Recombinant bacteria producing β-glucosidase from Arctic and its application

Abstract

The present invention relates to a recombinant bacterium producing Arctic-derived β-glucosidase and its application, belonging to the field of biotechnology. The target gene of the recombinant bacterium is β-glucosidase derived from Arctic bacteria Arc12, the nucleotide sequence of which is shown in SEQ ID No: 1, and the nucleotide sequence of the β-glucosidase with signal peptide is shown in SEQ ID No: 2, the signal peptide is Bacillus subtilis signal peptide CitH, and the expression vector is Escherichia coli-Bacillus shuttle plasmid pMA5, which contains constitutive promoter P HpaII The expression strain is Bacillus subtilis WB600. The present invention provides a method for secretory expression of the enzyme under specific promoter, signal peptide, and strain conditions. This method is simple to operate and can be achieved without the need for special inducers. Secretory expression of the enzyme eliminates the need for cell disruption in downstream processing, reducing production costs and possessing promising application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a recombinant bacterium producing Arctic-derived beta-glucosidase and an application thereof. Background Art

[0002] β-Glucosidase (EC 3.2.1.21) hydrolyzes the terminal non-reducing β-D-glucose bonds in oligosaccharides, releasing the glycosyl β-D-glucose and the corresponding ligand. β-Glucosidase is widely distributed in various organisms and is primarily used in cellulose complex enzyme systems to catalyze the final step in the hydrolysis of lignocellulose, converting cellobiose to glucose. Lignocellulose is an important renewable organic resource. After hydrolysis, it can be used as a raw material for clean fuels and chemical products, including fuel ethanol and xylitol. β-Glucosidase is also used in industrial production, such as the bioconversion of soy isoflavones and wine flavoring.

[0003] The production of natural β-glucosidase is limited, and heterologous expression is often required to obtain it. Bacillus subtilis is a Gram-positive bacterium. As a biosafety bacterium, the expressed protein does not contain endotoxins. Unlike Escherichia coli, Bacillus subtilis has only one cell membrane and can release proteins directly into the culture medium, eliminating the step of cell disruption and greatly reducing the production cost of downstream process treatment. Bacillus subtilis usually expresses exogenous proteins by introducing expression plasmids. The promoters of Bacillus subtilis expression plasmids are mainly divided into inducible and constitutive types. Different promoters have different expression levels of specific proteins, which need to be explored. Commonly used inducible promoters P grac , using IPTG as an inducer to start protein expression, but IPTG has certain toxicity to cells, which limits its application; P xyl The promoter is xylose-inducible, but xylose is expensive and not suitable for large-scale application; the constitutive promoter P aprE and P HpaII Induction is not required, and heterologous proteins can be directly expressed. Secretory expression of most proteins requires the addition of a signal peptide to the N-terminus of the protein, which is secreted into the extracellular space via various secretory pathways. Only a few proteins do not require a signal peptide and are secreted into the extracellular space via atypical secretory pathways. Bacillus subtilis has 294 known signal peptides, and currently, no prediction system can predict which signal peptide is used for a specific protein.

[0004] In previous work, we isolated a β-glucosidase from the Arctic bacterium Arc12. This enzyme can hydrolyze a variety of glycoside substrates and exhibits ethanol tolerance, showing promising applications in the simultaneous saccharification and fermentation of lignocellulose to produce bioethanol. An intracellular expression system for this enzyme in Escherichia coli has been established, but a secretory expression system is not yet available. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant bacterium producing β-glucosidase from the Arctic and its application. The present invention utilizes a specific promoter to increase the expression level and a specific signal peptide to increase the secretory expression level without the need for induction by chemical substances, thereby achieving the secretory expression of β-glucosidase from the Arctic bacterium Arc12, and has broad application prospects in industrial enzyme production.

[0006] The present invention is achieved through the following technical solutions:

[0007] A recombinant bacterium producing β-glucosidase from the Arctic, wherein the target gene of the recombinant bacterium is β-glucosidase from the Arctic bacterium Arc12, the nucleotide sequence of which is shown in SEQ ID No: 1, the nucleotide sequence of the β-glucosidase with signal peptide is shown in SEQ ID No: 2, the signal peptide is the Bacillus subtilis signal peptide CitH, the expression vector is the Escherichia coli-Bacillus shuttle plasmid pMA5, containing the constitutive promoter P HpaII ; The expression strain is Bacillus subtilis WB600.

[0008] The present invention also provides an application of expressing the β-glucosidase by utilizing the recombinant bacteria.

[0009] The beneficial effects of the present invention compared with the prior art are as follows:

[0010] The present invention provides a recombinant bacterium for secretory expression of β-glucosidase derived from Arctic bacteria Arc12. The secretory expression of the enzyme is achieved by utilizing a specific promoter, a signal peptide, and a strain combination. Compared with known methods, the present invention achieves efficient secretory expression of the β-glucosidase derived from Arctic bacteria Arc12, does not require the addition of an inducer and a cell disruption step, can effectively reduce production costs, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The PCR results of β-glucosidase gene are shown in Figure 1. Lane 1, recombinant β-glucosidase gene; Lane 2, DNA marker; Lane 3, β-glucosidase gene with N-terminal signal peptide.

