A nucleic acid aptamer for detecting TSHR protein, derivatives and applications thereof

The nucleic acid aptamer YC6 screened by Cell-SELEX technology solves the problem of the lack of efficient and specific nucleic acid aptamers in the existing technology, achieves highly specific recognition and binding of TSHR protein, and provides a new diagnosis and treatment plan for thyroid diseases.

CN115786351BActive Publication Date: 2025-09-23THE EYE HOSPITAL OF WENZHOU MEDICAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211273364.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-18
Publication Date
2025-09-23
Estimated Expiration
2042-10-18

AI Technical Summary

Technical Problem

The existing technology lacks efficient, low-cost and highly specific nucleic acid aptamers for detecting and targeting thyroid-stimulating hormone receptor (TSHR) protein, and existing drugs have problems such as low affinity, short half-life and low bioavailability in the treatment of Graves' disease.

Method used

The nucleic acid aptamer YC6 with a unique stem-loop structure was screened through Cell-SELEX technology, and the TSHR plasmid was transfected into 293T cells using lentivirus to construct a high-expression model. This ensures that the aptamer specifically recognizes the TSHR protein, has strong binding affinity, is easy to modify and transform, and is non-cytotoxic. It is used to prepare targeted drug-loaded preparations and diagnose TSHR-related diseases.

Benefits of technology

It achieves highly specific recognition and binding to TSHR protein, provides new ideas for disease diagnosis and treatment, reduces production costs, improves affinity and stability, and is suitable for the diagnosis and treatment of thyroid diseases and thyroid-related eye diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786351B_ABST
    Figure CN115786351B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of molecular biology, and more particularly to nucleic acid aptamers, derivatives, and applications thereof for detecting TSHR protein. The present invention provides a nucleic acid aptamer for detecting TSHR protein, the nucleotide sequence of which is shown in SEQ NO. 1. The present invention provides a DNA aptamer YC6 with high affinity for TSHR protein, which has been validated at the molecular, cellular, and tissue levels. The present invention discovers that the DNA aptamer YC6 has the ability to recognize and target cells expressing thyrotropin receptors, providing new insights into the diagnosis and treatment of thyroid diseases and thyroid-related eye diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a nucleic acid aptamer for detecting TSHR protein, a derivative and an application thereof. Background Art

[0002] The thyrotropin receptor (TSH), acting as the receptor for thyroid-stimulating hormone (TSH), plays a central role in controlling thyroid cell metabolism. The activity of this receptor is mediated by G proteins, activating adenylate cyclase. Graves' disease (GD) is a common systemic autoimmune disease. Since the syndrome we now call GD was first described in medical literature in the early 19th century, the curious connection between an enlarged and overactive thyroid gland and inflammation and swelling of the connective tissue around the eye has puzzled the medical community. The relationship between the TSHR and GD was not recognized until Adams and Purves discovered a long-acting thyroid stimulant and demonstrated that it stimulated adenylate cyclase activity in the thyroid gland. These antibodies are now known as thyrotropin immunoglobulins (TSIs). Immune tolerance to the TSHR is lost through an as-yet-unidentified mechanism. This misidentification of the TSHR as "non-self" results in the production of TSIs that target the TSHR on thyroid epithelial cells.

[0003] Thyrotropin immunoglobulin (TSI) is directly involved in the pathogenesis of Graves' disease and hyperthyroidism, interacting with the thyroid gland's thyroid hormone receptor (TSHR) to induce uncontrolled receptor stimulation. The clinical hallmark of GD is abnormal growth and overactivity of the thyroid gland, resulting in pathologically high thyroid hormone levels. These levels enhance oxygen consumption and metabolism in target tissues. In addition to its effects on the thyroid gland, approximately 20% of patients with true GD experience ocular manifestations of the disease, termed thyroid-associated ophthalmopathy (TAO). TAO represents a process of connective tissue activation and remodeling that can lead to disfigurement and blindness. Within this process, TSI, which acts through the TSHR, locally expressed in perithyroid tissue, is associated with inflammation and dilatation within the orbit. Functional TSHR has been detected in orbital fat, extraocular muscles, and orbital fibroblasts. Therefore, there is strong evidence supporting a role for TSHR and TSI in thyroid overactivity and orbital pathology in GD. Furthermore, TSHR defects have been widely reported as a cause of thyroid tumors (papillary and follicular carcinomas). (Terry Smith (2017): TSHRas atherapeutic target in Graves' disease, Expert Opinion on Therapeutic Targets, DOI; 10.1080 / 14728222.2017.1288215).

