A quality inspection method for adapter primers for high-throughput sequencing and a high-throughput sequencing method

By designing a quality control method for adapter primers to evaluate the integrity, mutation rate and insertion rate of adapter primers, the shortcomings of adapter primer quality control in high-throughput sequencing were solved, and the quality and reliability of sequencing data were improved.

CN115807068BActive Publication Date: 2025-09-23GENEWIZ INC SZ
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211146078.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-20
Publication Date
2025-09-23
Estimated Expiration
2042-09-20

AI Technical Summary

Technical Problem

Existing high-throughput sequencing technologies lack quality control methods for adapter primers, which affects the data output and quality of sequencers.

Method used

A method for testing adapter primers for high-throughput sequencing was designed. The adapter primers to be tested were mixed with 3' adapters for ligation reaction. An extension primer was added to form the second DNA strand, and PCR amplification was performed. Sequencing and data analysis were performed on the MGI sequencing platform to evaluate the integrity, mutation rate, deletion rate, and insertion rate of the adapter primers.

Benefits of technology

Accurately analyze the quality of adapter primers, improve production processes, provide high-quality NGS library construction and sequencing adapter primers, and improve the reliability and accuracy of sequencing data.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115807068B_ABST
    Figure CN115807068B_ABST
Patent Text Reader

Abstract

The present invention discloses a quality inspection method for adapter primers used for high-throughput sequencing and a high-throughput sequencing method. The quality inspection method comprises: mixing an adapter primer to be tested with a 3' adapter to perform a ligation reaction, adding an extension primer to perform an extension reaction to form a second DNA strand, adding a 5' adapter to perform a ligation reaction, performing PCR amplification to obtain an MGI library, and sequencing and data analysis of the MGI library based on an MGI sequencing platform. The 3' adapter and 5' adapter are adapters that match the MGI sequencing platform. The present invention designs a quality inspection method for adapter primers used for high-throughput sequencing, designs an MGI library construction strategy for the adapter primers to be tested, and performs sequencing and data analysis based on the MGI sequencing platform. The method can accurately analyze the integrity, mutation rate, deletion rate, and insertion rate of the adapter primers, evaluate the quality of the adapter primers, and thus effectively perform quality inspection on high-throughput sequencing adapter primers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a quality inspection method for adapter primers used for high-throughput sequencing and a high-throughput sequencing method. Background Art

[0002] High-throughput sequencing technology, also known as "next-generation" sequencing technology (NGS) or massively parallel sequencing (MPS), is different from traditional Sanger (dideoxy sequencing) in that it can perform parallel sequencing on a large number of nucleic acid molecules at a time. Typically, a single sequencing reaction can produce no less than 100Mb of sequencing data.

[0003] Currently, widely used high-throughput sequencing technologies include MGI DNA nanoballs (DNBs) technology developed by LifeTech, Illumina, and BGI, as well as single-molecule sequencing technologies developed by Nanopore and Pacific Biosciences. These technologies can simultaneously sequence millions of DNA molecules, enabling parallel analysis of hundreds or even thousands of samples. The sequencing process typically involves constructing libraries using library construction kits (such as those provided by Illumina, Roche, and NEB) and performing sequencing analysis. The main steps in library construction include: 1. fragmenting large DNA fragments into 200-500 bp fragments; 2. end-repairing the fragmented DNA to form blunt ends; 3. adding an A base to the 3' end of the DNA fragment using the terminal transferase activity of a polymerase; 4. hybridizing and ligating the dsDNA with a 3' A end using double-stranded Y-shaped adapters with a 3' T end; and 5. PCR enrichment of the adapter-ligated products to obtain a library suitable for sequencing. Among them, the quality of the NGS adapter primers used in the library construction process directly affects the data output and data quality of the sequencer. However, there is currently a lack of quality control methods for the quality of the adapter primers used in the library construction process.