[0012] Figure 2 The results of pMA5 enzyme digestion; lane 1, DNA marker; lane 2, pMA5 plasmid; lane 3, pMA5 plasmid enzyme digestion product;

[0013] Figure 3 P aprEElectrophoresis diagram of secretory expression of recombinant β-glucosidase controlled by the promoter; Lane 1, WB600 empty bacteria; Lane 2, fermentation supernatant of WB600 empty bacteria; Lane 3, recombinant bacteria containing the recombinant expression vector pBE-nbgl; Lane 4, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pBE-nbgl; Lane 5, protein marker;

[0014] Figure 4 P HpaII Electrophoresis diagram of secretory expression of recombinant β-glucosidase controlled by the promoter; Lane 1, protein marker; Lane 2, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-bgl (24h); Lane 3, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-bgl (48h); Lane 4, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-bgl (72h); Lane 5, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-nbgl Fermentation supernatant (24 h); Lane 6, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-nbgl (48 h); Lane 7, fermentation supernatant of recombinant bacteria containing the recombinant expression vector pMA-nbgl (72 h); Lane 8, fermentation supernatant of strain containing the pMA5 empty vector (24 h); Lane 9, fermentation supernatant of strain containing the pMA5 empty vector (48 h); Lane 10, fermentation supernatant of strain containing the pMA5 empty vector (72 h);

[0015] Figure 5 P HpaII Promoter-controlled secretory expression activity of recombinant β-glucosidase; light gray, fermentation supernatant containing recombinant bacteria expressing the recombinant expression vector pMA-bgl; dark gray, fermentation supernatant containing recombinant bacteria expressing the recombinant expression vector pMA-nbgl. DETAILED DESCRIPTION

[0016] The technical solution of the present invention is further explained below through examples, but the protection scope of the present invention is not limited in any form by the examples.

[0017] Example 1 Construction of an expression vector for β-glucosidase from Arctic bacteria Arc12

[0018] A nucleotide sequence containing SEQ ID No: 2 was obtained by gene synthesis. Using the synthetic gene as a template, PCR was performed with primers 1 (AAGGAGAGGGACGCGATGGGAAATACTCGTAAAAAAGTTT) and 2 (GATGGTGATGTCTAGTCACCTTGTGTTGTGCAGCA) to obtain a β-glucosidase gene with a complementary sequence to the pBES plasmid. Using the genome of Arctic bacteria Arc12 as a template, PCR was performed with primers 3 (GGAGCGATTTACATAATGTTCTCGATCGACCGC) and 4 (ACTGCATAACTCATATCACCTTGTGTTGTGCAGC) to obtain a β-glucosidase gene with a complementary sequence to the pMA5 plasmid. Using the synthetic gene of SEQ ID No: 2 as a template, PCR was performed with primers 5 (GGAGCGATTTACATAATGGGAAATACTCGTAA AAA AGTTT) and 6 (ACTGCATAACTCATATCACCTTGTGTTG TGCAGCA) was used to obtain the β-glucosidase gene with a complementary sequence to the pMA5 plasmid. The PCR product was detected by electrophoresis. The electrophoresis results were as follows: Figure 1 As shown, an electrophoretic band appeared at the position of the target product, and the PCR product was recovered.

[0019] PCR system (LA Taq enzyme purchased from TaKaRa)

[0020]

[0021]

[0022] PCR conditions

[0023] 1.94℃,5min

[0024] 2.94℃, 1min

[0025] 55℃, 30s

[0026] 72℃, 1min 50s

[0027] Loop 35 times

[0028] 3.72℃, 5min

[0029] The pBES plasmid was digested with Mlu I and Xba I at 37°C for 1 hour, and the digestion products were detected by electrophoresis. The linearized pBES was recovered by gel excision. The pMA5 plasmid was digested with Nde I at 37°C for 1 hour, and the digestion products were detected by electrophoresis. The electrophoresis results are shown as follows: Figure 2As shown, linearized pMA5 was recovered by gel excision.

[0030] Enzyme digestion system (Mlu I, Xba I and Nde I enzymes purchased from NEB)

[0031] 10*CutSmart buffer 10μL

[0032] Plasmid 85 μL

[0033] 2.5 μL each of Mlu I and Xba I or 5 μL of Nde I

[0034] Total volume 100 μL

[0035] The PCR product was ligated with the linearized pBE or pMA5 plasmid using In-fusion enzyme (purchased from TaKaRa). The ligation product was transformed into Escherichia coli DH5α and plated on a plate containing 50 μg / mL ampicillin. Positive clones were screened and single colonies were picked for sequencing analysis. The recombinant expression vectors obtained were named pBE-nbgl, pMA-bgl, and pMA-nbgl, respectively.

