and InDel) and one reverse common primer; the PCR reaction system contains a universal sequence modified by a fluorescent group and a quenching group (Master Mix is provided by LGC company), so the forward primer can specifically bind to the DNA with the same genotype, the two forward primers can emit two different colors of light, if the template strand is homozygous at this site, a single fluorescence matching it will be emitted, if it is heterozygous, two kinds of fluorescence can be emitted at the same time. KASP marker PCR amplification system, each 5 μl reaction system is as follows: 0.056 μl Primer Mix, 2.5 μl Master Mix, 2.2 μl Template DNA (50 ng / μl), 0.244 μl ddH2O, Master Mix is purchased from LGC company, the ratio of Primer Mix is: 12% HEX primer, 12% FAM primer, 30% Common primer, the primer is synthesized by Shanghai Yingjun company. Amplification uses 384-hole PCR instrument (BIO-RAD, S1000TM Thermal Cycler), the program is as follows: 94℃ 15min; 94℃ 20s, 63-55℃ 1min (decrease 1℃ for each cycle), 10 cycles; 94℃ 20s, 55℃ 60s, 32 cycles. The PCR amplification product is placed in an automatic focusing fluorescence multifunctional enzyme label instrument (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data is imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.
[0028] The method and the kit both belong to the protection scope of the present application.
[0029] The present application also protects a new wheat thousand grain weight gene QTL and its linked molecular marker, the QTL is named QTGW.haust-1A, located on 1A chromosome, the flanking markers are 3950546 and 1213099, the physical interval is 14.56-49.30 Mb; the closely linked SNP marker is AX-94557184 (see Figure 1 ), which can explain 26.27-29.64% of the phenotypic variation under the two detected environmental conditions. Specifically, the molecular marker can amplify the genomic DNA of Avocet and Chilero by the primer pair. The present application provides a new wheat thousand grain weight gene QTL marker, which can be used for molecular marker assisted screening of the thousand grain weight gene.
[0030] The molecular marker can be applied to the assisted selection of the wheat thousand-grain weight gene in wheat breeding.
[0031] The technical solutions of the present application will be described clearly and completely below in combination with the embodiments of the present application. The following embodiments facilitate better understanding of the present application, but do not limit the present application.
[0032] In the following examples, the experimental methods are all conventional methods unless otherwise specified. The test materials used in the following examples can be purchased from a conventional biochemical reagent store unless otherwise specified.
[0033] Example 1: Discovery of a thousand-grain weight gene QTL in wheat material Avocet and obtaining of a KASP marker thereof.
[0034] I. Obtaining of phenotypes
[0035] The recombinant inbred line (RIL) population containing 164 families was constructed by taking the wheat backbone parent Avocet of the International Maize and Wheat Improvement Center (CIMMYT) as the female parent and Chilero as the male parent. The test materials were provided by CIMMYT and Henan University of Science and Technology.
[0036] The Avocet x Chilero RIL population was planted in Luoyang, Henan in 2018-2019 and 2019-2020, using a completely randomized block design, three replicates, single row area, row length 1 m, row width 0.3 m, uniformly sowing 30 seeds per row, and conventional management. After maturation, the grains were harvested, and the SC-G automatic seed testing and thousand-grain weight analyzer of Wan Deep Company was used to measure the thousand-grain weight. The improved CTAB method (Murray et al., 1980) was used to extract the genomic DNA of the 164 families and the parents, the DNA concentration was determined by NanoDrop2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / ul, then the DNA quality was detected by 0.8% agarose gel, and the qualified DNA was subjected to SNP typing. The DArT markers of 262 families and parents were detected by using 23536 probes covering the whole genome of wheat developed by the Ravi P. Singh team of CIMMYT and the Triticarte Company Limited (Canberra, Australia, http: / / www.triticarte.com.au), and the SNP analysis of Avocet and Chilero was performed by using the 660K SNP chip completed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences and Affymetrix Axiom Company.
[0037] II. Construction of linkage map.
