A protein detection method combining surface-enhanced Raman spectroscopy and CRISPR / Cas12a

Abstract

This invention discloses a protein detection method combining surface-enhanced Raman spectroscopy (SERS) with CRISPR / Cas12a. The method includes the following steps: incubating samples containing a series of marker proteins with aptamers; incubating the resulting products with Cas12a protein, crRNA, and a Raman probe; exciting the incubated products with a laser; detecting their Raman signals; identifying and analyzing the Raman characteristic peak of 4 ATP; and obtaining a standard curve comparing the marker protein concentration with the Raman characteristic peak intensity of 4 ATP. The same analysis is performed on samples containing unknown concentrations of marker proteins, and the marker protein concentration in the samples is calculated based on the standard curve. Compared with existing ELISA methods, this invention has higher sensitivity and higher catalytic efficiency.

Description

Technical Field

[0001] This invention relates to a protein detection method that combines surface-enhanced Raman spectroscopy with CRISPR / Cas12a. Background Technology

[0002] The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) system, first discovered in archaea and bacteria, is a set of adaptive immune systems that naturally protect these organisms from invasive genetic components such as viruses and infectious plasmids. When used in conjunction with one or more Cas proteins, CRISPR RNA (crRNA) recognizes specific nucleic acid sequences, activating the Cas proteins to perform endonuclease functions and cleave the target nucleic acid molecule.

[0003] In addition to specific endonuclease activity (targeted cleavage), CRISPR-type III, V, and VI RNA-guided nucleases (Cas12, Cas13, and Cas14) also possess non-specific single-stranded nuclease activity (side-chain cleavage) activated by side-chain targeting, making them important tools for nucleic acid detection. Due to their high specificity and the relatively simple design of guide RNAs, the CRISPR / Cas system is increasingly widely used in conjunction with lateral chromatography strips or fluorescence conduction systems for nucleic acid detection.

[0004] Surface Enhancement of Raman Scattering (SERS) is a highly sensitive and selective tool for identifying biological and chemical analytes based on Raman scattering. It is characterized by the Raman probe resonating with the electromagnetic field on or near the surface of a specially prepared metallic conductor, particularly a rough noble metal surface (such as gold or silver), or within a sol (these substances are collectively referred to as Raman substrates). This results in a significantly enhanced Raman scattering signal compared to ordinary Raman signals.

[0005] SERS, as an emerging spectroscopic method, has been widely applied in fields such as organic pollutant analysis, heavy metal ion detection, and protein measurement due to its unique characteristics of high sensitivity, high resolution, and stability, as well as its highly specific single-molecule characteristic peaks. With the rapid development of Raman spectroscopy and the urgent need for disease diagnosis, SERS has been widely used in bioanalysis and biomedical research.

[0006] However, existing marker protein detection methods have drawbacks such as negative signals, cumbersome operation, and high detection costs. Summary of the Invention

[0007] The purpose of this invention is to provide a protein detection method that combines surface-enhanced Raman spectroscopy with CRISPR / Cas12a, which improves the sensitivity, specificity and catalytic efficiency of the detection, and features simple operation and short detection cycle.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] A protein detection method combining surface-enhanced Raman spectroscopy with CRISPR / Cas12a includes the following steps:

[0010] (1) Incubate samples containing a series of marker proteins and aptamers in buffer for at least 30 minutes to obtain samples of marker protein-aptamer binding. Incubate the obtained samples with Cas12a protein, crRNA, and Raman probe for at least 20 minutes. Excite the incubation products with a laser (785 nm) and detect their Raman signals. Identify the Raman characteristic peak of 4 ATP (1074 cm⁻¹). -1 The intensity of the marker protein was analyzed, and a standard curve was obtained showing the relationship between the concentration of the marker protein and the intensity of the Raman characteristic peak of 4 ATP.

[0011] In step (1), crRNA recognizes aptamers, which specifically recognize the target protein (marker protein) and wrap around it. If the aptamer is wrapped around the protein, it cannot be recognized by crRNA. Conversely, when the target protein is not present, crRNA specifically recognizes the aptamer, thereby activating the enzyme activity of Cas12a, and then arbitrarily cleaving ssDNA.

[0012] A Raman probe consists of three parts: magnetic beads, colloidal silver coupled with Raman molecules, and ssDNA linking the first two parts. If the ssDNA is cleaved, after magnetic adsorption and washing, the colloidal silver coupled with the Raman molecules will be washed away, thus causing a change in the Raman signal.

[0013] (2) Analyze the sample containing the unknown concentration of marker protein according to the operation in step (1) to obtain the Raman characteristic peak intensity of 4ATP, and calculate the concentration of marker protein in the sample based on the standard curve.

[0014] The marker proteins may be prostate-specific antigen (PSA), SARS-CoV-2N protein, interferon-gamma (IFN-γ), carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCCA), or alpha-fetoprotein (AFP).