[0004] In summary, a quality inspection method for high-throughput sequencing adapter primers is provided to help improve the production process and better provide high-quality NGS library construction and sequencing adapter primers, which is of great significance to the field of high-throughput sequencing. Summary of the Invention

[0005] In response to the deficiencies in the existing technology and actual needs, the present invention provides a quality inspection method for adapter primers for high-throughput sequencing and a high-throughput sequencing method. The quality inspection method for adapter primers designed by the present invention for high-throughput sequencing can effectively evaluate the quality of adapter primers, including adapter primer integrity, mutation rate, deletion rate and insertion rate, etc., can assist in improving the production process, and provide high-quality NGS library construction and sequencing adapter primers, which is of great significance to the field of high-throughput sequencing.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a quality inspection method for adapter primers for high-throughput sequencing, the quality inspection method comprising:

[0008] The adapter primer to be tested is mixed with the 3' adapter for ligation reaction, an extension primer is added for extension reaction to form the second DNA chain, a 5' adapter is added for ligation reaction, and PCR amplification is performed to obtain an MGI library. The MGI library is sequenced and data analyzed based on the MGI sequencing platform. The 3' adapter and 5' adapter are adapters that match the MGI sequencing platform.

[0009] In the present invention, a quality inspection method for adapter primers used in high-throughput sequencing is designed, an MGI library construction strategy for the adapter primers to be tested is designed, and sequencing and data analysis are performed based on the MGI sequencing platform. This can accurately analyze the integrity, mutation rate, deletion rate, and insertion rate of the adapter primers, evaluate the quality of the adapter primers, and thus effectively perform quality analysis on high-throughput sequencing primers.

[0010] In the present invention, the MGI (BGI) sequencing platform is a sequencing-by-synthesis technology platform with unique DNBSEQ technology, DNA nanoball technology and combined probe-anchored polymerization (cPAS) sequencing technology as its core. During the sequencing process, the bases are recorded by detecting the fluorescent signal converted into an electrical signal.

[0011] In the present invention, the analysis method of the linker primer integrity, mutation rate, deletion rate and insertion rate is as follows: Figure 1 For details, please refer to the Oligonucleotide Quality Analysis Software V1.0 Software User Manual (Registration Number: 2021SR1616309).

[0012] In the present invention, adapter primers for high-throughput sequencing can be effectively analyzed without any particular limitation.

[0013] Preferably, the adapter primer to be tested includes an Illumina platform adapter primer.

[0014] Preferably, the 3' linker is modified with biotin.

[0015] The quality inspection method of the adapter primer for high-throughput sequencing of the present invention can effectively evaluate any adapter primer suitable for the Illumina platform.

[0016] Preferably, the nucleic acid sequence of the adapter primer to be tested includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0017] In the present invention, all adapters applicable to the MGI sequencing platform are applicable to the present invention without special limitation.

[0018] Preferably, the nucleic acid sequence of the 3' linker includes the sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0019] Preferably, the nucleic acid sequence of the 5' linker includes the sequences shown in SEQ ID NO.5 and SEQ ID NO.6.

[0020] In the present invention, the 5' linker is a double-stranded structure and is usually synthesized in a single-stranded form. Before use, two single-stranded links are usually mixed and annealed to prepare a double-stranded linker.

[0021] Preferably, the annealing procedure includes incubating at 95° C. for 10 seconds and then decreasing the temperature to 10° C. at a rate of 0.1° C. / s, as shown in Table 1.

[0022] Table 1

[0023]

[0024]

[0025] Preferably, the ligation reaction procedure of the 3' linker includes: reaction at 35-40°C for 40-80 min, and reaction at 90-98°C for 30 s-2 min.

[0026] Preferably, the ligation reaction system of the 3' linker comprises 10×T4 DNA ligation buffer, PEG-8000, ATP, T4 DNA ligase and water.

[0027] In the present invention, all extension adapters applicable to the MGI sequencing platform are applicable to the present invention without special limitation.

[0028] Preferably, the nucleic acid sequence of the extension primer includes the sequence shown in SEQ ID NO.7.

[0029] In the present invention, all primers suitable for PCR amplification for library construction on the MGI sequencing platform are applicable to the present invention without special limitation.

[0030] In one embodiment, the PCR products of the present invention comprised a sequence of sequences comprising SEQ ID NO.8 and SEQ ID NO.9.

[0031] SEQ ID NO.1:

[0032] AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T.

[0033] SEQ ID NO.2:

[0034] CAAGCAGAAGACGGCATACGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T.

[0035] SEQ ID NO.3:Pho-AAGTCGGATC[C3Spacer]10-TEG-biotin.

[0036] SEQ ID NO.4:SpacerC12-AA(SpacerC12)GATCCGACTTNNNNNNN-AmC6

[0037] SEQ ID NO.5:CCGCTTGGCCTCCGACTT-ddC.