[0004] Currently, there are 5C9 antibodies targeting thyrotropin receptor K1–70, but they have the disadvantages of high production cost, long cycle, poor batch stability, immunogenicity and high price; (TurcuAF, Kumar S, Neumann S, et al. A small molecule antagonist inhibits thyrotropin receptor antibody-induced orbital fibroblast functions involved in the pathogenesis of Graves ophthalmopathy. J Clin Endocrinol Metab. 2013; 98(5); 2153-2159.doi; 10.1210 / jc.2013-1149) small molecule compounds NCGC00229600 (ANTAG2) / NCGC00242364 (ANTAG3) / SMAS37a / b, but they have the disadvantages of low affinity (micromolar), short half-life (<3h) and low bioavailability (50%) (Marcinkowski P, Hoyer I, Specker E, et al. A New Highly Thyrotropin Receptor-Selective Small-Molecule Antagonist with Potential for the Treatment of Graves'Orbitopathy. Thyroid. 2019; 29(1); 111-123. doi; 10.1089 / thy.2018.0349).

[0005] Aptamers have the advantages of small size, strong specificity, high stability, low immunogenicity, ease of modification, and construction of targeted delivery, and have the potential to be used as targeted recognition and labeling for TSHR proteins. Aptamers are single-stranded DNA or RNA with a length of 20 to 100 nucleotides. They are obtained by systematic evolutionary selection of ligands using the SELEX method and can form three-dimensional structures that specifically bind to target molecules. The most notable characteristics of aptamers are as follows:

[0006] 1) First, aptamer-mediated molecular recognition is highly specific, enabling the discrimination of subtle molecular differences. Proof of concept was demonstrated by using aptamers to distinguish three distinct but closely related morphologically similar acute myeloid leukemia (AML) cell lines. This ability to accurately distinguish molecular features helps elucidate the molecular basis underlying pathogenesis.

[0007] 2) Cell-SELEX was developed to simulate the real environment of living cells. It can generate aptamers for any cell of interest without relying on prior knowledge of its molecular characteristics. Therefore, Cell-SELEX can be used to discover previously unknown biomarkers or their characteristics in pathogenesis that have not yet been recognized;

[0008] 3) Nucleic acid aptamers are easy to modify, which can enhance their in vivo stability. At the same time, they can be coupled with other drugs, molecules or nanoparticles. After binding to receptors on the cell membrane, they can mediate themselves or the coupled particles into the cell, making them an ideal targeted molecular tool for drug delivery.

[0009] However, there are no reports of thyrotropin receptor-specific aptamers. Summary of the Invention

[0010] The main purpose of the present invention is to overcome the shortcomings of existing technologies and provide a nucleic acid aptamer, derivatives and applications thereof for detecting TSHR protein, as well as the application of the nucleic acid aptamer used in the method to construct a preparation for recognizing the target protein TSHR and a targeted drug-loaded preparation. The aptamer is simple to prepare, low in cost, has good selectivity for thyrotropin receptor protein, strong binding force, high detection sensitivity, simple detection process operation and accurate results.

[0011] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0012] The present invention provides a nucleic acid aptamer for detecting TSHR protein. The nucleotide sequence of the nucleic acid aptamer is shown in SEQ NO 1.

[0013] The present invention also provides derivatives of the nucleic acid aptamer for detecting TSHR protein, wherein the derivatives are obtained by subjecting one or both ends of the nucleic acid aptamer sequence to radioactive labeling, therapeutic drug linkage, fluorescent labeling or biotin labeling, so as to obtain nucleic acid aptamer derivatives having the same TSHR binding ability as the nucleic acid aptamer.

[0014] The present invention further provides derivatives of the nucleic acid aptamer for detecting TSHR protein, wherein the derivatives are obtained by deleting or adding one or more nucleotides from the nucleic acid aptamer sequence to obtain derivatives of the nucleic acid aptamer having the same function as the nucleic acid aptamer.

[0015] The present invention further provides the aforementioned nucleic acid aptamer for detecting TSHR protein and the derivative of the aforementioned nucleic acid aptamer for detecting TSHR protein, and their use in preparing a TSHR protein detection reagent.

[0016] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in preparing a TSHR targeting vector reagent.

[0017] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in studying the differentiation between relatively high-expressing TSHR cells and relatively low-expressing TSHR cells.

[0018] The present invention further provides the aforementioned nucleic acid aptamer for detecting TSHR protein and the derivative of the aforementioned nucleic acid aptamer for detecting TSHR protein, and their use in studying TSHR protein in vivo labeling.

