Construction method and application of a single copy VGF gene oncolytic vaccinia virus vector

Abstract

The present invention relates to a construction method and application of a tumor-targeted vaccinia virus vector WRDD-VGF, wherein the virus vector is a vaccinia virus WR strain, wherein two original VGF genes and J2R (TK) genes are deleted, and a single copy VGF gene sequence is inserted into the TK region to obtain an oncolytic vaccinia virus vector of a single copy VGF gene with a TK gene deletion. The WRDD-VGF of the present invention has the characteristics of targeting, safety, and effectiveness, has tumor targeting and anti-tumor effects, can be used for the treatment of various tumors, and provides a novel tumor-targeted virus backbone vector for oncolytic virus drug research.

Description

Technical Field

[0001] The present invention relates to a construction method and application of a single-copy VGF gene oncolytic vaccinia virus vector, belonging to the field of biotechnology and gene therapy. Background Art

[0002] In recent years, vaccinia virus has been widely used as a tumor-targeted gene vector because of its strong and efficient replication and transduction capabilities, its great ability to accept foreign genes, its ability to infect a wide spectrum of tumor cells, its genomic DNA will not integrate with host DNA, and its excellent safety record in the smallpox eradication program, with few serious adverse reactions. Compared with other types of viruses, vaccinia virus can be injected intravenously during the application of tumors as an oncolytic agent, and can be administered remotely, solving the problem of difficult drug administration in clinical practice.

[0003] Vaccinia virus (VV) WR strain shows strong toxicity in animal models and has inherent tumor selectivity. The WR strain contains two VGF gene (vaccinia virus growth factor) sequences. The vv-DD vector (Cancer Research, 2001, 61, 8751–7, named WRDD in this article) obtained by genetic technology by deleting TK (and inserting the reporter gene enhanced green fluorescent protein EGFP) and two copies of the VGF gene has a tumor killing effect similar to that of the wild strain and shows a more significant tumor-specific replication effect. vv-DD has entered clinical trials and the results showed that it is very safe and has a potential to improve its anti-tumor ability. VGF is a product encoded by the vaccinia virus C11R gene. The C11R gene is an early gene present in the WR strain and other orthopoxviruses, encoding a soluble secreted vaccinia virus growth factor, a protein that binds to and stimulates EGFR. The loss of the C11R gene reduces vaccinia virus-induced ERK2 and NF-κB activation. Sequence analysis showed that VGF is a processed form of the polypeptide encoded in the vaccinia virus genome, which is related to epidermal growth factor (EGF) and alpha transforming growth factor (αTGF). Unlike EGF or αTGF, VGF is glycosylated, and VGF binds to the EGF receptor and stimulates its own phosphorylation. VGF plays an important role in stimulating the growth of uninfected cells to promote viral infection. Early technologies could only delete both copies of the VGF sequence of the WR strain at the same time. The loss of the VGF gene weakened the ability of the vaccinia virus to spread between cells and cause cytopathic effects. Therefore, it is necessary to develop a more targeted and more effective oncolytic vaccinia virus vector. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention aims to provide a method for constructing a single-copy VGF gene oncolytic vaccinia virus vector and its application. The virus vector can enhance anti-tumor ability in vivo and in vitro, and has the characteristics of targeting, safety and effectiveness.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] A method for constructing a single-copy VGF gene oncolytic vaccinia virus vector, wherein the oncolytic vaccinia virus vector is a vaccinia virus WR strain, wherein the TK gene is deleted on the basis of deleting the original two copies of the VGF gene, and a single-copy VGF gene sequence is inserted into the TK region to obtain an oncolytic vaccinia virus vector with a single copy of the VGF gene and a TK gene deleted.

[0007] In the method for constructing an oncolytic vaccinia virus vector, the VGF gene is a natural VGF gene or a VGF gene variant.

[0008] The VGF gene variant is a variant obtained by genetic engineering or protein engineering, and retains the activity of the natural VGF gene.