[0038] SEQ ID NO.6:

[0039] Pho-GAAGTCGGAGGCCAAGCGGTCTTAGGAAGA*C*A*A。

[0040] SEQ ID NO.7:

[0041] CAACTCCTTGGCTCACAGAACGACATGGCTACGATCC*GA*CT*T。

[0042] SEQ ID NO.8:

[0043] 5'Pho / TCTCAGTACGTCAGCAGTTNNNNNNNNNCAACTCCTTGGCTCAC。

[0044] SEQ ID NO.9:

[0045] GGCATGGCGACCTTATCAGNNNNNNNNNNTTGTCTTCCTAAGACC。

[0046] Wherein, XXXXXXXX: represents the specific tag sequence, X can be any base among A, T, G, and C; *: thiolation modification; Pho: phosphorylation modification; [C3Spacer]10: 10 carbon 3 spacers in series; TEG-biotin: triethylene glycol-biotin; SpacerC12: carbon 12 spacer; AmC6: amino carbon 6 modification; ddC: dideoxycytosine; N: can be any base among A, T, G, and C.

[0047] Preferably, the PCR amplification procedure includes:

[0048] Pre-denaturation at 90-98°C for 1-5 min;

[0049] Denaturation at 95–98°C for 15–30 s, annealing at 55–65°C for 10–25 s, and extension at 70–75°C for 20–40 s for 10–20 cycles;

[0050] 70~75℃, 2~6min.

[0051] Preferably, the quality inspection method further comprises the step of purifying the ligation product and the PCR amplification product:

[0052] Preferably, the quality inspection method comprises the following steps:

[0053] (1) Mix the adapter primer to be tested with the 3' adapter for ligation reaction, purify the ligation product, add the extension primer, react at 35-40°C for 40-80 minutes, and at 90-98°C for 30 seconds to 2 minutes to form the second strand of DNA;

[0054] (2) mixing the product of step (1) with the 5' linker for ligation reaction, and performing PCR amplification to obtain the MGI library;

[0055] (3) Sequencing and data analysis of the MGI library were performed based on the MGI sequencing platform.

[0056] In a second aspect, the present invention provides a high-throughput sequencing method, comprising:

[0057] The adapter primers are quality inspected using the quality inspection method for adapter primers for high-throughput sequencing described in the first aspect, and adapter primers are selected for high-throughput sequencing based on the quality inspection results.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] The present invention designs a quality inspection method for adapter primers for high-throughput sequencing, designs an MGI library construction strategy for the adapter primers to be tested, and performs sequencing and data analysis based on the MGI sequencing platform. It can accurately analyze the integrity, mutation rate, deletion rate and insertion rate of the adapter primers, evaluate the quality of the adapter primers, and thus effectively guide high-throughput sequencing. It can help improve the production process and provide high-quality NGS library construction and sequencing adapter primers, which is of great significance to the field of high-throughput sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 Flowchart of the analysis method for adapter primer integrity, mutation rate, deletion rate and insertion rate;

[0061] Figure 2 This is the result of quality control of MGI library by capillary electrophoresis;

[0062] Figure 3 This is the quality assessment result of the linker primer of sequence 1;

[0063] Figure 4 This is the quality assessment result of sequence 2 adapter primer. DETAILED DESCRIPTION

[0064] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention.

[0065] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0066] In the embodiment of the present invention, the adapter primer of the Illumina platform (sequence 1: aatgatacggcgaccaccgagatctacactctttcccacactctttccctacacgacgctcttccgatc*t; sequence 2: caagcagaagacggcatacgagataatgagcggtgactggagttcagacgtgtgctcttccgatc*t, synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.) is taken as an example to verify the quality inspection method of the adapter primer for high-throughput sequencing of the present invention.

[0067] Example 1

[0068] In this example, a 5' linker and a 3' linker were prepared.

[0069] Take 10 μL of adapter 1 (final concentration 100 μM, SEQ ID NO.3) and 10 μL of adapter 2 (final concentration 100 μM, SEQ ID NO.4) and mix them evenly; take 10 μL of adapter 3 (final concentration 100 μM, SEQ ID NO.5) and 10 μL of adapter 4 (final concentration 100 μM, SEQ ID NO.6) and 0.2 μL of 5M (mol / L) NaCl and mix them evenly; place them in a PCR instrument and incubate at 95°C for 10 seconds, then reduce the temperature to 10°C at a rate of 0.1°C / s. The specific procedure is shown in Table 2. Adapter 1 and adapter 2 anneal to form a double-stranded 3' adapter, and adapter 3 and adapter 4 anneal to form a double-stranded 5' adapter.

