A method and kit for rapid identification of plant cell autophagy-related proteins based on tobacco transient expression system

Abstract

The present invention uses a method and kit for quickly identifying plant cell autophagy-related proteins based on a tobacco transient expression system. Agrobacterium expressing GFP fluorescently labeled ATG8a protein and Agrobacterium expressing mCherry fluorescently labeled test protein are constructed, the Agrobacterium is configured into a suspension, mixed and injected into the back of tobacco leaves, and the tobacco is cultured until GFP fluorescently labeled ATG8a protein and mCherry fluorescently labeled test protein are expressed; then concanavalin A is injected, tobacco leaves are cultured in sterile wet filter paper, and the expression of the test protein in the vacuole of tobacco leaf cells is observed. The method is used to accurately and effectively identify plant cell autophagy-related proteins in a relatively short time, and Arabidopsis thaliana endomanosidase is identified as an autophagy protein, and the TAIR database number of the Arabidopsis thaliana endomanosidase is AT1G09010.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method and a kit for rapidly identifying plant cell autophagy-related proteins based on a tobacco transient expression system. Background Art

[0002] Cellular autophagy is an important metabolic pathway that is evolutionarily conserved. Through this autophagic pathway, cells import intracellular substances to be degraded, such as misfolded proteins and impaired organelles, into vacuoles in yeast or plants, or lysosomes in animal cells for degradation. During the autophagic process, a series of autophagy-related genes (AuTopha Gy-related genes, referred to as ATG genes) encode products that coordinate with each other and precisely regulate the formation of autophagosomes (Marshall, RS, and Vierstra, RD (2018). Autophagy: the master of bulk and selective recycling. Annu. Rev. Plant Biol. 29, 173-208. doi: 0.1146 / annur ev-arplant-042817-040606.). Among them, ATG8 (LC3 in animal cells) is the core protein in the autophagic pathway and plays an important role in the formation and maturation of autophagosomes. Lipidated ATG8 is attached to the inner membrane of the autophagosome and is responsible for recruiting substrates to be degraded. When the autophagosome fuses with the vacuole or lysosome, the ATG8 protein on its outer membrane is released and recycled by ATG4, while the ATG8 on the inner membrane will be introduced into the vacuole along with the substrate to be degraded and degraded. Therefore, ATG8 is considered to be a landmark protein of the autophagy pathway, and co-localization analysis with ATG8 has been widely used to study autophagy-related proteins or degradation substrates.

[0003] Previous researchers generally used stable transfection materials or transient expression in protoplasts to perform co-localization analysis with ATG8. However, the co-localization analysis method using stable transfection materials is time-consuming, while the co-localization analysis method using transient expression in protoplasts is complicated and difficult to master. Therefore, there is an urgent need for an efficient and accurate method to identify autophagy-related proteins and degradation substrates in plant cells. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and provide a method and a kit for rapidly expressing plant cell autophagy-related proteins based on a tobacco transient expression system.

[0005] The first object of the present invention is to provide a method for identifying plant cell autophagy-related proteins.

[0006] The second object of the present invention is to provide a kit for identifying plant cell autophagy-related proteins.

[0007] The third object of the present invention is to provide the use of endomannosidase in promoting the autophagy function of plant cells.

[0008] In order to achieve the above object, the present invention is implemented by the following scheme:

[0009] A method for identifying plant cell autophagy-related proteins, comprising the following steps:

[0010] S1: constructing an engineering bacterium expressing a fluorescently labeled ATG8a protein and an engineering bacterium expressing a fluorescently labeled test protein, respectively. The NCBI accession number of the gene expressing the ATG8a protein is: NM_118319.4;

[0011] S2: suspending the engineered bacteria in step S1 in suspensions respectively to obtain an engineered bacteria suspension expressing the fluorescently labeled ATG8a protein and an engineered bacteria suspension expressing the fluorescently labeled protein to be tested, wherein the suspension contains MgCl2, acetosyringone and 2-morpholineethanesulfonic acid;