[0019] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in constructing a targeted drug-loaded preparation for thyroid disease.

[0020] Preferably, the thyroid disease is one of thyroid nodules, hyperthyroidism, chronic lymphocytic thyroiditis, diffuse thyroid lesions, hypothyroidism and thyroid abnormalities.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The present invention utilizes cell-SELEX screening technology to transfect TSHR plasmids into 293T cells (TSHR-293T) via lentivirus to construct model cells that highly express TSHR protein. Lentivirus then transfects empty plasmids into 293T cells (MOCK) as negative screening cells, eliminating DNA that nonspecifically binds to 293T cells and ensuring that the screened aptamers specifically recognize TSHR protein. Screening using living cells as targets ensures that the screened aptamers recognize the native conformation of the target molecule.

[0023] 2. The TSHR-targeting nucleic acid aptamer of the present invention has a unique stem-loop structure and was found to have high binding affinity and specificity by flow cytometry. It can specifically recognize TSHR-293T cells but not 293T cells. The nucleic acid aptamer obtained by screening can be further truncated and optimized, with a small molecular weight, saving synthesis costs, improving affinity, easy modification and transformation, no cytotoxicity, strong binding specificity, no immunogenicity, and high stability. These advantages make the nucleic acid aptamer as a TSHR protein-specific recognition molecular probe for the diagnosis and targeted regulation of TSHR protein-related diseases have important potential.

[0024] 3. The present invention provides a high-affinity DNA aptamer, YC6, that binds to the TSHR protein and has been validated at the molecular, cellular, and tissue levels. The present invention proposes that the DNA aptamer YC6 can recognize and target cells expressing the thyrotropin receptor, providing new insights into the diagnosis and treatment of thyroid diseases and thyroid-related eye diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0026] Figure 1 The binding of the obtained nucleic acid aptamer YC6 to TSHR-293T and MOCK was detected by flow cytometry;

[0027] The horizontal axis is the fluorescence intensity, and the vertical axis is the cell number.

[0028] Figure 2 Fluorescence microscopy was used to detect the binding of aptamer YC6 to orbital fat connective tissue in patients with thyroid-associated eye disease;

[0029] TSHRab represents the fluorescence signal of TSHR antibody, YC6-CY3 represents the fluorescence signal of aptamer modified with CY3 fluorescein, DAPI represents the fluorescence signal of cell nucleus, and Merge represents the combined fluorescence signal of aptamer, antibody and cell binding.

[0030] Figure 3 The stability of nucleic acid aptamer YC6 was characterized by agarose gel.

[0031] Figure 4 FIG. 4 is a diagram of the stem-loop structure of the nucleic acid aptamer. DETAILED DESCRIPTION

[0032] The present invention provides a nucleic acid aptamer for detecting TSHR protein. The nucleotide sequence of the nucleic acid aptamer is ACCGACCGTGCTGGACTCACTCGCAAGGGCACTTTTTTTAGGTCGACTATGAGCGAGCCTGGCG as shown in SEQ NO 1.

[0033] In the present invention, the nucleic acid aptamer YC6 for detecting TSHR protein was heated at 25°C and 1.0 mM Na + , 0.5 mM Mg 2+ Under certain conditions, it has a unique stem-loop structure, and its structural formula is as follows Figure 4 shown.

[0034] The present invention also provides derivatives of the nucleic acid aptamer for detecting TSHR protein, wherein the derivatives are obtained by subjecting one or both ends of the nucleic acid aptamer sequence to radioactive labeling, therapeutic drug linkage, fluorescent labeling or biotin labeling, so as to obtain nucleic acid aptamer derivatives having the same TSHR binding ability as the nucleic acid aptamer.

[0035] The present invention further provides derivatives of the nucleic acid aptamer for detecting TSHR protein, wherein the derivatives are obtained by deleting or adding one or more nucleotides from the nucleic acid aptamer sequence to obtain derivatives of the nucleic acid aptamer having the same function as the nucleic acid aptamer.

[0036] The present invention further provides the aforementioned nucleic acid aptamer for detecting TSHR protein and the derivative of the aforementioned nucleic acid aptamer for detecting TSHR protein, and their use in preparing a TSHR protein detection reagent.

[0037] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in preparing a TSHR targeting vector reagent.

[0038] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in studying the differentiation between relatively high-expressing TSHR cells and relatively low-expressing TSHR cells.