[0070] Table 2

[0071]

[0072] Example 2

[0073] This example performs 3' linker ligation.

[0074] (1) The 3' linker ligation reaction system is shown in Table 3.

[0075] Table 3

[0076] Components Dosage (μL) 10×T4 DNA ligation buffer (purchased from Thermo Fisher, cat. no. EL0013) 4 μL 50% PEG-8000 16μL 100mM ATP 0.2μL Illumina adapter primers to be tested (sequence 1 and sequence 2) 20 pmol Example 1 Preparation of 3' linker (100 μM) 0.5μL T4 DNA ligase (30 U / μL) (purchased from Thermo Fisher, cat. no. EL0013) 1 μL <![CDATA[H2O]]> Make up to 40 μL

[0077] (2) The 3' linker ligation reaction procedure is shown in Table 4.

[0078] Table 4

[0079] temperature time 37℃ 60min 95℃ 1min 10℃ Keep

[0080] After the reaction was completed, it was immediately stored at -20°C.

[0081] (3) Purification and recovery of the 3' linker ligation product using streptavidin magnetic beads.

[0082] 1) Resuspend and mix Dynabeads using a shaker TM MyOne TM Streptavidin C1 (purchased from ThermoFisher, cat. no. 65001). Magnetic bead washing: Transfer X μL (20 μL per sample, N samples, then X = N × 20 μL) of the magnetic bead suspension to a 1.5 mL EP tube and place on a magnetic rack for 3 min. After the solution clears, discard the supernatant. Resuspend the magnetic beads in 500 μL of 0.1× BWT + SDS, place on a magnetic rack, and after clarification, discard the supernatant. Repeat the wash with 500 μL of 0.1× BWT + SDS. Resuspend the magnetic beads in Y μL of 0.1× BWT + SDS (120 μL per sample, N samples, then Y = N × 120 μL). Place on ice until ready to use.

[0083] 2) Remove the 3' adapter ligation products from the previous step from -20°C, thaw, and incubate in a PCR instrument at 95°C for 1 minute. Immediately place on ice for 2 minutes. Add 120 μL of magnetic bead suspension to each PCR tube of ligation products, resuspend and mix thoroughly, and incubate on a rotator at room temperature for 20 minutes.

[0084] 3) Briefly centrifuge the beads and place them on a magnetic rack. Allow the solution to clear and discard the supernatant (be careful not to absorb the beads). Remove the magnetic rack and add 200 μL of 0.1× BWT + SDS. Resuspend and mix thoroughly, centrifuge, and place on a magnetic rack.

[0085] 4) Discard the supernatant and add 100 μL of Wash Buffer to the magnetic beads, resuspend and mix thoroughly, incubate at 45°C in a PCR instrument for 3 minutes, centrifuge briefly, and place on a magnetic stand.

[0086] 5) After the solution is clear, discard the supernatant, add 200 μL of 0.1× BWT and resuspend by vortexing to mix.

[0087] (4) Purify and recover the 3' linker ligation product for second-strand DNA synthesis.

[0088] 1) The synthesis reaction system (46 μL) is shown in Table 5.

[0089] Table 5

[0090]

[0091] 2) Briefly centrifuge the magnetic bead mixture obtained in step (3), place it in a magnetic stand for about 5 minutes, remove the supernatant, add the above 46 μL system, pipette and resuspend, place it in a PCR instrument and incubate at 65°C for 2 minutes, and immediately place it on ice for use.

[0092] 3) Add 4 μL of Klenow fragment (5 U / μL, purchased from NEB, Cat. No. M0212L) and mix thoroughly by pipetting. Transfer to a PCR instrument using the protocol shown in Table 6.

[0093] Table 6

[0094] temperature time 25℃ 5min 35℃ 25min

[0095] 4) Centrifuge briefly and place the beads on a magnetic rack until the solution is clear.

[0096] 5) Discard the supernatant and wash the magnetic beads three times with 200 μL Wash Buffer (containing 15 mM sodium chloride, 1.5 mM sodium acetate (pH 7.0) and 0.1% SDS).

[0097] Example 3

[0098] This example performs 5' linker ligation and purification.

[0099] (1) Prepare the system (100 μL) according to Table 7.