[0012] S3: mixing the engineered bacterial suspension expressing the fluorescently labeled ATG8a protein obtained in step S2 and the engineered bacterial suspension expressing the fluorescently labeled test protein, injecting the mixture onto the back of tobacco leaves to form a water-stained area, marking the water-stained area of ​​the tobacco leaves, and culturing the tobacco leaves until the fluorescently labeled ATG8a protein and the fluorescently labeled test protein are expressed;

[0013] S4: After the fluorescently labeled ATG8a protein and the fluorescently labeled test protein are expressed in step S3, concanavalin A is injected into the water-soaked area on the back of the tobacco leaf, and the tobacco leaves are cultured in sterile moist filter paper to observe the expression of the test protein in the vacuole of the tobacco leaf cells. The expression of the test protein is detected in the vacuole of the tobacco leaf cells, indicating that the test protein is related to the autophagy-related pathway of plant cells.

[0014] Preferably, in step S1, the color of the fluorescent labeling of the ATG8a protein is different from the color of the fluorescent labeling of the protein to be detected.

[0015] More preferably, in step S1, the fluorescent marker for labeling the ATG8a protein is GFP, and the fluorescent marker for labeling the protein to be tested is mCherry.

[0016] Preferably, in step S2, the suspension contains 9-11 mM MgCl2, 90-110 μM acetosyringone and 9-11 mM 2-morpholineethanesulfonic acid, and the pH is adjusted to 5.5-6.

[0017] More preferably, in step S2, the suspension contains 10 mM MgCl2, 100 μM acetosyringone and 10 mM 2-morpholineethanesulfonic acid, and the pH is adjusted to 5.8.

[0018] Preferably, in step S3, the volume ratio of the engineering bacteria suspension expressing the fluorescently labeled ATG8a protein to the engineering bacteria suspension expressing the fluorescently labeled protein to be tested is 0.8-1.2:1.

[0019] More preferably, the volume ratio of the engineering bacteria suspension expressing the fluorescently labeled ATG8a protein and the engineering bacteria suspension expressing the fluorescently labeled protein to be tested in step S3 is 1:1.

[0020] Preferably, in step S3, the tobacco culture condition temperature is 27-29° C., the culture light to dark time ratio is 1-2:1, and the culture time is 24-36 hours.

[0021] More preferably, in step S3, the tobacco culture condition temperature is 28° C., the culture light to dark time ratio is 2:1, and the culture time is 24 to 36 hours.

[0022] Preferably, the OD600 of the engineered bacteria in the engineered bacteria suspension in step S3 is 1.9-2.1.

[0023] More preferably, the OD600 of the engineered bacteria in the engineered bacteria suspension in step S3 is 2.

[0024] Preferably, the engineered bacteria is Agrobacterium.

[0025] Preferably, the concentration of Concanavalin A in step S4 is 0.8-1.2 μM.

[0026] More preferably, the concentration of Concanavalin A in step S4 is 1 μM.

[0027] Preferably, in step S4, the filter paper is moistened with MS sugar-free liquid culture medium, and the tobacco leaves are spread between the filter papers and cultured in the dark at 27-29° C. for 24-36 hours, wherein the MS sugar-free liquid culture medium contains MS salt, 2-morpholineethanesulfonic acid and water.

[0028] More preferably, in step S4, the tobacco leaves are cultured at 28° C. in the dark for 36 hours.

[0029] More preferably, in step S4, the MS sugar-free liquid culture medium contains 4-5 g / L MS salt and 0.4-0.6 g / L 2-morpholineethanesulfonic acid.

[0030] More preferably, in step S4, the MS sugar-free liquid culture medium contains 4.43 g / L MS salt and 0.5 g / L 2-morpholineethanesulfonic acid.

[0031] More preferably, in step S4, the concanavalin A is obtained by diluting a concanavalin A dimethyl sulfoxide solution with the MS sugar-free liquid culture medium, and the concanavalin A dimethyl sulfoxide solution contains 490-510 μM concanavalin A.

