Molecular marker method for gene of rice tillering angle and special primer thereof
By using gene editing and overexpression techniques, TAC8 was identified as the major QTL for rice tillering angle. A molecular marker method for controlling rice tillering angle was developed, which solved the problem of insufficient gene universality in rice tillering angle research, and enabled accurate prediction in different rice varieties and accelerated the breeding process.
Patent Information
- Application Number
- CN202211572413.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-08
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2042-12-08
AI Technical Summary
In the existing technology, the study of rice tillering angle has not been able to effectively control the universality of tillering angle genes. In particular, the TAC3 gene has only demonstrated differences in the application of different haplotypes to all rice tillering angle studies, and the specific problems in the study of related genes have not been effectively solved.
TAC8 was identified as the major QTL for rice tillering angle through gene editing and overexpression. A molecular marker method for controlling rice tillering angle was developed. The functional fragment of TAC8 was amplified using a multiplex PCR system, and the tillering angle of the target germplasm was predicted by agarose gel electrophoresis. Combined with actual field observation, the accuracy of the developed marker was determined.
It enables accurate prediction of tillering angle in different subpopulations of indica and japonica rice, providing a way to accelerate the selection of ideal plant types and improving the control accuracy and breeding efficiency of tillering angle.
Smart Images

Figure BDA0003988633330000082 
Figure BDA0003988633330000092 
Figure BDA0003988633330000093
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the field of molecular biology, in particular to a gene molecular marker method for controlling a rice tillering angle character and special primers thereof. BACKGROUND
[0002] Rice is the main food of more than 60% of the population in China. With the increase of population and the decrease of rural labor, the food crisis is becoming more and more serious. Building an ideal plant type is an effective measure to increase rice yield. The earliest concept of ideal plant type of rice was proposed by Donald et al. in 1986, which believed that the ideal plant type was composed of photosynthesis, growth and development and the correlation of crop yield, and the ideal plant type could maximize the efficiency of photosynthesis. Among the factors of rice plant type, the looseness of tillering can directly affect the population structure, light energy utilization and disease susceptibility of rice. Too loose or too tight tillering angle will lead to the reduction of effective panicles and the reduction of seed setting rate, and will affect the yield. From 1960 to 1998, the application of semi-dwarf varieties and the improvement of related crop varieties almost doubled the rice yield in Asia. Academician Yuan Longping's 'ideal plant type of super high-yield hybrid rice' proposed specific super high-yield plant type indicators. One of the main challenges of rice breeding is to build an ideal plant type to improve the utilization rate of canopy radiation and thus improve the grain yield.
[0003] QTL positioning is essentially to analyze the relationship between the DNA markers of the entire genome of the constructed specific population and the phenotypic values of the target traits, to locate the corresponding position of the linkage group through the calculation of the exchange rate between the markers and the QTL, and to estimate its genetic effect. Therefore, QTL is also called statistical gene, and the accuracy of its positioning depends on the application of statistical models and methods (He Fenghua et al., 2004). The general steps include: constructing a genetic linkage map; selecting pure lines containing relative traits for crossing to obtain a suitable population; detecting the marker genes and quantitative trait values of each individual in the segregating generation population; analyzing the correlation between the marker genes and the quantitative trait values, determining the position of QTL on the chromosome, and estimating the related genetic parameters of QTL.
[0004] Tiller angle of rice as one of the main traits to shape the ideal plant type, determines the planting density per unit area of the plant and crop yield. The ideal tiller angle can not only avoid the disease caused by high humidity due to small angle, but also avoid the reduction of photosynthetic efficiency and yield per unit area caused by creeping growth. Therefore, it has been selected by human beings in the long-term domestication and genetic improvement of rice. However, the research on the genetic molecular mechanism of rice tiller angle has developed rapidly only in the past 30 years. There is a large natural variation in tiller angle among different varieties of rice. However, the genes controlling the natural variation of tiller angle are very limited. Therefore, it is urgent to excavate more genes related to tiller angle to better perfect its genetic basis and assist breeding.
