A bacterial continuous evolution system, positive transaction error DNA polymerase and continuous evolution method

Abstract

The present invention relates to a bacterial continuous evolution system, an orthogonal DNA polymerase and a continuous evolution method. The present invention combines an orthogonal DNA replication system with an orthogonal DNA polymerase to obtain a continuous evolution method that can contain all mutation types, can achieve mutations in long DNA fragments, has good continuity and is easy to operate. By inducing the opening and closing of DNA polymerase expression, the switching between the linear plasmid error-prone mutation process and the high-fidelity replication process is achieved, thereby achieving efficient continuous evolution of the target DNA sequence.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a bacterial continuous evolution system, a positive transaction error DNA polymerase and a continuous evolution method. Background Art

[0002] Directed evolution technology realizes the development of new gene expression elements or efficient enzymes through library construction and high-throughput screening process, and it is currently widely used in the fields of enzyme engineering and metabolic engineering. However, the traditional directed evolution method needs to first construct an in vitro library, and this process not only has a low flux, but also often consumes a lot of time and cost. Therefore, a variety of continuous evolution methods have been developed to overcome this difficulty. The key to continuous evolution is that random mutations of the target DNA sequence in vivo can be achieved, which is not only easy to operate but also can greatly improve the throughput of the library. However, a continuous evolution method that meets the following four conditions has not yet been developed in bacteria, that is, all mutation types, long DNA fragment mutations can be achieved, good continuity and easy operation. The orthogonal DNA replication system previously developed in yeast can meet 4 key features, but it is still a huge challenge to develop such a system in bacteria. Therefore, in order to lay a foundation for the development of enzyme engineering, metabolic engineering and other fields, the present invention realizes a continuous evolution method based on orthogonal linear gene expression vectors in bacteria, i.e., Bacillus thuringiensis. Summary of the invention

[0003] To solve the above technical problems, the present invention provides a continuous evolution method for an orthogonal linear gene expression vector based on bacteria, which is a continuous evolution method obtained by combining an orthogonal DNA replication system with an orthogonal DNA polymerase and can meet four key characteristics, namely, it includes all mutation types, can realize mutation of long DNA fragments, has good continuity and is easy to operate, and is applied to the evolution of target DNA sequences.

[0004] The first object of the present invention is to provide a bacterial continuous evolution system, which comprises a linear plasmid and a DNA polymerase mutant; wherein,

[0005] The linear plasmid includes a DNA replication and control gene cluster, a promoter and a target gene, and the nucleotide sequence of the DNA replication and control gene cluster is shown in SEQ ID NO.6;

[0006] The DNA polymerase mutant is obtained by mutating the DNA polymerase whose amino acid sequence is shown in SEQ ID NO.1; the mutation is

[0007] Mutating the aspartic acid at position 18 to alanine and simultaneously mutating the aspartic acid at position 70 to alanine (D18A / D70A); or

[0008] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the tyrosine at position 442 is mutated to asparagine (D18A / D70A / Y442N); or

[0009] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the leucine at position 521 is mutated to serine (D18A / D70A / L521S); or

[0010] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the valine at position 191 is mutated to phenylalanine (D18A / D70A / V191F); or

[0011] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the valine at position 199 is mutated to phenylalanine (D18A / D70A / V199F); or

[0012] The aspartic acid at position 18 was mutated to alanine, the aspartic acid at position 70 was mutated to alanine, the leucine at position 403 was mutated to lysine, the methionine at position 404 was mutated to isoleucine, and the glutamine at position 405 was mutated to methionine (D18A / D70A / L403K / M404I / Q405M).

[0013] Specifically, the sequence of the DNA polymerase shown in SEQ ID NO.1 is as follows:

[0014] .

[0015] Furthermore, the linear plasmid also includes a resistance gene terminated prematurely by a stop codon, providing a method for determining the mutation rate of the linear plasmid vector. In one embodiment of the present invention, an expression cassette encoding an erythromycin resistance protein terminated prematurely by a stop codon "TAA" is selected, and its nucleotide sequence is shown in SEQ ID NO.2.

[0016] Furthermore, in one embodiment of the present invention, the linear plasmid includes a DNA replication and control gene cluster and an expression frame encoding an erythromycin resistance protein terminated prematurely by the termination codon "TAA", and its nucleotide sequence is shown in SEQ ID NO.3.