[0032] More preferably, the Concanavalin A dimethyl sulfoxide solution contains 500 μM Concanavalin A.

[0033] A kit for identifying plant cell autophagy-related proteins, the kit containing one or more of the engineered bacteria expressing the fluorescently labeled ATG8a protein, a suspension, a tobacco plant, concanavalin A, filter paper and / or a syringe, wherein the suspension contains MgCl2, acetosyringone and / or 2-morpholineethanesulfonic acid.

[0034] Preferably, the kit further comprises a plasmid for expressing a fluorescent protein for labeling the protein to be tested.

[0035] Preferably, the fluorescent labeling color of the labeled ATG8a protein is different from the fluorescent labeling color of the protein to be detected.

[0036] More preferably, the fluorescent marker for labeling the ATG8a protein is GFP, and the fluorescent marker for labeling the protein to be tested is mCherry.

[0037] Preferably, the kit further comprises MS sugar-free liquid culture medium for wetting the filter paper, wherein the MS sugar-free liquid culture medium comprises MS salt, 2-morpholineethanesulfonic acid and water.

[0038] More preferably, the MS sugar-free liquid culture medium contains 4-5 g / L MS salt and 0.4-0.6 g / L 2-morpholineethanesulfonic acid.

[0039] More preferably, the MS sugar-free liquid culture medium contains 4.43 g / L MS salt and 0.5 g / L 2-morpholineethanesulfonic acid.

[0040] Preferably, the engineered bacteria is Agrobacterium.

[0041] Application of endomannosidase in promoting autophagy function of plant cells, wherein the TAIR database number of the endomannosidase is AT1G09010.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The present invention uses a method and kit for quickly identifying plant cell autophagy-related proteins based on a tobacco transient expression system. Agrobacterium expressing GFP fluorescently labeled ATG8a protein and Agrobacterium expressing mCherry fluorescently labeled test protein are constructed, the Agrobacterium is configured into a suspension, mixed and injected into the back of tobacco leaves, and the tobacco is cultured until GFP fluorescently labeled ATG8a protein and mCherry fluorescently labeled test protein are expressed; then concanavalin A is injected, tobacco leaves are cultured in sterile wet filter paper, and the expression of the test protein in the vacuole of tobacco leaf cells is observed. The method is used to accurately and effectively identify plant cell autophagy-related proteins in a relatively short time, and Arabidopsis thaliana endomanosidase is identified as an autophagy protein, and the TAIR database number of the Arabidopsis thaliana endomanosidase is AT1G09010, which provides a powerful method and detection tool for subsequent research on plant cell autophagy pathways and analysis of their functions and regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The figure is a tobacco transient expression vector used for co-localization analysis with ATG8a protein; A is a simple schematic diagram of the construction of pEGAD-GFP-AtATG8a vector using a one-step recombination cloning method. B is the plasmid map of the pEGAD-GFP-AtATG8a vector; C is the plasmid map of the pEGAD-POI-mCherry vector. The promoter, terminator, open reading frame and various restriction sites are marked on the plasmid map, 35S: cauliflower mosaic virus 35S promoter; BlpR: BASTA gene; IS1: insertion sequence; KanR: kanamycin resistance gene; LB: left border; NOS: terminator; oriV: origin of replication; POI, target gene. RB: right border; TetR: repressor of tetracycline resistance element; trfA: replication initiator protein; TraJ: positive regulator of F plasmid transfer (tra) operon.

[0045] Figure 2 This is the experimental flow chart of tobacco transient expression and concanavalin A inhibitor treatment; A is the suspended Agrobacterium solution; B is the injected tobacco; C is the marked injection site; D is the injection of concanavalin A solution; E is the cut leaves; F is spread flat on pre-moistened filter paper; G is the surface covered with filter paper; H is wrapped in tin foil and cultured in the dark.