[0009] The method for constructing the oncolytic vaccinia virus vector comprises the following steps:

[0010] (1) Reference sequence: NCBI Reference Sequence: NC_006998.1, design a shuttle vector targeting the TK region and containing the VGF sequence; connect the upstream sequence of the TK gene SEQ1, the fluorescent protein RFP sequence SEQ3, the H5 promoter SEQ4, the VGF sequence SEQ5, and the downstream sequence of the TK gene SEQ2 to the plasmid vector in sequence by gene synthesis to construct the VGF shuttle vector pTK-VGF;

[0011] (2) Based on the TK gene sequence, the gRNA sequence SEQ6 was designed, and the gRNA sequence was inserted into the PB-gRNA vector to construct PB-gRNA-TK;

[0012] (3) CV1 cells were inoculated into a six-well plate. When the cells reached a confluence of more than 90%, Cas9 and PB-gRNA-TK mixed plasmids were transfected at the same time. After 24 hours, WRΔVGF was infected and pTK-VGF was transfected after 2 hours. After another 48 hours, the supernatant and the cell mixture were collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at a rate of 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After the monoclonal solution was frozen and thawed, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector WRDD-VGF.

[0013] The oncolytic vaccinia virus vector obtained by the construction method is used in the preparation of drugs for treating tumors.

[0014] The tumor is a solid tumor.

[0015] The solid tumor includes pancreatic cancer, colon cancer, liver cancer or gastric cancer.

[0016] Beneficial effects of the present invention:

[0017] The tumor-targeted vaccinia virus vector WRDD-VGF provided by the present invention deletes the TK gene on the basis of deleting the original two copies of the VGF gene of the WR strain vaccinia virus, and inserts a single copy of the VGF gene sequence into the TK region by homologous recombination to obtain a TK gene-deficient single copy of the VGF gene oncolytic vaccinia virus vector WRDD-VGF.

[0018] The present invention deletes the TK gene while retaining the copy VGF gene of the WR strain, thereby maintaining the high specificity of the vaccinia virus to tumor cells, enhancing the virus's ability to infect and replicate in tumor cells and its ability to spread and replicate between tumor cells, thereby improving the killing effect on tumor cells and reducing the impact on normal cells, thereby obtaining a viral vector with stronger anti-tumor ability.

[0019] The oncolytic vaccinia virus vector WRDD-VGF of the present invention has the characteristics of targeting, safety and effectiveness, has tumor targeting and anti-tumor effects, can carry various tumor therapeutic genes, and is used for the treatment of various solid tumors such as pancreatic cancer, liver cancer, and colon cancer, and also provides a new type of tumor-targeted virus backbone vector for oncolytic virus drug research. Therefore, WRDD-VGF can be used as a gene therapy vector with effectiveness and safety in treating tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : Schematic diagram of the structures of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK.

[0021] Figure 2 : Schematic diagram of the killing ability of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK on different tumor cells.

[0022] Figure 3 : Schematic diagram of the effects of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK on vaccinia virus plaque formation.

[0023] Figure 4: Schematic diagram of the treatment days and tumor growth curve of tumor-bearing C57BL / 6 mice using tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK.

[0024] Figure 5 : Schematic diagram comparing the tumor clearance rates of tumor-bearing C57BL / 6 mice after treatment with tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK.

[0025] Figure 6 : Schematic diagram of body weight changes in tumor-bearing C57BL / 6 mice after treatment with tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK as well as a control group (PBS). DETAILED DESCRIPTION

[0026] The specific implementation modes of the present invention are further described in detail below in conjunction with the embodiments.

[0027] The viral vector of the embodiment of the present invention is the vaccinia virus WR (Western Reserve) strain.

[0028] Example 1 Construction of tumor-targeted vaccinia virus vector WRDD-VGF

[0029] (1) Reference sequence: NCBI Reference Sequence: NC_006998.1, design a shuttle vector targeting the TK region and containing the VGF sequence, wherein the upstream sequence of the TK gene is called the left arm (SEQ1), the downstream sequence is called the right arm (SEQ2), and the middle sequence is, in order, the red fluorescent protein RFP (SEQ3), the H5 promoter (SEQ4) and the VGF sequence (SEQ5). The sequence was synthesized by gene synthesis and connected to a plasmid vector to construct the VGF shuttle vector pTK-VGF.