[0005] The prior art CN 107937409 B discloses that the sequence of TAC3 gene is shown as SEQ ID NO: 1, the cDNA sequence is shown as SEQ ID NO: 2, and the encoded protein sequence is shown as SEQ ID NO: 3 and 4. The QTL site related to the tiller angle of rice is located by GWAS, the range of qTA3 is narrowed by combining LD analysis, and the candidate gene TAC3 is determined by combining reverse genetics means. The function of TAC3 gene is verified by gain-of-function mutant tac3D 1. The expression amount of the gene in tac3D 1 is significantly increased, and the tiller angle at the tillering stage is significantly increased from 10.4° to 19.4° and the tiller angle at the flowering stage is significantly increased from 8.4° to 17.6° compared with the wild type ZH11. The tiller angle of TAC3 gene in different haplotype indica rice materials is significantly different. However, the TAC3 gene disclosed in the prior art only proves that there is a difference in indica rice materials of different haplotypes, and is not applied to all rice subgroups, and does not have universal applicability. SUMMARY
[0006] The purpose of the present application is to provide a method for isolating and cloning a gene molecular marker for controlling tiller angle on the eighth chromosome from rice and a special primer thereof. The applicant names the gene as TAC8 (Tiller Angle Control 8) gene. The method is used to improve the tiller angle of rice, so as to control the plant type and yield of rice.
[0007] In order to achieve the above purpose, the technical scheme of the present application is as follows:
[0008] The primer for amplifying the gene for controlling the tiller angle of rice has the sequence shown as SEQ ID NO. 15-SEQ ID NO. 18, and the sequence of the gene for controlling the tiller angle of rice is shown as SEQ ID NO. 1.
[0009] Preferably, the protein for controlling the tillering angle of rice is shown as SEQ ID NO. 2.
[0010] The application also claims the application of the gene for controlling the tillering angle of rice, the protein or the primer for amplifying the gene for controlling the tillering angle of rice in controlling the tillering angle of rice.
[0011] The application also claims the application of the gene for controlling the tillering angle of rice, the protein or the primer for amplifying the gene for controlling the tillering angle of rice in improving the plant type of rice and rice breeding.
[0012] The application also claims the application of the gene for controlling the tillering angle of rice, the protein or the primer for amplifying the gene for controlling the tillering angle of rice in preparing a kit for identifying the tillering angle of rice, improving the plant type of rice or rice breeding.
[0013] A kit comprising one or more of the gene for controlling the tillering angle of rice, the protein or the primer for amplifying the gene for controlling the tillering angle of rice.
[0014] The application also claims the application of the kit in identifying the tillering angle of rice, improving the plant type of rice or rice breeding.
[0015] A molecular marker method for controlling the tillering angle of rice gene TAC8, comprising the following steps:
[0016] S1, extracting genomic DNA of different rice germplasm;
[0017] S2, PCR amplification: using multiplex PCR amplification method to amplify the genomic DNA of the target germplasm; the amplification primer sequence is shown as SEQ ID NO. 15-SEQ ID NO. 18;
[0018] S3, performing gel electrophoresis on the PCR product, and determining the tillering angle of the target germplasm according to the electrophoresis result; the rice germplasm with a band in the target region is the rice germplasm with a larger tillering angle, and the rice germplasm without a band in the target region is the rice germplasm with a smaller tillering angle.
[0019] Preferably, the molecular marker method further comprises verification, and the verification step comprises: planting the target germplasm, investigating the field tillering angle, corresponding to the marker result one by one, and determining the accuracy of the developed marker.
[0020] The application is further explained as follows:
[0021] The application determines TAC8 as a main QTL of rice tillering angle through gene editing and overexpression, and confirms that TAC8 can control the rice tillering angle and plays a control role on the rice plant type. A molecular marker and method for controlling the main QTL site qTAC8 of the rice tillering angle are developed, the dCAPS marker primer of the universally recognized main site TAC1 of the rice tillering angle is developed as an auxiliary verification means, the function fragment of TAC8 as the main gene for controlling the rice tillering angle is determined through transgenic verification and haplotype analysis, and the molecular marker primer RM5338 is designed by deleting the function fragment of TAC8. The application uses a multiple PCR system to simultaneously amplify two fragments, obtains a PCR stock solution, and then performs restriction endonuclease SmaI enzyme digestion, and then more accurately predicts the tillering angle size of the target germplasm through 2% agarose gel electrophoresis. In combination with the investigation on the actual tillering angle in the field, the accuracy of the developed marker is determined. Compared with the verification of a single primer, the multiple PCR combines the annealing and extension stages, shortens the PCR amplification time, and can improve the specificity of the PCR product and the yield of the target band. The dCAPS primer of TAC1 and the functional marker primer of TAC8 can be used for auxiliary verification, further improve the accuracy of the prediction of the tillering angle size of unknown germplasm, and accelerate the molecular breeding process.