[0017] Furthermore, the linear plasmid also includes replication origins at both ends. Each element from the 5' end to the 3' end is a left replication origin, a DNA replication and control gene cluster, a promoter, a target gene and a right replication origin, wherein the nucleotide sequence of the left replication origin is shown in SEQ ID NO.7, and the nucleotide sequence of the right replication origin is shown in SEQ ID NO.8.

[0018] Specifically, the nucleotide sequence of the left replication origin is as follows:

[0019] attatgtacctctactagcctattaaaatatttacctattgacacgtaataacatttatgaaatatgatatac;

[0020] The nucleotide sequence of the right replication origin is as follows:

[0021] Tatatcgtgaaacatagatgtttatttgtgtcaatgggtaatattggtaaaagtgctagtagggatacataata.

[0022] Furthermore, the linear plasmid uses pBMB-ESC as a vector.

[0023] Furthermore, the linear plasmid vector is derived from the genome of the double-stranded linear DNA lysogenic phage GIL16.

[0024] Furthermore, the linear plasmid vector transformation adopts homologous recombination method.

[0025] Furthermore, the linear plasmid vector is replicated by GIL16 orthogonal DNA polymerase (the amino acid sequence of the wild-type polymerase is shown in SEQ ID NO.1), and its replication is orthogonal to the genome. The orthogonal means that the DNA polymerase that replicates the linear plasmid cannot replicate the genome, and the host's DNA polymerase cannot trigger the replication of the linear plasmid.

[0026] Furthermore, the promoter on the linear plasmid is any promoter suitable for the host cell, such as an inducible promoter. In one embodiment of the present invention, a xylose-inducible promoter is used, such as P xylA .

[0027] Furthermore, the xylose-inducible promoter P xylA The nucleotide sequence is shown in SEQ ID NO.9.

[0028] Furthermore, the DNA polymerase mutant is expressed by an inducible promoter. In one embodiment of the present invention, a xylose-inducible promoter is used, such as PxylA .

[0029] Furthermore, in one embodiment of the present invention, the DNA polymerase mutant uses pBMB as a vector.

[0030] The second object of the present invention is to provide a cell containing the above-mentioned bacterial continuous evolution system.

[0031] Furthermore, the bacteria are Bacillus thuringiensis, including but not limited to Bacillus thuringiensis HD-1 (GenBank No.: CP001903), Bacillus thuringiensis JW-1 (GenBank No.: CP045030), etc.

[0032] The third object of the present invention is to provide a DNA polymerase mutant with positive transaction error, wherein the DNA polymerase mutant is obtained by mutation of the DNA polymerase with the amino acid sequence as shown in SEQ ID NO.1; the mutation is

[0033] The aspartic acid at position 18 is mutated to alanine, and the aspartic acid at position 70 is mutated to alanine (D18A / D70A, M6); or

[0034] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the tyrosine at position 442 is mutated to asparagine (D18A / D70A / Y442N, M17); or

[0035] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the leucine at position 521 is mutated to serine (D18A / D70A / L521S, M18); or

[0036] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the valine at position 191 is mutated to phenylalanine (D18A / D70A / V191F, M19); or

[0037] The aspartic acid at position 18 is mutated to alanine, the aspartic acid at position 70 is mutated to alanine, and the valine at position 199 is mutated to phenylalanine (D18A / D70A / V199F, M20); or

[0038] The aspartic acid at position 18 was mutated to alanine, the aspartic acid at position 70 was mutated to alanine, the leucine at position 403 was mutated to lysine, the methionine at position 404 was mutated to isoleucine, and the glutamine at position 405 was mutated to methionine (D18A / D70A / L403K / M404I / Q405M, M21).

[0039] Preferably, the error-prone DNA polymerase comprises three mutations, D18A, D70A and Y442N (amino acid sequence is SEQ ID NO.4), and its mutation rate is 6.82 x 10 -7 Per base per cell per generation, the frequency of genome mutation is 6,700 times higher.

[0040] Furthermore, the error-prone DNA polymerase is obtained by AlphaFold2 structure prediction and rational design mutation.