[0046] Figure 3Schematic diagram of co-localization analysis of target protein POI-mCherry and GFP-ATG8a. A shows the protein expression observed by fluorescence confocal microscopy in Nicotiana benthamiana leaves when negative control mCherry and GFP-ATG8a are co-expressed; B shows the protein expression observed by fluorescence confocal microscopy in Nicotiana benthamiana leaves when POI-mCherry and GFP-ATG8a are co-expressed; -ConA means no concanavalin A solution is added, and +-ConA means concanavalin A solution is injected; "A" and "B" in Merged represent autophagosomes, and the scale is 10μM. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0048] The pEGAD vector was purchased from the Arabidopsis Biological Resource Center, catalog number CD3-389. In addition, other tobacco transient expression vectors with fluorescent protein tags can also be used.

[0049] The phenol-free and chloroform-free column-based plant RNA extraction kit is a product of Beijing Tianenze Gene Technology Co., Ltd., with the catalog number 160906-50.

[0050] Concanavalin A is a product of Anolun (Beijing) Biotechnology Co., Ltd., with the product catalog number of BVT-0237-C100.

[0051] II One Step Cloning Kit is a product of Novazonics, with the catalog number of C112-01.

[0052] HiScript II Q RT SuperMix for qPCR (+gDNA wiper) KIT reverse transcription kit is a product of Novozymes, with the catalog number of R222-01.

[0053] Formula of Agrobacterium suspension: 10 mM MgCl2, 100 μM Acetosyringone, 10 mM 2-morpholineethanesulfonic acid (MES), adjusted to pH = 5.8.

[0054] MS sugar-free liquid culture medium formula: MS salt (Murashige & Skoog with Vitamins) 4.43 g, 2-morpholineethanesulfonic acid (MES) 0.5 g, distilled water to 1 L, adjust pH = 55.7.

[0055] Preparation method of Concanavalin A mother solution (500 μM): Dissolve 100 μg of Concanavalin A in 230.9 μL of dimethyl sulfoxide, and then divide into portions (50 μL / portion) and store at -20°C.

[0056] Example 1 Construction of expression vectors for cell autophagy marker protein GFP-ATG8a and target protein POI-mCherry

[0057] 1. Experimental Methods

[0058] like Figure 1 As shown, the one-step cloning technique was used to construct GFP-AtATG8a and POI-mCherry expression vectors. The specific steps are as follows:

[0059] (1) Amplification of Arabidopsis thaliana AtATG8a (AT4G21980) gene sequence: First, total RNA from 2-week-old Arabidopsis thaliana seedlings was extracted using a phenol-free and chloroform-free column-type plant RNA extraction kit (Tian Enze, 160906-50). Then, 1 μg of total RNA was taken and reverse transcribed into cDNA using a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) KIT reverse transcription kit (Novozyme, R222-01). The AtATG8a gene was then amplified by PCR. The NCBI accession number of the AtATG8a gene is: NM_118319.4, and the primer sequences are as follows:

[0060] ATG8a-Forward:AATTGATGGCTAAGAGTTCCTTC;

[0061] ATG8a-Reverse: GTGGATCCTCATCCAAAAGTGTTCTCT.

[0062] To ensure the success of the subsequent recombination cloning, the primers must overlap with the vector by 20 bp upstream and downstream of the fragment insertion site.

[0063] (2) Construction of pEGAD-GFP-AtATG8a expression vector: digested with restriction endonucleases EcoRI and BamHI in a 37°C water bath for 4 h, run on agarose gel, and recover the linearized pEGAD vector. II One Step Cloning Kit (Novozymes, C112-01) was used to insert the AtATG8a PCR fragment obtained in step 1 into the pEGAD vector by recombination cloning to obtain the pEGAD-GFP-AtATG8a expression vector.

[0064] (3) E. coli transformation: The reaction product of step 2 was transformed into E. coli DH5α by heat shock method, and the bacterial solution was spread on LB solid medium containing 50 mg / mL Kan antibiotic and inverted in a 37°C incubator for 12 to 16 h.