[0015] The aptamer is a short, selected oligonucleotide sequence that can specifically bind to and wrap around a marker protein. While the aptamer, as an oligonucleotide sequence, can also be recognized by crRNA, crRNA cannot recognize and activate the enzymatic activity of the CRISPR / Cas system when the aptamer is wrapped around its corresponding ligand (marker protein).

[0016] The buffer solution is preferably PBS containing 2 mM MgCl2 and 0.02% Tween-20, with a pH of 7.4;

[0017] The Raman probe consists of silver nanoparticles (AgNPs@4ATP) with 4-aminothiophenol (4ATP) conjugated on the surface and magnetic beads (SA-MBs) with streptavidin modified on the surface, with the two parts connected by biotin-modified single-stranded DNA (ssDNA).

[0018] The Cas12a protein recognizes specific nucleic acid sequences via CRISPR RNA (crRNA), activating its non-specific endonuclease activity to randomly cleave ssDNA in the sample, making the operation more stable and simpler.

[0019] The sequence of the crRNA is complementary to the aforementioned aptamer. The crRNA can serve as a guide RNA for the Cas12a protein, helping to activate its enzymatic activity. The crRNA specifically recognizes the aptamer sequence and then activates the enzymatic activity of Cas12a.

[0020] The present invention has the following advantages and effects compared with the prior art:

[0021] 1. Compared with existing ELISA methods, the method of this invention has higher sensitivity because it uses Cas12a enzyme instead of HRP enzyme and non-specific nucleic acid cleavage instead of enzyme-catalyzed colorimetric reaction, resulting in higher catalytic efficiency. In addition, this invention uses Raman signal, which is much more sensitive than colorimetric signal. Therefore, the sensitivity of S-CRISPR-Apt is higher than that of ELISA. The sensitivity of this method (up to 1 pg / m) is more than 3000 times higher than that of HRP-based ELISA technology.

[0022] 2. The signal detected by the method of the present invention is a Raman signal based on the surface-enhanced Raman effect, which has the characteristics of high sensitivity; the recognition function of the present invention comes from the CRISPR / Cas12a system and aptamers, thus having the characteristics of good specificity; the signal change of the present invention is mainly based on the binding of aptamers and the enzymatic activity of Cas12a, thus having the characteristics of simple operation and short detection cycle. Attached Figure Description

[0023] Figure 1This is a standard curve of PSA concentration versus Raman signal intensity.

[0024] Figure 2 This is a standard curve of SARS-CoV-2N protein concentration versus Raman signal intensity.

[0025] Figure 3 This is a standard curve of IFN-γ concentration versus Raman signal intensity. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0027] Example 1

[0028] In this embodiment, prostate-specific antigen (PSA) was used as the analyte for quantitative analysis.

[0029] 1. Preparation of Raman probes

[0030] Weigh 90 mg of silver nitrate into a conical flask and dissolve it in 500 mL of ultrapure water. Heat the solution to boiling. Add 10 mL of 1% trisodium citrate aqueous solution dropwise to the boiling silver nitrate solution while stirring vigorously with a magnetic stirrer. Boil the mixture for another 30 minutes to produce stable gray-green colloidal silver. Mix 6 μL of 10 mM 4ATP (4-aminobenzylthiophenol) with 1 mL of silver nanoparticles (i.e., gray-green colloidal silver). Stir the solution continuously at room temperature for 1 hour, then centrifuge at 6000 rpm for 10 minutes at 4 °C and discard the supernatant. Resuspend the resulting particles (AgNPs@4ATP) in 1 mL of ultrapure water.

[0031] 100 μL of streptavidin magnetic beads (MBs-SA, purchased from Suzhou Beaver Biomedical Engineering Co., Ltd.) were washed three times with a magnetic rack and resuspended in 500 μL of Buffer 1 (kit catalog number Cat.#22307). 30 μL of 4 mM SH-ssDNA-biotin was added to MBs-SA and incubated for 30 minutes to obtain MBs-SA-biotin-ssDNA-SH.

[0032] Raman probes were obtained by incubating MBs-SA-biotin-ssDNA-SH with AgNPs@4ATP at room temperature for 30 minutes. The Raman probes were washed three times and stored at 4°C for later use.

[0033] The sequence of the ssDNA is as follows:

[0034] biotin-ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt-SH

[0035] 2. Activate the non-specific ssDNase activity of Cas12a and cleave the Raman probe.

[0036] 8 μL of PSA at different concentrations, 10 fM aptamer, and binding buffer (PBS buffer containing 2 mM MgCl2 and 0.02% Tween-20, pH 7.4) were added to wells of a plate and incubated at 37 °C for 30 min. After the binding reaction, 50 nM LbCas12a, 62.5 nM crRNA, Raman probe, and 1×NEBuffer 2.1 were added and incubated at 37 °C for 20 min. The plate was enriched and washed three times with a magnetic rack, and then resuspended in 100 μL of ultrapure water. The wells were placed in a portable Raman reader, and Raman signals were measured one by one using a portable Raman spectrometer under a 785 nm excitation laser at a power of 300 mW for a cumulative time of 10 seconds. A Raman characteristic peak of 4 ATP (1074 cm⁻¹) was clearly identified. -1 And used for analysis.