[0030] (2) Based on the TK gene sequence, the gRNA sequence (SEQ6: AACGATAATAGATAGATACGGAA) was designed and inserted into the PB-gRNA vector (Nucleic Acids Res 2014, 42: e155) to construct PB-gRNA-TK.

[0031] (3) CV1 cells were inoculated into six-well plates. When the cells reached a confluence of more than 90%, Cas9 and PB-gRNA-TK were transfected at the same time. After 24 hours, WRΔVGF was infected (two original VGF genes were deleted based on the WR wild type), and pTK-VGF was transfected 2 hours later. After another 48 hours, the mixture of supernatant and cells was collected, frozen and thawed three times, and added to a six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, a monoclonal clone with red fluorescence was picked under a fluorescence microscope. After freezing and thawing the monoclonal solution, 5 μl / well was added to a six-well plate filled with CV1 cells. After 48 hours, a monoclonal clone was picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector WRDD-VGF (see the attached structure). Figure 1 ).

[0032] Depend on Figure 1 It can be seen that WRDD deleted the original two VGF genes and J2R (TK) gene, WR-ΔTK deleted the J2R (TK) gene, and WRDD-VGF deleted the original two VGF genes and J2R (TK) gene, and inserted the VGF gene into the TK region.

[0033] SEQ1

[0034] TTGTGCAAAGCTTTTGCGATCAATAAATGGATCACAACCAGTATCTCTTAAC

[0035] GATGTTCTTCGCAGATGATGATTCATTTTTTAAGTATTTGGCTAGTCAAGATG

[0036] ATGAATCTTCATTATCTGATATATTGCAAATCACTCAATATCTAGACTTTCTGT

[0037] TATTATTATTGATCCAATCAAAAAAATAAATTAGAAGCCGTGGGTCATTGTTAT

[0038] GAATCTCTTTCAGAGGAATACAGACAATTGACAAAATTCACAGACTTTCAA

[0039] GATTTTAAAAAAACTGTTTAACAAGGTCCCTATTGTTACAGATGGAAGGGTC

[0040] AAACTTAATAAAGGATATTTGTTCGACTTTGTGATTAGTTTGATGCGATTCA

[0041] AAAAAGAATCCTCTCTAGCTACCACCGCAATAGATCCTGTTAGATACATAGA

[0042] TCCTCGTCGCAATATCGCATTTTCTAACGTGATGGATATATTAAAGTCGAATA

[0043] AAGTGAACAATAATTAATTCTTTATTGTCATC

[0044] SEQ2

[0045] TATTATATTTTATCTAAAAAACTAAAAATAAACATTGATTAATTTAATAT

[0046] AATACTTAAAAATGGATGTTGTGTCGTTAGATAAACCGTTTATGTATTTTGAG

[0047] GAAATTGATAATGAGTTAGATTACGAACCAGAAAGTGCAAATGAGGTCGCA

[0048] AAAAACTGCCGTATCAAGGACAGTAAACTATTACTAGGAGAATTATTTT

[0049] TTCTTAGTAAGTTACAGCGACACGGTATATTAGATGGTGCCACCGTAGTGTA

[0050] TATAGGATCTGCTCCCGGTACACATATACGTTATTTGAGATCATTTCTATA

[0051] ATTTAGGAGTGATCATCAAATGGATGCTAATTGACGGCCGCCATCATGATCC

[0052] TATTTTAAATGGATTGCGTGATGTGACTCTAGTGACTCGGTTCGTTGATGAG

[0053] GAATATCTACGATCCATCAAAAAACAACTGCATCCTTCTAAGATTTTTAAT

[0054] TTCTGATGTGAGATCCAAACGAGGAGGAAATGAACCTAGTACGGCGGATTTSEQ3

[0055] ATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATGCGCTTCAAGGTGCGC

[0056] ATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCG

[0057] AGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAA

[0058] GGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTA

[0059] CGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGA

[0060] AGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAG

[0061] GACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTTCAGGACGGCTC

[0062] CTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCC

[0063] CGTAATGCAGAAGAAGACTATGGGCTGGGAGGCCTCCACCGAGCGCCTGT

[0064] ACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGAAGCTG

[0065] AAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAA

[0066] GAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACAT

[0067] CACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCCG

[0068] AGGGCCGCCACCACCTGTTCCTGTAG

[0069] SEQ4

[0070] AAAAATTGAAAATAAATACAAAGGTTCTTGAGGGTTGTGTTAAATTGAAAG

[0071] CGAGAAATAATCATAAATA

[0072] SEQ5

[0073] ATGTCGATGAAATATCTGATGTTGTTGTTCGCTGCTATGATAATCAGATCATT

[0074] CGCCGATAGTGGTAACGCTATCGAAACGACATCGCCAGAAATTACAAACGC

[0075] TACAACAGATATTCCAGCTATCAGATTATGCGGTCCAGAGGGAGATGGATAT

[0076] TGTTTACACGGTGACTGTATCCACGCTAGAGATATTGACGGTATGTATTGTA

[0077] GATGCTCTCATGGTTATACAGGCATTAGATGTCAGCATGTAGTATTAGTAGAC

[0078] TATCAACGTTCAGAAAACCCAAACACTACAACGTCATATATCCCATCTCCCG

[0079] GTATTATGCTTGTATTAGTAGGCATTATTATTATTACGTGTTGTCTATTATCTGT

[0080] TTATAGGTTCACTCGACGAACTAAACTACCTATACAAGATATGGTTGTGCCA

[0081] TAA

[0082] SEQ6:AACGATAATAGATACGGAA

[0083] Example 2 Detection of the killing ability of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK on different tumor cells

[0084] Panc-1 (human pancreatic cancer), DT6606 (mouse pancreatic cancer), MC38 (mouse colon cancer), and Hepa1-6 (mouse liver cancer) cells in the logarithmic growth phase were collected, counted, and seeded in a 96-well plate at 3000 cells / well; SW620 (human colon cancer) cells were counted and seeded in a 96-well plate at 5000 cells / well. After 10-12 hours, the cells adhered to the wall, and the WRDD-VGF, WRDD, and WR-ΔTK (WR strain with J2R (TK) gene deleted) virus solutions were gradiently diluted, with the highest concentration being 1000 pfu / cell. The dilutions were performed 10-fold in sequence, and the 11th column was a blank control group.

[0085] On the sixth day, the amount of virus was detected using the CCK-8 (Cell Counting Kit-8) kit and converted into EC50 (i.e., the amount of virus required for each virus to kill 50% of tumor cells. The lower the EC50, the stronger the killing ability of the virus). Figure 2 ,Depend on Figure 2 It can be seen that compared with WRDD and WR-ΔTK, WRDD-VGF has a stronger killing ability against tumor cells.

[0086] Example 3 Effects of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK on vaccinia virus plaque formation

[0087] CV1 cells were inoculated into six-well plates. When the cells reached a confluence of more than 90% the next day, WRDD-VGF, WRDD and WR-ΔTK virus solutions were diluted to 1000 pfu / mL using serum-free culture medium. 1 mL was added to each six-well plate. After marking, the plates were infected for 2 hours. During this period, the plates were gently shaken for 1 minute every half an hour. Then, the sterilized 3% carboxymethyl cellulose was mixed with serum-free culture medium in the same proportion and slowly added to the six-well plates. After culturing for 48 hours, the supernatant was discarded, the plates were rinsed twice with PBS, 200 ul of crystal violet staining solution was added for staining for 10 minutes, and then rinsed twice with PBS. Photos were taken against a white background.

[0088] Depend on Figure 3 It can be seen that the plaque diameters of the WRDD-VGF and WR-ΔTK groups were significantly larger than that of the WRDD group, indicating that VGF affects the spread of virus infection among tumor cells and is required for the formation of vaccinia virus plaques.