[0022] The application first obtains the predicted gene sequence of TAC8 from the National Rice Data Center (ricedata.cn). The prediction shows that TAC8 has only one exon, the coding region contains 792 base pairs (SEQ ID NO. 1), and encodes a TCP family protein composed of 264 nucleotides (SEQ ID NO. 2). The gene structure is as shown in the figure (attached Figure 4 A), and the amplification primers F: (5'-3') ATGTCCGCGCCGTCGTCGT (SEQ ID NO. 3); R: TTACTCATCCGTTGTCGTCGTT (SEQ ID NO. 4) are designed. The DNA of the light rice variety D50 is used as a template to complete the cloning of TAC8. The cloning comparison result is as shown in the figure (attached Figure 2 After the gene cloning is completed, the TAC8 knockout and overexpression vectors are constructed, the transgenic plants are obtained through genetic transformation, and then the phenotype function identification is performed to complete the function verification of TAC8.
[0023] The beneficial effects of the application are as follows:
[0024] The application determines that TAC8 can regulate rice tillering angle and control the spread degree of rice plant type from the perspective of molecular breeding through gene editing and overexpression, and provides a molecular marker method for controlling rice tillering angle QTL qTAC8, which is a molecular marker obtained by analyzing and sequencing on the 8th chromosome and being closely linked to the main effect QTL qTAC8 of rice tillering angle, and the molecular marker of the main effect site TAC1 can accurately predict the size of the tillering angle of rice, and provides a better solution for accelerating the breeding process of ideal plant type.
[0025] The molecular marker method of the disclosed TAC8 gene can be used for assisted selection in combination with the main effect site TAC1 of rice tillering angle, and can be verified in different subgroups of indica rice and japonica rice at the same time, and has universality. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 It is a gel map of TAC8 cloning;
[0027] From left to right lane 1: 2K Marker, from top to bottom, the band size from bottom to top is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lanes 2 and 3: TAC8 genomic amplification bands, the band size is 792bp;
[0028] Figure 2 It is a comparison result of TAC8 cloning;
[0029] Figure 3 It is a gel electrophoresis running verification of sgRNA expression cassette;
[0030] A: First round of PCR gel verification gel map; from left to right lane 1 is 2K Marker, from bottom to top, the band size is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; The second lane is CRR-1(M-F), and the second lane is CRF-1(grr);
[0031] B: Second round of PCR gel verification gel map; from left to right, 2K Marker, from bottom to top, the band size is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, the second and third lanes are gRNA expression cassette amplification, and the band position is 750bp;
[0032] Figure 4 It is a function verification of TAC8 gene;
[0033] A, Structure and sequence alignment analysis of TAC8 gene; B, NIL(TAC8) and TAC8 knockout plant heading stage phenotype; C, NIL(TAC8) and knockout strain bending degree of stem base comparison chart; D, NIL(TAC8) and knockout strain tillering angle (radian); E, NIL(TAC8) and TAC8 knockout strain blade angle; ** indicates significant difference at 0.01 level;
[0034] Figure 5 TAC8 overexpression vector map;
[0035] A: pHF611 vector enzyme digestion map; Lane 1: 2K Marker, from bottom to top, the band size is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lane 2, 3: pHF611 vector using restriction enzymes SmaI and BamHI; B: TAC8 CDS amplification gel map; Lane 1: 2K Marker, from bottom to top, the band size is 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp; Lane 2: target band, TAC8 CDS amplification sequence, sequence size is 798bp;
[0036] Figure 5 C is the map of the fusion vector of the target gene constructed by homologous recombination method;
[0037] Figure 6 TAC8 function verification;
[0038] A, NIL(tac8) overexpression plant phenotype; B, JNIL(tac8) and overexpression strain stem base comparison picture; C, TAC8 relative expression amount in NIL(tac8) and overexpression plant; D, NIL(tac8) and overexpression plant tillering angle (radian); ** indicates significant difference at 0.01 level.