[0041] The fourth object of the present invention is to provide a gene encoding the above-mentioned DNA polymerase mutant with positive transaction errors.

[0042] The fifth object of the present invention is to provide an expression vector carrying the gene encoding the above-mentioned DNA polymerase mutant with positive transaction errors.

[0043] The sixth object of the present invention is to provide a cell expressing the above-mentioned DNA polymerase mutant with positive transaction errors. The cell can be bacteria, fungi, plant cells or animal cells.

[0044] The seventh objective of the present invention is to provide the above-mentioned bacterial continuous evolution system, cells containing the above-mentioned bacterial continuous evolution system, DNA polymerase mutants, genes encoding DNA polymerase mutants, expression vectors carrying genes encoding DNA polymerase mutants, and cells expressing DNA polymerase mutants for use in food and biological fields, especially in bacterial continuous evolution and error-prone replication.

[0045] Furthermore, the application is to add an inducer in cell culture to achieve error-prone replication and random mutation of the target DNA sequence. The target DNA sequence includes but is not limited to: a promoter, a ribosome binding site and a methanol utilization gene cluster.

[0046] The eighth object of the present invention is to provide a continuous evolution method based on bacterial positive transaction error DNA polymerase, comprising the step of introducing the above linear plasmid and the above DNA polymerase mutant into cells (bacteria). DNA polymerase replicates the linear plasmid through positive transaction error in the cell to achieve the directed evolution application of random mutation library construction and high-throughput screening of target protein (encoded by target gene).

[0047] Furthermore, the DNA polymerase mutant is expressed by an inducible promoter, and then induced to express by adding an inducer in the culture conditions. In the evolution method of the present invention, by inducing the opening and closing of the expression of the DNA polymerase mutant, the switching between the linear plasmid error-prone mutation process and the high-fidelity replication process can be achieved, thereby achieving control of the continuous evolution process.

[0048] Furthermore, the concentration of the inducer is 0.01-100 g / L.

[0049] By means of the above scheme, the present invention has at least the following advantages:

[0050] The present invention achieves efficient continuous evolution of target DNA sequences by constructing a continuous evolution method based on bacterial orthogonal linear gene expression vectors. Its advantages include: including all mutation types, realizing mutation of long DNA fragments (theoretical mutation frame length is greater than the length of the phage genome, i.e., 15,000 bp), good continuity and simple operation. Among them, the DNA polymerase with positive transaction errors was obtained by rational design and mutation rate testing after the structure was predicted by AlphaFold2. The mutation rate of the optimal mutant reached 6.82x10 -7 Per base per cell per generation, it is 6,700 times the genome mutation frequency, and does not cause a significant increase in the genome mutation rate.

[0051] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0053] Figure 1 Conceptual diagram of the continuous evolution method based on orthogonal linear gene expression vectors. DETAILED DESCRIPTION

[0054] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0055] The materials and methods involved in the following embodiments are as follows:

[0056] Bacillus thuringiensis: Bacillus thuringiensis HD-1 (GenBank No.: CP001903).

[0057] The GenBank accession number of green fluorescent protein (GFP) is AF324408.1.

[0058] The culture medium was LB medium: culture medium (g / L): tryptone 10, yeast powder 5, NaCl 10.

[0059] SG buffer: Each L contains 93.1 g of sucrose and 150 mL of glycerol.

[0060] 0.1M PBS: contains K per 100mL 2 HPO 4 1.4g, KH 2 PO 4 0.52g.

[0061] 1M MgCl 2 : MgCl per 100mL 2 6H 2 O 20.33g.

[0062] EP buffer: Each L contains 1L SG buffer, 5mL 0.1M PBS, and 1.0M MgCl 2 500μL.

[0063] Method for determining the expression level of green fluorescent protein: 200 μL of diluted fermentation liquid was added to each well of a 96-well plate, and a Cytation3 cell imaging microplate reader (Berteng Instruments, Inc., USA) was used, with an excitation wavelength of 488 nm, an emission wavelength of 523 nm, and a gain of 60.