[0065] (4) Vector identification: Pick a single colony grown on the culture medium in step (3) and place it in a 1.5 mL centrifuge tube containing 400 μL of L LB liquid culture medium, mark it accordingly, and culture it at 37°C, 200 rpm for 2 to 4 hours. Then take 1 to 2 μL of the bacterial solution as a template for PCR verification.

[0066] (5) The constructed pEGAD-GFP-AtATG8a expression vector was introduced into Agrobacterium GV3101 by freeze-thaw method to obtain Agrobacterium containing the pEGAD-GFP-AtATG8a expression vector.

[0067] The GFP fluorescent protein in the pEGAD vector was replaced with the mCherry fluorescent protein, and the AtATG8a gene was replaced with the gene expressing the protein to be tested (POI) to construct the pEGAD-POI-mCherry expression vector. The pEGAD-POI-mCherry expression vector was then introduced into Agrobacterium GV3101 using the same freeze-thaw method to obtain Agrobacterium containing the pEGAD-POI-mCherry expression vector.

[0068] The GFP fluorescent protein in the pEGAD vector was replaced with the mCherry fluorescent protein, and the pEGAD-mCherry expression vector was introduced into Agrobacterium GV3101 using the same freeze-thaw method to obtain Agrobacterium containing the pEGAD-mCherry expression vector as a control.

[0069] Example 2 Tobacco transient expression of GFP-ATG8a and POI-mCherry

[0070] 1. Experimental Methods

[0071] (1) The positive monoclonal colonies transformed with Agrobacterium containing the pEGAD-GFP-AtATG8a expression vector, the pEGAD-POI-mCherry expression vector and the pEGAD-mCherry expression vector (as a control) obtained in Example 1 were picked respectively, and added to LB liquid culture medium containing 50 μg / mL kanamycin, 50 μg / mL rifampicin and 10 μg / mL gentamicin, and cultured at 28°C with shaking at 250 rpm overnight.

[0072] (2) The overnight culture solution of step (1) was centrifuged at 6000×g for 10 min to collect the bacteria, and then suspended with the freshly prepared Agrobacterium suspension, and the Agrobacterium concentration was adjusted to OD600=2.0, and then placed at room temperature for more than 4 h to obtain an Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector and an Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector (see Figure 2 A) and Agrobacterium suspension containing pEGAD-mCherry expression vector.

[0073] (3) Mix the Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector obtained in step (2) with the Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector in equal volumes; mix the Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector with the Agrobacterium suspension containing the pEGAD-mCherry expression vector in equal volumes; then inject the mixed suspension into 3-4 week-old tobacco leaves ( Figure 2 B), the injection volume is about 100μL. Use a marker to mark the water-stained area of ​​the tobacco leaf ( Figure 2 C).

[0074] (4) The tobacco injected with the label in step (3) is placed in an artificial climate chamber and cultured for 24 to 36 hours at 28° C. and long daylight (16 hours of light / 8 hours of darkness).

[0075] Example 3 Concanavalin A inhibitor treatment

[0076] 1. Experimental Methods

[0077] (1) Example 2 After the tobacco culture was completed, a leaf disc was punched near the injection pinhole using a 6 mm diameter punch, and then the expression level of the fluorescent fusion protein (GFP-ATG8a and POI-mCherry) in the leaf disc was detected using a fluorescence microscope. If the fluorescent fusion protein in the experimental group was strongly expressed compared with the leaves not injected with the Agrobacterium suspension, it indicated that the fluorescent fusion protein was well expressed.

[0078] (2) Treatment with concanavalin A, a specific inhibitor of plant cell vacuolar ATPase (V-ATPase): The concanavalin A stock solution was diluted 500 times with MS sugar-free liquid medium, and then the diluted concanavalin A solution was injected from the back of the leaf with a 1 mL needle-free syringe ( Figure 2 D), the leaves are moistened after injection, about 500 μL. At the same time, the same volume of MS sugar-free liquid medium without concanavalin A is used as a control to inject tobacco leaves. After the concanavalin A solution or MS sugar-free liquid medium is completely absorbed (about 15 minutes), carefully cut the injected tobacco leaves with scissors ( Figure 2 E).