[0038] 23536 DArT markers covering 21 chromosomes of wheat were screened and deleted. First, the deletion was performed with a deletion rate of 10%, and then redundant markers were deleted using the bin function of IciMapping. Finally, 3290 markers were linked to the map.
[0039] III. QTL analysis.
[0040] QTL analysis was performed using IciMapping 4.1 ICIM-ADD method, and the LOD value was selected as 3.0. One stable QTL was located on chromosome 1A, which was named QTGW.haust-1A. Figure 1 The flanking markers were 3950546 and 1213099, and the physical interval was 14.56-49.30 Mb. Under different environmental conditions, it could explain 26.27-29.64% of the phenotypic variation (see Table 2, Figure 1 ). The AX-108927771 marker in the interval was transformed into KASP marker KaspAX-108927771, and the genotypes of 111 wheat varieties were detected. The KASP primer sequence for detecting the QTL QTGW.haust-1A of thousand-grain weight is shown in Table 1.
[0041] Table 1 KASP primer sequence table for detecting QTL QTGW.haust-1A of thousand-grain weight.
[0042]
[0043] Note: GAAGGTGACCAAGTTCATGCT A,
[0044] GAAGGTCGGAGTCAACGGATT B.
[0045] Table 2 Detection of QTGW.haust-1A in Avocet x Chilero RIL population by composite interval mapping method.
[0046]
[0047] IV. Utilization of primer pairs.
[0048] The experimental material was 111 wheat varieties, as shown in Table 3.
[0049] 1. All experimental materials were planted in Luoyang, Henan Province in the 2019-2020 and 2020-2021 academic years. A completely randomized block design with three replicates was adopted, using single-row plots with a row length of 1m and a row width of 0.3m. 30 seeds were evenly sown in each row, and conventional management was implemented. After maturity, the seeds were harvested, and the thousand-seed weight was measured using a Wanshen Company SC-G automatic seed testing and thousand-seed weight analyzer.
[0050] 2. All experimental materials were tested using the KaspAX-108927771 label.
[0051] The results are shown in Table 3 and Figure 2 Of the 111 wheat varieties, 85 showed the AA (Avocet) genotype, with thousand-grain weights of 37.7 g and 38.1 g, respectively; 26 varieties showed the GG (Chilero) genotype, with thousand-grain weights of 33.3 g and 33.7 g, respectively. Statistical tests showed that the gene effect of QTGW.haust-1A was significantly different (P<0.05).
[0052] Table 3 Genotyping results and thousand-grain weight of 111 wheat varieties.
[0053]
[0054]
[0055]
[0056] It should be noted that the above-described embodiments should be understood as illustrative, not as limiting the scope of protection of this invention. The scope of protection of this invention is defined by the claims. For those skilled in the art, some non-essential improvements and adjustments made to this invention without departing from the essence and scope of this invention still fall within the scope of protection of this invention.
Claims
1. Use of a molecular marker tightly linked to the wheat thousand kernel weight gene QTL in identifying or aiding in the identification of genotyping of the wheat thousand kernel weight trait, characterized in that: The QTL is located on the 1A chromosome of wheat, named QTGW.haust-1A , flanking markers are 3950546 and 1213099 , and the physical interval is 14.56-49.30 Mb; The molecular marker is KaspAX-108927771 closely linked to QTGW.haust-1A a marker. The molecular marker KaspAX-108927771 obtained by amplification with primers as shown in SEQ ID NO: 01-03.
2. A method for genotyping the wheat thousand kernel weight trait, characterized in that: comprising the following steps: Step one, extracting DNA of the wheat to be identified; Step two, using the DNA extracted in step one as a template, and using primers as shown in SEQ ID NO: 01-03 to perform PCR amplification; Step three, placing the amplification product obtained in step two in an automatic focusing fluorescent multifunctional enzyme label instrument to read fluorescence data, and then importing the data into Klustercaller v3.4 software to genotype according to fluorescence color.