[0064] Example 1 Electrotransformation of Bacillus thuringiensis

[0065] Preparation of competent state: First, pick a single colony in 5mL LB medium and activate and culture at 30℃ overnight. Then transfer to fresh LB medium at 1 / 100 of the inoculation volume, culture at 30℃, 220r / min until OD600 is approximately equal to 1.0-1.3 (about 2h), then cool in an ice bath for 10-30min. The entire competent state preparation and transformation process should be carried out under low temperature conditions. After cooling, centrifuge the bacterial solution at 5000r / min, 4℃ for 5min, collect the bacteria, and discard the supernatant. Then wash the bacteria twice with pre-cooled EP buffer under the same conditions, wash the bacteria once with pre-cooled SG buffer, and finally resuspend the bacteria in SG buffer (add about 1.5mL) to make the competent state OD600 about 50-70; divide the competent state into 50μL / tube in centrifuge tubes and store at -80℃ for use, or divide it into 500μL / tube in centrifuge tubes and divide it into 500μL / tube for use.

[0066] Electroporation process: Take 1 tube of competent cells and place it on ice, add 3-5μL plasmid DNA (plasmid concentration is above 100ng / μL, E. coli JM110 must be used as the cloning host, otherwise the plasmid will be restricted and cut, resulting in transformation failure), shake slightly to mix, add to a 1mm pre-cooled electroporation cup after ice bath for 10-30min, and quickly add 500μL 37℃ preheated LB medium after 1.25kV electric shock; resume culture at 37℃, 220r / min for 2h, then spread on the resistance plate and culture in a 37℃ incubator overnight.

[0067] Example 2 DNA polymerase mutation rate determination host construction

[0068] First, the auxiliary plasmid pBMB-ESC (sequence is SEQ ID NO.5) was constructed to achieve efficient recombination of Bacillus thuringiensis HD-1. Specifically, on this plasmid, by using xylose to induce the expression of Exo (double-stranded DNA 5'-3' exonuclease), EcoSSB (single-stranded DNA binding protein from Escherichia coli) and CspRecT (DNA annealing protein) to achieve the formation of single-stranded DNA and efficient annealing of DNA fragments in the cell.

[0069] The linear plasmid integration frame was constructed by fusion PCR. First, a recombination frame with a homology arm length of 500-1000 bp was designed, taking a linear plasmid (nucleotide sequence such as SEQ ID NO.3) containing an expression frame encoding erythromycin resistance protein (nucleotide sequence such as SEQ ID NO.2) terminated prematurely by the stop codon "TAA" as an example. The specific operation was as follows: the left arm was amplified using primers HD-TE-1F: acggacagttgtgcaacaactacg and HD-TE-1R: gaaattgttatccgctccgtcacacgtgtgtcattttggac; the spectinomycin resistance protein expression cassette was amplified using primers HD-TE-2F: cacgtgtgacggagcggataacaatttcacacaggaaacagc and HD-TE-2R: gaacacgaactaacgccagggttttcccagtcacg; the spectinomycin resistance protein expression cassette was amplified using primers HD-TE-3F: ggaaaaccctggcgttagttcgtgttcgtgctgacttgc and HD-TE-3R: gcc agtttcgtcgttTaatgccctttacctgttccaatttcg was used to amplify the erythromycin antibiotic resistance protein expression cassette, and the primers HD-TE-4F: ggtaaagggcattAaacgacgaaactggctaaaataagtaaac and HD-TE-4R: gtagttatgcccagcgtgagtctagggacctctttagctccttgg were used to amplify the erythromycin antibiotic resistance protein expression cassette and introduce the TAA stop codon, and the primers HD-TE-5F: cctagactcacgctgggcataactactttgtg and HD-TE-5R: caattacggcttgtgcttcctctcg were used to amplify the right arm.