[0036] Example 2 Construction of Bacillus subtilis expression strain

[0037] The recombinant plasmids pBE-nbgl, pMA-bgl, and pMA-nbgl described in Example 1 were extracted from Escherichia coli DH5α, verified by sequencing, and then transformed into Bacillus subtilis WB600. The transformation method was a chemical transformation method, and the specific method was as follows:

[0038] Pick a single colony of Bacillus subtilis WB600 and inoculate it into LB liquid medium, and culture it in a shaking incubator at 37℃ overnight; take 100μL of overnight cultured bacterial liquid and inoculate it into 5ml The culture medium was shaken at 37°C for 3 hours; 200 μL was quickly inoculated into 2 mL of SPII medium and cultured at 37°C and 100 rpm for 1.5 hours; 20 μL of 100×EGTA solution was added and cultured at 37°C and 100 rpm for 10 minutes, and the culture was divided into 500 μL in 1.5 ml centrifuge tubes; 10 μL of pBE-nbgl, pMA-bgl or pMA-nbgl plasmid was added to the tube, mixed and cultured at 37°C and 100 rpm for 30 minutes, the speed was adjusted to 250 rpm, and the culture was continued for 1.5 hours; the bacteria were collected by centrifugation at 4000 rpm, part of the supernatant was discarded, 100 μL of the resuspended bacteria were spread on a kanamycin-resistant plate, and cultured at 37°C overnight to obtain a Bacillus subtilis expression strain.

[0039] Example 3P aprE Promoter-controlled secretory expression of recombinant β-glucosidase

[0040] Pick a single colony of Bacillus subtilis with plasmid pBE-nbgl in Example 2 and place it in SR medium containing kanamycin. At the same time, inoculate WB600 empty bacteria as a control and culture at 37°C and 180rpm for 48h. Centrifuge the bacterial solution at 10000rpm for 1min, and take the supernatant to determine the enzyme activity. Use 4-nitrophenyl-β-D-pyranoglucoside (pNPG) as the substrate for enzyme activity determination, mix the enzyme solution with the substrate, incubate at 55°C for 5min, add an equal volume of 1mol / L Na2CO3 to terminate the reaction, and measure the absorbance at 405nm. The expression level of recombinant β-glucosidase was detected by SDS-PAGE, and the electrophoresis results are shown in Figure 2. Figure 3 As shown, there was no obvious target band in the fermentation supernatant of the expression strain, the fermentation supernatant of the WB600 empty bacteria had no enzyme activity, and the enzyme activity of the fermentation supernatant of the expression strain was 0.46 U / mL.

[0041] Example 4P HpaII Promoter-controlled secretory expression of recombinant β-glucosidase

[0042] Pick a single colony of Bacillus subtilis with plasmid pMA-bgl or pMA-nbgl in Example 2 and place it in SR medium containing kanamycin. At the same time, inoculate Bacillus subtilis with the original plasmid pMA5 as a control. Culture at 37°C and 180rpm for 72h, and take 500μL of bacterial solution every 24h for enzyme activity determination. Centrifuge the bacterial solution at 10000rpm for 1min, and take the supernatant to determine the enzyme activity. Use 4-nitrophenyl-β-D-pyranoglucoside (pNPG) as the substrate for enzyme activity determination, mix the enzyme solution with the substrate, act at 55°C for 5min, add an equal volume of 1mol / L Na2CO3 to terminate the reaction, and measure the absorbance at 405nm. The expression level of recombinant β-glucosidase was detected by SDS-PAGE, and the electrophoresis results are as shown in the figure. Figure 4 As shown in Figure 2, after 48 hours of fermentation, the supernatant of the fermentation broth containing the recombinant expression vector pMA-nbgl had an obvious target band of about 50 kDa in size. The recombinant bacteria containing the recombinant expression vector pMA-nbgl also expressed a small amount of enzyme activity. Figure 5 As shown, after 48h of fermentation, the enzyme activity of the fermentation broth of the recombinant bacteria containing the recombinant expression vector pMA-nbgl reached 9U / mL, which is P aprE The enzyme activity in the fermentation broth of the recombinant bacteria containing the recombinant expression vector pMA-nbgl was 19.5 times higher than that of the recombinant β-glucosidase expressing strain controlled by the promoter. After 72 hours of fermentation, the enzyme activity in the fermentation broth of the recombinant bacteria containing the recombinant expression vector pMA-bgl was 10 times higher. Promoter optimization and the addition of a signal peptide significantly increased the secretory expression of the β-glucosidase from the Arctic bacterium Arc12, providing the necessary conditions for the production and application of this enzyme.

Claims

1. A recombinant bacterium expressing Arctic-derived β-glucosidase, characterized in that: The recombinant bacteria uses Bacillus subtilis WB600 as the original strain, and the recombinant bacteria contains the Escherichia coli-Bacillus shuttle plasmid pMA5 and the nucleotide sequence shown in SEQ ID No: 2; wherein the Escherichia coli-Bacillus shuttle plasmid pMA5 contains the constitutive promoter PHpaII, and the nucleotide sequence shown in SEQ ID No: 2 encodes β-glucosidase with the Bacillus subtilis signal peptide CitH.

2. An application, characterized in that: The application is to use the recombinant bacteria according to claim 1 to express the β-glucosidase.

Images