[0089] Example 4 Therapeutic effects of tumor-targeted vaccinia virus vectors WRDD-VGF, WRDD and WR-ΔTK on tumor-bearing C57BL / 6 mice

[0090] Pancreatic cancer cell line DT6606 (mouse pancreatic cancer cell line) was subcutaneously inoculated on the right back of 6-7 week-old male C57BL / 6 mice at a rate of 2×10 6 Cells were inoculated into the subcutaneous tissue of the right back of the mouse. After 5-7 days, the tumor reached 80-100 mm. 3 The mice were divided into four groups (7 in each group). The treatment groups were treated with 2×10 8 The mice were treated with WRDD-VGF, WRDD and WR-ΔTK at 500 pfu / mouse. The blank control was phosphate buffered saline (PBS). The mice were treated three times on days 1, 3 and 5. The changes in tumor volume and weight of the mice were measured and recorded twice a week. The experimental results are shown in Figure 4 , Figure 5 , Figure 6 shown.

[0091] Depend on Figure 4 The changes in tumor volume show that compared with the blank control (PBS), the tumors of WRDD-VGF, WRDD, and WR-ΔTK grew more slowly, indicating that they all had therapeutic effects. Compared with WRDD and WR-ΔTK, the tumors of WRDD-VGF hardly grew within 33 days after treatment, and WRDD and WR-ΔTK grew more slowly. After 33 days, WR-ΔTK began to grow slowly, while WRDD and WR-ΔTK grew faster, indicating that WRDD-VGF had the best therapeutic effect.

[0092] Depend on Figure 5 The changes in tumor elimination rate show that WRDD-VGF is more effective in inhibiting tumor growth than WRDD and WR-ΔTK. WRDD-VGF vaccinia virus vector can eliminate 42.9% (3 / 7) of tumors in C57BL / 6 mice, while the tumor elimination rates of WR-ΔTK and WRDD for C57BL / 6 mice are 28.6% (2 / 7) and 14.2% (1 / 7), respectively.

[0093] Depend on Figure 6 It can be seen that the weight of mice increased slowly during the treatment period in the tumor-targeted vaccinia virus vector WRDD-VGF, WRDD and WR-ΔTK treatment groups and the control group PBS, without significant fluctuations, indicating that WRDD-VGF, WR-ΔTK and WRDD had little effect on the weight of mice.

Claims

1. A method for constructing a single-copy VGF gene oncolytic vaccinia virus vector, characterized in that: The oncolytic vaccinia virus vector is a vaccinia virus WR strain, which deletes the TK gene on the basis of deleting the original two copies of the VGF gene, and inserts a single copy of the VGF gene sequence into the TK region to obtain an oncolytic vaccinia virus vector with a single copy of the VGF gene and a TK gene deleted.

2. The method for constructing an oncolytic vaccinia virus vector according to claim 1, characterized in that: The following steps are involved: (1) Reference sequence: NCBI Reference Sequence: NC_006998.1, design a shuttle vector targeting the TK region and containing the VGF sequence; connect the upstream sequence of the TK gene SEQ ID NO: 1, the fluorescent protein RFP sequence SEQ ID NO: 3, the H5 promoter SEQ ID NO: 4, the VGF sequence SEQ ID NO: 5, and the downstream sequence of the TK gene SEQ ID NO: 2 to the plasmid vector in sequence by gene synthesis to construct the VGF shuttle vector pTK-VGF; (2) Based on the TK gene sequence, the gRNA sequence SEQ ID NO: 6 was designed, and the gRNA sequence was inserted into the PB-gRNA vector to construct PB-gRNA-TK; (3) CV1 cells were inoculated into six-well plates. When the cells reached a confluence of more than 90%, Cas9 and PB-gRNA-TK mixed plasmids were transfected at the same time. After 24 hours, WRΔVGF was infected and pTK-VGF was transfected 2 hours later. After another 48 hours, the supernatant and cell mixture were collected, frozen and thawed three times, and added to the six-well plate filled with CV1 cells at 5 μl / well. After 48 hours, monoclonal cells with red fluorescence were picked under a fluorescence microscope. After freezing and thawing the monoclonal solution, 5 μl / well was added to the six-well plate filled with CV1 cells. After 48 hours, monoclonal cells were picked again until all of them showed red fluorescence under a fluorescence microscope, which was the vaccinia virus vector WRDD-VGF.

3. Use of the oncolytic vaccinia virus vector obtained by the construction method according to claim 2 in the preparation of drugs for treating solid tumors.

4. The use according to claim 3, characterized in that The solid tumor includes pancreatic cancer, colon cancer, liver cancer or gastric cancer.

Images