[0039] The present invention further provides the aforementioned nucleic acid aptamer for detecting TSHR protein and the derivative of the aforementioned nucleic acid aptamer for detecting TSHR protein, and their use in studying TSHR protein in vivo labeling.

[0040] The present invention further provides the use of the nucleic acid aptamer for detecting TSHR protein and the derivative of the nucleic acid aptamer for detecting TSHR protein in constructing a targeted drug-loaded preparation for thyroid disease.

[0041] In the present invention, the thyroid disease is one of thyroid nodules, hyperthyroidism, chronic lymphocytic thyroiditis, diffuse thyroid lesions, hypothyroidism and thyroid abnormalities.

[0042] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Cell source: The primary cells used in the following examples were extracted from adipose connective tissue isolated during orbital decompression surgery in patients with thyroid-related diseases; the human embryonic kidney cell line (293T) was purchased from Wuhan Pronocell Life Science Co., Ltd., China.

[0044] Example 1 The nucleic acid aptamer YC6 was screened by cell-SELEX technology, and the binding of the obtained nucleic acid aptamer YC6 to TSHR-293T and MOCK was detected by flow cytometry.

[0045] (1) Design of nucleic acid library and primers used:

[0046] Random single-stranded DNA library:

[0047] 5'-ACCGACCGTGCTGGACTCA(N)42ACTATGAGCGAGCCTGGCG-3' (N represents any of the four bases A, T, G, and C, and 42 represents 42 Ns, i.e., 42 random bases) (SEQ NO. 2)

[0048] Upstream primer: 5'-fluorescein isothiocyanate-ACCGACCGTGCTGGACTCA-3' (SEQ NO. 3)

[0049] Downstream primer: 5'-biotin-CGCCAGGCTCGCTCATAGT-3' (SEQ NO. 4)

[0050] (2) Screening process:

[0051] The present invention uses TSHR-293T cells that highly express TSHR as a positive screening target and MOCK cells that do not express TSHR as a counter-screening target.

[0052] 1. Positive screening:

[0053] a. Incubation: Dissolve the random DNA library in binding buffer, denature at 95°C for 5 minutes, anneal on ice for 10 minutes, and then incubate with pretreated TSHR-293T cells that have been cultured for at least 48 hours and have reached approximately 90% confluency at 4°C for 1 hour.

[0054] b. Separation: Remove the supernatant after incubation and rinse the cells several times with wash buffer. Then, scrape the washed cells with sterile water and place them in a centrifuge tube. Denature at 95°C for 10 minutes, renature on ice for 10 minutes, and centrifuge at 5500 rpm for 3 minutes. Aspirate the supernatant to obtain the first-round screening nucleic acid library of TSHR-293T cells.

[0055] c. PCR amplification of the library: Using the library obtained in step b as a template and the above primers as primers, amplification conditions are as follows: 95°C for 30 seconds, 55.9°C for 30 seconds, 72°C for 30 seconds for 8 cycles, and 72°C for 5 minutes. A preliminary amplification product is obtained, and then large-scale amplification is performed using the amplified product as a template for an appropriate number of cycles. d. Preparation of single-stranded DNA: The biotin-labeled antisense strand of the PCR amplification product from step c is separated using streptavidin-modified agarose beads. The double-stranded DNA is then denatured with 0.2M NaOH and the fluorescein isothiocyanate-labeled positive-sense single-stranded DNA library is collected by desalting.

[0056] 2. Counter-screening: Incubate the single-stranded DNA library obtained in step d with counter-screening cells MOCK cells, collect the supernatant after incubation to exclude non-specifically bound nucleic acid molecules, and continue to incubate the supernatant with positive screening cells for the next screening step.

[0057] 3. Screening cycle: Repeat steps 1 and 2 until a library of aptamers with strong binding to the target TSHR-293T cells is found. This process may need to be repeated for several to more than ten rounds.

[0058] 4. High-throughput sequencing: The final round of screening combined with the largest nucleic acid library is subjected to high-throughput sequencing, and the binding ability of the obtained sequence to TSHR-293T cells is detected by flow cytometry to determine the nucleic acid aptamer.

[0059] First, TSHR-293T and MOCK were cultured for 48 hours to make the cell density reach 90%, and then the adherent cells were digested from the culture dish with 0.2% EDTA. 250nM of synthesized FAM-labeled YC6 was prepared with 200μl binding buffer, denatured at 95℃ for 5 minutes, and renatured on ice for 10 minutes. Incubated with 300,000 TSHR-293T or MOCK cells at 4℃ for 45 minutes. Wash the incubated cells 2 to 3 times with washing buffer, and then resuspend the cells in 300μl washing buffer. Fluorescence detection was performed by flow cytometry, and the initial random DNA library was used as a control. The nucleic acid aptamer only binds to the target cell TSHR-293T, but not to MOCK. The results are as follows. Figure 1 shown.