[0079] (3) Remove the petiole of the leaf cut in step (2) and spread it flat on a sterile culture dish covered with filter paper, and moisten the filter paper with MS sugar-free liquid culture medium ( Figure 2 F), and then gently smooth it with your hands to ensure that the leaf is in full contact with the filter paper and there are no bubbles between the two. Finally, cover the leaf with another layer of filter paper moistened with MS sugar-free liquid medium ( Figure 2 G in.

[0080] (4) Wrap the culture dish processed in step (3) with tin foil ( Figure 2 The culture medium was cultured in an artificial climate box at 28°C in the dark for 36 h.

[0081] Example 4 Laser confocal microscopy observation

[0082] (1) Use a blade to cut the leaves cultured in Example 3 into 0.5 × 0.5 cm squares along the marked parts of Example 2, stick them on a glass slide, moisten them with a small amount of ddH2O, and place them on a stage.

[0083] (2) The localization of GFP-ATG8a and POI-mCherry was observed using a laser confocal microscope Zeiss LSM 800 (Carl Zeiss, https: / / www.zeiss.com). The GFP excitation light was 488 nm and the detection light was 505-550 nm; the mCherry excitation light was 543 nm and the detection light was 585-615 nm.

[0084] Example 5 Identification of the autophagy correlation of Arabidopsis thaliana endonucleoside

[0085] 1. Experimental Methods

[0086] The autophagy relevance of Arabidopsis thaliana endomannosidase (TAIR ID: AT1G09010) was identified using the methods of Examples 1 to 4.

[0087] 2. Experimental Results

[0088] like Figure 3 As shown, when no concanavalin A inhibitor was used ( Figure 3 -ConA in A and B), GFP-ATG8a, POI-mCherry and mCherry were all expressed in the cytoplasm. When treated with concanavalin A inhibitor ( Figure 3 In the A and B +ConA), many punctate bodies marked by GFP-ATG8a can be detected in the vacuole. In addition, POI-mCherry-marked punctate bodies also accumulated in the vacuole and co-localized with GFP-ATG8a. However, mCherry did not form punctate bodies. The above results indicate that the protein to be tested, POI, that is, Arabidopsis thaliana endomannosasidase (TAIR ID: AT1G09010), is related to the autophagy pathway.

[0089] Example 6 A kit for identifying plant cell autophagy-related proteins

[0090] 1. Composition

[0091] The Agrobacterium expressing GFP fluorescently labeled ATG8a protein (pEGAD-GFP-AtATG8a vector) was constructed in the same manner as in Example 1;

[0092] pEGAD plasmid expressing mCherry fluorescent protein to label the protein to be tested;

[0093] Agrobacterium suspension, formula: 10 mM MgCl2, 100 μM acetosyringone, 10 mM 2-morpholineethanesulfonic acid (MES), adjusted to pH = 5.8;

[0094] Tobacco plant; Concanavalin A; filter paper; syringe;

[0095] MS sugar-free liquid culture medium, formula: MS salt (Murashige & Skoog with Vitamins) 4.43g / L, 2-morpholineethanesulfonic acid (MES) 0.5gg / L, distilled water as solvent, adjusted pH = 55.7.

[0096] 2. Usage

[0097] 1. According to the method of Example 1, Agrobacterium containing the pEGAD-POI-mCherry expression vector is obtained, and POI is the protein to be tested.

[0098] 2. (1) Pick the positive monoclonal colonies transformed with Agrobacterium containing the pEGAD-GFP-AtATG8a expression vector and the pEGAD-POI-mCherry expression vector, add them into LB liquid culture medium containing 50 μg / mL kanamycin, 50 μg / mL rifampicin and 10 μg / mL gentamicin, and culture them at 28°C with shaking at 250 rpm overnight.