[0070] After the obtained DNA fragment is purified, the corresponding linear plasmid / genome integration operation is as follows: first, prepare the competent state of the strain containing the pBMB-ESC plasmid, add xylose with a final concentration of 3% when the bacterial solution OD600 is about 0.5, and continue to culture until the OD600 is about 1.0-1.3. The rest of the operations are the same as the electroporation plasmid. During electroporation, the DNA fragment needs to be relatively single, add 5 μL of DNA fragments with a concentration of more than 200 ng / μL, and then culture for 3 hours. The rest of the operations are the same as the electroporation plasmid, and the final DNA integration frame realizes the recombination editing of the prophage GIL16 genome, and constructs a linear plasmid containing an expression frame encoding erythromycin resistance protein terminated prematurely by the stop codon "TAA". Under the same conditions, strains containing a complete erythromycin resistance gene can grow under the condition of adding erythromycin, while strains containing an erythromycin resistance gene terminated prematurely by the TAA stop codon do not grow under the condition of adding chloramphenicol. In order to induce the expression of DNAP polymerase, GIL16 DNA polymerase was amplified using primers pDNAP-1F: tgTTAAAGGAGGAAGGATCCatgagtactactaatagaaaaaagcgtagagag and pDNAP-1R: gcatccttcaatccttataagaaacttaattcgcctaatagttctttcatgtcc, and the pBMB plasmid vector with a xylose-inducible promoter was amplified using primers pDNAP-2F: gtttcttataaggattgaaggatgcttaggaagacgag and HD-TE-2R: catGGATCCTTCCTCCTTTAAcatttccccctttgatttttagatatcactagtttgg, and then Gibson assembly was used to construct plasmid pBMB-ODNAP (SEQ ID NO.10).

[0071] Example 3 Determination of mutation rates of different orthogonal DNA polymerase mutants

[0072] Through rational design, 24 DNA polymerase mutants were initially obtained (Table 1, the amino acid sequence of GIL16 orthogonal DNA polymerase is shown in SEQ ID NO.1).

[0073] Table 1 Determination of mutation rates of different DNA polymerase mutants

[0074]

[0075]

[0076] Then, the recombinant Bacillus thuringiensis constructed in Example 2 was induced to express 24 mutants using the pBMB-ODNAP plasmid, induced by 5% xylose addition, cultured to saturated biomass after 1 / 1000 inoculation, and then diluted and coated on the plate to count the proportion of resistant colonies in the total cells. For each mutant, 17 parallels were set, and the final results were analyzed using the FALCOR tool (https: / / lianglab.brocku.ca / FALCOR / ) to calculate the final mutation rate μ (spb). The mutation rate was calculated by the formula μ (spb) = f / (R × C), where f is the result calculated by FALCOR, R is the unique mutation type that restores the erythromycin resistance gene, and C is the number of plasmid copies. It can be seen from sequencing that when TAA mutates to AAA / CAA / TTA / TAT / TAC, the strain can acquire erythromycin resistance, so R = 5 / 3. Finally, among the 24 mutants, M17 (amino acid sequence as shown in SEQ ID NO.4) had the highest mutation rate, reaching 6.82x10 -7 Per cell per base per generation.

[0077] The wild-type orthogonal DNA polymerase mutation rate determination includes the following steps: using 5% xylose to induce the expression of wild-type DNA polymerase in the cell, inoculating it at 1 / 1000, culturing it to saturated biomass, then diluting and coating it on a plate, and counting the proportion of resistant colonies in the total cells. The mutation frequency of the wild-type orthogonal DNA polymerase was determined to be 2.52x10 -9 Per cell per base per generation.

[0078] Example 4 Controlling the mutation rate and frequency of target DNA after adding different concentrations of xylose

[0079] The recombinant Bacillus thuringiensis containing the M17 mutant constructed in Example 3 was cultured in 700 μL LB medium and 96-well deep-well plate at 37°C, 750 rpm for 10 h to obtain seed solution, and then the seed solution was transferred into 200 μL LB medium containing different concentrations of xylose at an inoculum of 0.1%, so that the final xylose concentration in different wells was 0.00 g / L to 50 g / L, and 17 parallel controls were set for each concentration, and cultured at 37°C and 750 rpm for 24 h. Under the same conditions, the mutation rate of the control group without adding xylose was 2.59x10 -8 ; After adding 0.01, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 30, 50 g / L xylose, the average values ​​of mutation rate and mutation frequency data are shown in Table 2.