[0100] Table 7

[0101] Components Volume (μL) <![CDATA[H2O]]> 74.75 10×T4 DNA ligation buffer 10 50% PEG-4000 10 Example 1 Preparation of 5' linker 2 2% Tween-20 1.25 T4 DNA ligase (5 U / μL) 2

[0102] (2) Briefly centrifuge and place the magnetic beads obtained in step (4) of step 2 on a magnetic rack. Remove the supernatant completely and resuspend them in 100 μL of the above-mentioned system. Place the beads in a metal bath and incubate at 22°C and 300 rpm for 1 hour.

[0103] (3) Place the sample on a magnetic rack, remove the supernatant, and wash the magnetic beads three times with 200 μL Wash Buffer.

[0104] (4) After brief centrifugation, place on a magnetic rack, completely remove the supernatant, resuspend with 50 μL TT Buffer (containing 10 mM Tris–HCl (pH 7.5) and 0.05% Tween 20), centrifuge briefly, incubate at 95°C for 1 min, and immediately place on a magnetic rack. Immediately transfer 48 μL of the supernatant (containing the unamplified library) to a new 0.2 mL PCR tube for use.

[0105] Example 4

[0106] In this example, library amplification and addition of library-specific tags are performed.

[0107] (1) The reaction system is shown in Table 8.

[0108] Table 8

[0109]

[0110] (2) The PCR reaction procedure is shown in Figure 9.

[0111] Table 9

[0112]

[0113] (3) Library purification

[0114] 1) Purify the DNA using 1×VAHTS DNA Clean Beads (purchased from Novozymes, Cat. No. N411-01). Add 50 μL of beads directly to the PCR reaction system. Vortex or pipette gently 10 times to mix thoroughly. Incubate at 25°C for 5 min.

[0115] 2) Briefly centrifuge the PCR tube and place it on a magnetic stand to separate the beads and liquid.

[0116] 3) After the solution is clear, carefully transfer the supernatant to a new PCR tube and retain the supernatant.

[0117] 4) Keep the PCR tube in the magnetic rack and add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Incubate at 25°C for 30 seconds and remove the supernatant.

[0118] 5) Repeat step 4) for a total of two rinses.

[0119] 6) Keep the PCR tube in the magnetic rack and air-dry the beads with the lid open until no ethanol remains. Remove the PCR tube from the magnetic rack and add 20 μL of HO to elute the beads to obtain the MGI library.

[0120] Example 5

[0121] Capillary electrophoresis was used to check the quality of the DNA library, and the MGI library was further circularized according to the instructions of the BGI MGI platform DNA circularization kit (purchased from MGI, cat. no. 1000005259), and sequenced and analyzed.

[0122] The results of DNA library quality test by capillary electrophoresis of sequence 1 and sequence 2 adapter primers are as follows Figure 2 As shown, by applying the quality inspection method of the present invention to build a library for Illumina sequencing adapter primers, a high-quality DNA library can be obtained; Figure 3 and Figure 4 The quality of the Sequence 1 and Sequence 2 adapter primers is shown separately, including adapter primer integrity, mutation rate, deletion rate, and insertion rate. The integrity of the Sequence 1 adapter primer is 87.4%, and the integrity of the Sequence 2 adapter primer is 29.23%. The remaining portion is incomplete or contains incorrect bases. The statistical results of the insertion rate, deletion rate, and mutation rate of the Sequence 1 and Sequence 2 adapter primers are shown in Table 10.

[0123] Table 10

[0124] Insertion rate Missing rate mutation rate Sequence 1 0.02% 0.03% 0.04% Sequence 2 0.02% 0.96% 0.03%

[0125] In summary, the present invention designs a quality inspection method for adapter primers for high-throughput sequencing, designs an MGI library construction strategy for the adapter primers to be tested, and performs sequencing and data analysis based on the MGI sequencing platform. This method can accurately analyze the integrity, mutation rate, deletion rate, and insertion rate of adapter primers, and evaluate the quality of adapter primers, thereby effectively guiding high-throughput sequencing, assisting in improving production processes, and providing high-quality NGS library construction and sequencing adapter primers, which is of great significance to the field of high-throughput sequencing.

[0126] The applicant states that the present invention is intended to illustrate the detailed methods of the present invention through the above-described embodiments, but the present invention is not limited to the above-described detailed methods, that is, it does not mean that the present invention must rely on the above-described detailed methods in order to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for various raw materials in the products of the present invention, addition of auxiliary ingredients, and selection of specific methods, etc., are all within the scope of protection and disclosure of the present invention.