[0099] (2) The overnight culture solution of step (1) was centrifuged at 6000×g for 10 min to collect the bacteria, and then suspended with the freshly prepared Agrobacterium suspension, and the Agrobacterium concentration was adjusted to OD600=2.0, and then placed at room temperature for more than 4 h to obtain an Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector and an Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector.

[0100] (3) Mix the Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector obtained in step (2) with the Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector in equal volumes; inject the mixed suspension into 3-4 week-old tobacco leaves from the back of the leaves using a syringe, with the injection volume of about 100 μL. Mark the water-stained area of ​​the tobacco leaves.

[0101] (4) The tobacco injected with the label in step (3) is placed in an artificial climate chamber and cultured for 24 to 36 hours at 28° C. and long daylight (16 hours of light / 8 hours of darkness).

[0102] 3. (1) After the tobacco culture is completed, use a 6 mm diameter puncher to punch a leaf disc near the injection pinhole, and then use a fluorescence microscope to detect the expression level of the fluorescent fusion protein (GFP-ATG8a and POI-mCherry) in the leaf disc. If the fluorescent fusion protein in the experimental group is strongly expressed compared with the leaves that have not been injected with Agrobacterium suspension, it indicates that the fluorescent fusion protein is well expressed.

[0103] (2) Concanavalin A treatment: dilute the Concanavalin A stock solution 500 times with MS sugar-free liquid medium, and then inject the diluted Concanavalin A solution from the back of the leaf with a syringe until the leaf is wet, about 500 μL. After the Concanavalin A solution or MS sugar-free liquid medium is completely absorbed (about 15 minutes), carefully cut the injected tobacco leaves with scissors.

[0104] (3) Remove the petiole of the leaf cut in step (2) and lay it flat on a sterile culture dish covered with filter paper. The filter paper is moistened with MS sugar-free liquid medium and smoothed to ensure that the leaf is in full contact with the filter paper and there are no bubbles between the two. Finally, cover the leaf with another layer of filter paper moistened with MS sugar-free liquid medium.

[0105] (4) Wrap the culture dish treated in step (3) with tin foil and culture it in an artificial climate box at 28° C. in the dark for 36 hours.

[0106] 4. (1) Use a blade to cut the leaves cultured in step 4 into 0.5 × 0.5 cm squares along the marked parts of step 2. Stick them on a glass slide, moisten them with ddH2O, and place them on a stage.

[0107] (2) The localization of GFP-ATG8a and POI-mCherry was observed using a laser confocal microscope Zeiss LSM 800 (Carl Zeiss, https: / / www.zeiss.com). The GFP excitation light was 488 nm and the detection light was 505-550 nm; the mCherry excitation light was 543 nm and the detection light was 585-615 nm.

[0108] 3. Determination method

[0109] GFP-ATG8a-labeled punctate bodies and POI-mCherry-labeled punctate bodies were detected in the vacuole, indicating that POI-mCherry co-localized with GFP-ATG8a. The protein POI to be tested is related to the autophagy pathway and is an autophagy-related protein used to promote the autophagy function of plant cells.

[0110] Example 7

[0111] 1. Composition

[0112] Same as Example 6.

[0113] 2. Usage

[0114] Different from Example 6, the volume ratio of the Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector to the Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector is 1.2:1.

[0115] Concanavalin A was used at a concentration of 1.2 μM.

[0116] The conditions for culturing tobacco leaves in MS sugar-free liquid medium were 27°C for 24 h.

[0117] 3. Determination method

[0118] Same as Example 6.

[0119] The kit used in Example 7 is effective in identifying the autophagy correlation of the protein to be tested.

[0120] Example 8

[0121] 1. Composition

[0122] Same as Example 6.

[0123] 2. Usage

[0124] Different from Example 6, the volume ratio of the Agrobacterium suspension containing the pEGAD-GFP-AtATG8a expression vector to the Agrobacterium suspension containing the pEGAD-POI-mCherry expression vector is 0.8:1.