[0080] Table 2 Target DNA mutation rate and mutation frequency after adding different concentrations of xylose

[0081]

[0082] Comparative Example 1 Determination of strain genome mutation rate

[0083] The method for determining the genomic mutation rate is the same as that for determining the orthogonal DNA polymerase mutation rate, but xylose is not added, and the selected mutant gene is the genomic RpoB protein. When the genomic RpoB protein undergoes the following mutations, the strain will acquire rifampicin resistance: V135F (gtt-ttt), Q137R (cag-cgg), Q468R (cag-cgg), Q468K (cag-aag), Q468L (cag-ctg), H481D (cac-gac), H481P (cac-ccc), H481Y (cac-tac), H481R (cac-cgc), S486Y (tct-tat), S486F (tct-ttt), and L488S (tta-tca), therefore, R = 12 / 3. The strain seed solution was inoculated at 1 / 1000 and cultured to saturated biomass, then diluted and coated on the plate, and the proportion of resistant colonies in the total cells was counted. The final genome mutation frequency was measured to be 1.02x10 -10 Each cell, each base per generation. Therefore, it can be calculated that the mutation rate of positive transaction error DNA polymerase is 6700 times the mutation frequency of the genome.

[0084] In addition, the mutation rate of the recombinant Bacillus thuringiensis genome containing the M17 mutant constructed in Example 3 was determined by the same method, and the result was 1.45x10 -10 , significance analysis found that it did not cause a significant increase in the genome mutation rate.

[0085] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A bacterial continuous evolution system, Features: The bacterial continuous evolution system comprises a linear plasmid and a DNA polymerase mutant, and the bacterial continuous evolution system is used for Bacillus thuringiensis; wherein, The linear plasmid includes a DNA replication and control gene cluster, a promoter and a target gene, and the nucleotide sequence of the DNA replication and control gene cluster is shown in SEQ ID NO.6; The DNA polymerase mutant is obtained by mutating the DNA polymerase whose amino acid sequence is shown in SEQ ID NO.1; the mutation is Mutating the aspartic acid at position 18 to alanine and simultaneously mutating the aspartic acid at position 70 to alanine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the tyrosine at position 442 to asparagine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the leucine at position 521 to serine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the valine at position 191 to phenylalanine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the valine at position 199 to phenylalanine; or The aspartic acid at position 18 was mutated to alanine, the aspartic acid at position 70 was mutated to alanine, the leucine at position 403 was mutated to lysine, the methionine at position 404 was mutated to isoleucine, and the glutamine at position 405 was mutated to methionine.

2. The bacterial continuous evolution system according to claim 1, Features: The linear plasmid also includes a resistance gene terminated prematurely by a stop codon.

3. The bacterial continuous evolution system according to claim 1, Features: The DNA polymerase mutant is expressed under the control of an inducible promoter.

4. A cell comprising the bacterial continuous evolution system according to any one of claims 1 to 3, Features: The cell is Bacillus thuringiensis.

5. A DNA polymerase mutant with a positive transaction error, Features: The DNA polymerase mutant is obtained by mutating the DNA polymerase whose amino acid sequence is shown in SEQ ID NO.1; the mutation is Mutating the aspartic acid at position 18 to alanine and simultaneously mutating the aspartic acid at position 70 to alanine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the tyrosine at position 442 to asparagine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the leucine at position 521 to serine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the valine at position 191 to phenylalanine; or Mutating the aspartic acid at position 18 to alanine, the aspartic acid at position 70 to alanine, and the valine at position 199 to phenylalanine; or The aspartic acid at position 18 was mutated to alanine, the aspartic acid at position 70 was mutated to alanine, the leucine at position 403 was mutated to lysine, the methionine at position 404 was mutated to isoleucine, and the glutamine at position 405 was mutated to methionine.

6. A gene encoding the DNA polymerase mutant with positive transaction errors according to claim 5.

7. An expression vector carrying the gene according to claim 6.

8. A cell expressing the DNA polymerase mutant with positive transaction error according to claim 5.

9. Use of the bacterial continuous evolution system according to any one of claims 1 to 3, the cell according to claim 4, the DNA polymerase mutant with positive transaction errors according to claim 5, the gene according to claim 6, the expression vector according to claim 7 or the cell according to claim 8 in the continuous evolution or error-prone replication of Bacillus thuringiensis.

10. A continuous evolution method based on bacterial positive transaction DNA polymerase, It is characterized in that The method comprises the step of introducing the linear plasmid and the DNA polymerase mutant according to any one of claims 1 to 3 into Bacillus thuringiensis.

Images