[0037] The sequence of the aptamer is: gggcggggcggacgagacagtaagggctgtgggtgtggtggaagaaact;

[0038] The crRNA sequence is: uaauuucuacuaaguguagauuuccaccacacccacagcccuuacuguc;

[0039] The LbCas12a, crRNA, and 1×NEBuffer 2.1 were all purchased from New England Biolabs (NEB).

[0040] 3. Experimental Results

[0041] Figure 1 The standard curve of PSA is shown. As can be seen from the figure, the signal of the detection system increases with the increase of PSA analyte, and there is a good linear relationship in the range of 1 pg / mL to 1 ng / mL.

[0042] Example 2

[0043] In this embodiment, SARS-CoV-2N protein was used as the analyte for quantitative analysis.

[0044] The difference from Example 1 is that the PSA aptamer is replaced with the SARS-CoV-2N protein aptamer, and the crRNA paired with the PSA aptamer is replaced with the corresponding crRNA paired with the SARS-CoV-2N protein aptamer.

[0045] The SARS-CoV-2N protein aptamer sequence is: gagaaggctggatgtcatccagccaacac;

[0046] The crRNAs that pair with the SARS-CoV-2N protein aptamer are listed as: uaauuucuacuaaguguagauguguuggcuggaugacaucc;

[0047] Figure 2 The standard curve of SARS-CoV-2N protein is shown. As can be seen from the figure, the signal of the detection system increases with the increase of SARS-CoV-2N protein analyte, and there is a good linear relationship in the range of 1 pg / mL to 1 ng / mL.

[0048] Example 3

[0049] In this embodiment, IFN-γ (gamma interferon) was used as the analyte for quantitative analysis.

[0050] The difference from Example 1 is that the PSA aptamer is replaced with an IFN-γ aptamer, and the crRNA paired with the PSA aptamer is replaced with the corresponding crRNA paired with the IFN-γ aptamer.

[0051] The IFN-γ aptamer sequence is: ggggttggttgtgttgggtgttgtgt;

[0052] The crRN sequence is: uaauuucuacuaaguguagauacacaacacccaacacaaccaacccc;

[0053] Figure 3 The standard curve of IFN-γ is shown. As can be seen from the figure, the signal of the detection system increases with the increase of IFN-γ analyte, and there is a good linear relationship in the range of 1 pg / mL to 1 ng / mL.

[0054] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A protein detection method combining surface-enhanced Raman spectroscopy with CRISPR / Cas12a for non-disease diagnosis and treatment purposes, characterized in that... Includes the following steps: (1) Incubate the sample containing a series of marker proteins and aptamers in buffer for at least 30 minutes to obtain the sample of marker protein binding aptamer. Incubate the obtained sample with Cas12a protein, crRNA and Raman probe for at least 20 minutes. Excite the incubation product with laser and detect its Raman signal. Identify the Raman characteristic peak of 4-aminothiophenol and analyze its intensity to obtain a standard curve of marker protein concentration and Raman characteristic peak intensity of 4-aminothiophenol. (2) Analyze the sample containing the unknown concentration of marker protein according to the operation in step (1) to obtain the Raman characteristic peak intensity of 4-aminothiophenol, and calculate the concentration of marker protein in the sample based on the standard curve. The aptamer is a short oligonucleotide sequence that can specifically bind to the marker protein; The sequence of the crRNA is complementary to the aptamer; The marker protein mentioned is one of prostate-specific antigen, SARS-CoV-2 N protein, and gamma interferon; When the marker protein is prostate-specific antigen, the nucleotide sequence of the aptamer is: gggcggggcggacgagacagtaagggctgtgggtgtggtggaagaaact, and the paired crRNA sequence is: uaauuucuacuaaguguagauuuccaccacacccacagcccuuacuguc; When the marker protein is SARS-CoV-2 N protein, the nucleotide sequence of the aptamer is: gagaaggctggatgtcatccagccaacac, and the paired crRNA sequence is: uaauuucuacuaaguguagauguguuggcuggaugacaucc; When the marker protein is interferon-gamma, the nucleotide sequence of the aptamer is: ggggttggttgtgttgggtgttgtgt, and the paired crRNA sequence is: uaauuucuacuaaguguagauacacaacacccaacacaaccaacccc; The Raman probe consists of silver nanoparticles with 4-aminothiophenol conjugated on the surface and magnetic beads with streptavidin modified on the surface, with the two parts linked by biotin-modified single-stranded DNA. The nucleotide sequence of the single-stranded DNA is as follows: biotin-tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt-SH; The buffer solution is PBS containing 2 mM MgCl2 and 0.02% Tween-20, with a pH of 7.4; The wavelength of the laser in step (1) is 785 nm; The Raman characteristic peak of 4-aminothiophenol in step (1) has a wavelength of 1074 cm⁻¹. -1 .

Images