Claims

1. A quality inspection method for adapter primers for high-throughput sequencing, characterized in that: The quality inspection method includes: Mixing the adapter primer to be tested with the 3' adapter for ligation reaction, adding an extension primer for extension reaction to form a second DNA strand, adding a 5' adapter for ligation reaction, performing PCR amplification to obtain an MGI library, and sequencing and data analysis of the MGI library based on the MGI sequencing platform; The 3' adapter and 5' adapter are adapters that match the MGI sequencing platform; The nucleic acid sequence of the adapter primer to be tested is shown in SEQ ID NO.1 or SEQ ID NO.2; The nucleic acid sequences of the 3' linker are shown in SEQ ID NO.3 and SEQ ID NO.4; The nucleic acid sequences of the 5' linker are shown in SEQ ID NO.5 and SEQ ID NO.6; The nucleic acid sequence of the extension primer is shown in SEQ ID NO.7; The nucleic acid sequences of the primers for PCR amplification are shown in SEQ ID NO.8 and SEQ ID NO.9; SEQ ID NO.1: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC*T; SEQ ID NO.2: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T; SEQ ID NO.3: Pho-AAGTCGGATC[C3Spacer] 10-TEG-biotin; SEQ ID NO.4: SpacerC12-AA(SpacerC12)GATCCGACTTNNNNNNN-AmC6 SEQ ID NO.5: CCGCTTGGCCTCCGACTT-ddC; SEQ ID NO.6: Pho-GAAGTCGGAGGCCAAGCGGTCTTAGGAAGA*C*A*A; SEQ ID NO.7: CAACTCCTTGGCTCACAGAACGACATGGCTACGATCC*GA*CT*T; SEQ ID NO.8: 5'Pho / TCTCAGTACGTCAGCAGTTNNNNNNNNNNCAACTCCTTGGCTCAC; SEQ ID NO.9: GGCATGGCGACCTTATCAGNNNNNNNNTTGTCTTCCTAAGACC; Wherein, XXXXXXXX: represents the specific tag sequence, X is any base among A, T, G, and C; *: thiolation modification; Pho: phosphorylation modification; [C3Spacer]10: 10 carbon 3 spacers in series; TEG-biotin: triethylene glycol-biotin; SpacerC12: carbon 12 spacer; AmC6: amino carbon 6 modification; ddC: dideoxycytosine; N: any base among A, T, G, and C.

2. The quality inspection method for adapter primers for high-throughput sequencing according to claim 1, characterized in that: The adapter primer to be tested includes an Illumina platform adapter primer; The 3' linker is modified with biotin.

3. The quality inspection method for adapter primers for high-throughput sequencing according to claim 2, characterized in that: The ligation reaction procedure of the 3' linker includes: reaction at 35-40°C for 40-80 min, and reaction at 90-98°C for 30 s-2 min.

4. The quality inspection method for adapter primers for high-throughput sequencing according to any one of claims 1 to 3, characterized in that: The PCR amplification procedure includes: Pre-denaturation at 90-98°C for 1-5 min; Denaturation at 95–98°C for 15–30 s, annealing at 55–65°C for 10–25 s, and extension at 70–75°C for 20–40 s, for 10–20 cycles; 70~75℃, 2~6 min.

5. The quality inspection method for adapter primers for high-throughput sequencing according to claim 4, characterized in that: The quality inspection method further comprises the step of purifying the ligation product and the PCR amplification product; The quality inspection method comprises the following steps: (1) Mix the adapter primer to be tested with the 3' adapter for ligation reaction, purify the ligation product, add the extension primer, react at 35-40℃ for 40-80 min, and at 90-98℃ for 30 s-2 min to form the second strand of DNA; (2) Mixing the product of step (1) with the 5' linker for ligation reaction, and performing PCR amplification to obtain the MGI library; (3) Sequencing and data analysis of the MGI library based on the MGI sequencing platform.

6. A high-throughput sequencing method, characterized in that: The high-throughput sequencing method comprises: The adapter primers are quality inspected using the quality inspection method for adapter primers for high-throughput sequencing according to any one of claims 1 to 5, and adapter primers are selected for high-throughput sequencing based on the quality inspection results.

Citation Information

Patent Citations

  • Linker sequence and method for detecting ultra-low frequency mutation of target sequence

    CN107446996A

  • Construction method of high-throughput sequencing library suitable for single-stranded DNA

    CN110904512A