[0125] Concanavalin A was used at a concentration of 0.8 μM.

[0126] The difference from Example 6 is that the conditions for culturing tobacco leaves in the MS sugar-free liquid culture medium are 29° C. and 36 h.

[0127] 3. Determination method

[0128] Same as Example 6.

[0129] The kit used in Example 8 is effective in identifying the autophagy correlation of the protein to be tested.

[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A method for identifying plant cell autophagy-related proteins, characterized in that: The following steps are involved: S1: constructing an engineering bacterium expressing a fluorescently labeled ATG8a protein and an engineering bacterium expressing a fluorescently labeled test protein respectively, the NCBI accession number of the gene expressing the ATG8a protein is: NM_118319.4, and the primer sequences are: AATTGATGGCTAAGAGTTCCTTC, GTGGATCCTCATCCAAAAGTGTTCTCT; S2: suspending the engineered bacteria in step S1 in suspensions respectively to obtain an engineered bacteria suspension expressing the fluorescently labeled ATG8a protein and an engineered bacteria suspension expressing the fluorescently labeled protein to be tested, wherein the suspension contains MgCl2, acetosyringone and 2-morpholineethanesulfonic acid; S3: mixing the engineered bacterial suspension expressing the fluorescently labeled ATG8a protein and the engineered bacterial suspension expressing the fluorescently labeled test protein obtained in step S2, injecting the mixture onto the back of tobacco leaves to form a water-stained area, marking the water-stained area of ​​the tobacco leaves, and culturing the tobacco until the fluorescently labeled ATG8a protein and the fluorescently labeled test protein are expressed; the volume ratio of the engineered bacterial suspension expressing the fluorescently labeled ATG8a protein to the engineered bacterial suspension expressing the fluorescently labeled test protein is 0.8-1.2:1; S4: After the fluorescently labeled ATG8a protein and the fluorescently labeled test protein are expressed in step S3, concanavalin A is injected into the water-soaked area on the back of the tobacco leaf, and the tobacco leaves are cultured in sterile moist filter paper to observe the expression of the test protein in the vacuole of the tobacco leaf cells. The expression of the test protein is detected in the vacuole of the tobacco leaf cells, indicating that the test protein is related to the autophagy-related pathway of plant cells.

2. The method for identifying plant cell autophagy-related proteins according to claim 1, characterized in that: In step S1, the color of the fluorescent marker that marks the ATG8a protein is different from the color of the fluorescent marker of the protein to be tested.

3. The method for identifying plant cell autophagy-related proteins according to claim 1, characterized in that: The concentration of Concanavalin A in step S4 is 0.8-1.2 µM.

4. The method for identifying plant cell autophagy-related proteins according to claim 1, characterized in that: In step S4, the filter paper is moistened with MS sugar-free liquid culture medium, and the tobacco leaves are spread between the filter papers and cultured in the dark at 27-29° C. for 24-36 hours. The MS sugar-free liquid culture medium contains MS salt, 2-morpholineethanesulfonic acid and water.

5. A kit for identifying plant cell autophagy-related proteins, characterized in that: The kit contains the engineered bacteria expressing the fluorescently labeled ATG8a protein as described in claim 1, a suspension, a tobacco plant, concanavalin A, a filter paper and a syringe, and the suspension contains MgCl2, acetosyringone and / or 2-morpholineethanesulfonic acid.

6. The kit for identifying plant cell autophagy-related proteins according to claim 5, characterized in that: The kit also contains a plasmid for expressing a fluorescent protein that marks the protein to be tested.

7. The kit for identifying plant cell autophagy-related proteins according to claim 5, characterized in that: The color of the fluorescent marker that marks the ATG8a protein is different from the color of the fluorescent marker of the protein to be tested.

8. The kit for identifying plant cell autophagy-related proteins according to claim 5, characterized in that: The kit also contains MS sugar-free liquid medium for wetting the filter paper, wherein the MS sugar-free liquid medium contains MS salt, 2-morpholineethanesulfonic acid and water.

Images