[0060] Figure 1 : The horizontal axis FAM represents the fluorescence signal, and the vertical axis is the number of cells. The aptamer modified FAM fluorescence. The aptamer chains obtained by screening were incubated with positive and negative cells respectively. Figure 1 It can be seen that aptamer YC6 enhances the fluorescence signal of positive cells, but does not significantly enhance the fluorescence signal of negative cells.

[0061] Example 2 Fluorescence microscopy detection of the binding of aptamer YC6 to orbital fat connective tissue in patients with thyroid-associated eye disease

[0062] The orbital fat connective tissue of patients with thyroid-related eye disease was taken in an appropriate size and fixed, dehydrated, embedded, and prepared into paraffin sections. After dewaxing and antigen retrieval blocking, the sections were incubated with TSHR antibody ((1:1000, abcam, ab27974)) overnight, washed 3 times, and incubated with goat anti-mouse second antibody AF488 (1; 400, bioss). 250nM synthetic CY3-labeled YC6 was prepared with 500μl binding buffer, denatured at 95℃ for 5min, renatured on ice for 10min, and then incubated with the sections at 4℃ for 45min, washed 3 times, and sealed with DAPI-containing sealing solution. Fluorescence signals at 340nm, 488nm, and 570nm wavelengths were detected by fluorescence microscopy. The results are as follows: Figure 2 shown.

[0063] Figure 2 : Fluorescence microscopy was used to detect the binding of aptamer YC6 to orbital adipose connective tissue in patients with thyroid-associated eye disease.

[0064] DAPI: nuclear staining reagent

[0065] TSHRab: goat-anti, mouse, TSHR, antibody

[0066] YC6-CY3; CY3 fluorescein-modified YC6 aptamer

[0067] MERGE; signal superposition

[0068] Example 3: Stability Characterization of Aptamer YC6 Using Agarose Gel

[0069] First, the synthesized nucleic acid aptamer YC6 was dissolved in DMEM complete medium containing 10% FBS to a final concentration of 3 μM. The cells were incubated at 37°C for 0 h, 1 h, 2 h, 4 h, 6 h, 12 h, 24 h, and 48 h, denatured at 95°C for 5 min, renatured on ice for 10 min, and then stored at -80°C. The stability of the above samples was tested by 3% agarose gel electrophoresis. Compared with 0 h, YC6 showed no significant degradation after 48 h incubation in complete medium, indicating strong stability. The results are shown in Figure 2. Figure 3 shown.

[0070] Figure 3 : Characterization of the stability of nucleic acid aptamer YC6 by agarose gel.

[0071] The nucleic acid aptamer YC6 was dissolved in complete DMEM medium supplemented with 10% FBS to a final concentration of 3 μM and incubated at 37°C for 0, 1, 2, 4, 6, 12, 24, and 48 hours, denatured at 95°C for 5 minutes, renatured on ice for 10 minutes, and then stored at -80°C. The stability of these samples was assessed by 3% agarose gel electrophoresis. Compared to the 0-hour incubation, YC6 showed no significant degradation after 48 hours of incubation in complete medium, indicating strong stability.

[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer for detecting thyrotropin receptor protein, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO:

1.

2. The nucleic acid aptamer according to claim 1, wherein Both ends or one end of the nucleic acid aptamer sequence are radioactively labeled, linked to therapeutic drugs, fluorescently labeled or biotin-labeled.

3. Use of the nucleic acid aptamer according to claim 1 or 2 in preparing a detection reagent for thyrotropin receptor protein.

4. Use of the nucleic acid aptamer according to claim 1 or 2 in preparing a targeting carrier reagent for a thyrotropin receptor.

5. Use of the nucleic acid aptamer according to claim 1 or 2 in preparing a labeling reagent for thyrotropin receptor protein.

6. Use of the nucleic acid aptamer according to claim 1 or 2 in preparing a targeted drug-loaded preparation for thyroid diseases.

7. The use according to claim 6, characterized in that The thyroid disease is one of thyroid nodules, hyperthyroidism, chronic lymphocytic thyroiditis, diffuse thyroid lesions, hypothyroidism and thyroid abnormalities.

Citation Information

Patent Citations

  • Nucleic acid aptamer and application thereof related to recognition and combination of thyrotrophin receptor protein

    CN117187250A