[0039] Figure 7 TAC8 haplotype difference SNPs and material population distribution structure of each haplotype;
[0040] A, TAC8 haplotype difference SNPs; B, material population distribution structure of each haplotype;
[0041] Figure 8 TAC8 5 haplotype materials combined with TAC1 typing tillering angle box plot and national distribution of each haplotype material;
[0042] A, TAC8 5 haplotype materials combined with TAC1 typing tillering angle box plot; B, national distribution of each haplotype material;
[0043] Figure 9 Electrophoresis gel map of RM5887 amplification
[0044] Lane 1: 500 Marker, the band size from top to bottom is 500bp, 400bp, 300bp, 250bp, 200bp, 150bp, 100bp, 50bp; Lanes 2-28: the amplified products of different germplasm DNAs using RM5887, the target band size is 78bp, the information of each lane germplasm is shown in Table 5.
[0045] Figure 10 Electrophoresis gel map of RM529 amplification and 2% agarose electrophoresis gel map of RM529 amplification products after Smal enzyme digestion
[0046] A, Electrophoresis gel map of RM529 amplification; Lane 1: 500 Marker, the band size from top to bottom is 500bp, 400bp, 300bp, 250bp, 200bp, 150bp, 100bp, 50bp; Lanes 2-28: the amplified products of different germplasm DNAs using RM529, the target band size is 244bp, the information of each lane germplasm is shown in Table 5.
[0047] B, 2% agarose electrophoresis gel map of RM529 amplification products after Smal enzyme digestion; Lane 1: 500 Marker, the band size from top to bottom is 500bp, 400bp, 300bp, 250bp, 200bp, 150bp, 100bp, 50bp; Lanes 2-28: the electrophoresis bands of the amplified products of different germplasm DNAs using RM529 after enzyme digestion, the size of the band not cut is 244bp, the size of the band that can be cut is 200bp and 21bp, the information of each lane germplasm is shown in Table 5.
[0048] Figure 11 2% gel electrophoresis gel map of the products after enzyme digestion; Lane 1: 500 Marker, the band size from top to bottom is 500bp, 400bp, 300bp, 250bp, 200bp, 150bp, 100bp, 50bp; Lanes 2-28: the electrophoresis bands of the products after enzyme digestion of the amplified products of different germplasm DNAs using RM529 and RM5887, the target band size is 244bp, 203bp, 78bp, 21bp. DETAILED DESCRIPTION
[0049] The technical solutions of the present application are further described below in combination with specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.
[0050] Example 1
[0051] Gene editing of TAC8 using Crispr-Ca9 technology to obtain TAC8 knockout lines
[0052] 1. Cloning of TAC8
[0053] According to the gene structure (attached Figure 4 -A) Design the amplification primers F of TAC8: (5'-3') ATGTCCGCGCCGTCGTCGT (SEQ ID NO. 3); R: TTACTCATCCGTTGTCGTCGTT (SEQ ID NO. 4); the enzyme used is: GoldenStar T6Super PCR Mix (1.1x) gold Mix (Green) (catalog number: TSE101), and the genomic DNA of the naked rice variety D50 is used as the template for amplification; the amplification system is: template 1 μL, primers F / R 1 μL each, enzyme 22 μL; the PCR amplification system is: 98℃ for 2min; 98℃ for 10S, 55℃ for 15S, 72℃ for 10S, cycle 35 times, final extension 72℃ for 5min. The genomic DNA of the naked rice variety D50 is:
[0054]
[0055] ATGTCCGCGCCGTCGTCGTCGTCGTCGCCGTCGACGCTGGACGAGTACGACGCGCGCTTCTTCTTCCCCGGCGCCGACGCGTACACCGCCGGCCACCGGCAGGATGAGGAGACGCTGGAGGCCGTGCTGCGGCAGCCGGTGACGACGACGGCCGCGGCGGCGGCGGCGGTGGAGGGAGGTGGCGGCGGTGGAGGAGGAGGCGCCGGGGGATCCCCCGCGGCGGCGGCGGCGGCGACGCGGAGGCGGCCGTTCCGGACGGACCGGCACAGCAAGATCCGCACGGCGCAGGGCGTGCGGGACCGGCGGATGCGGCTGTCCGTCGGCGTCGCGCGCGACTTCTTCGCGCTGCAGGACAAGCTCGGCTTCGACAAGGCCAGCAGGACGGTGGAGTGGCTGCTCACCCAGTCCAAGCACGCCATCAACCGCCTCACCCTTCCCGACTCCGCCGACGCGGCGGCGGCGCCCGCGTTCGCCGCCGCTCCACCGCCGGCGGATCAGCATTCCTCGGCCATGGCCGCCGCCGCAGCATCGGCTGCGAAGGAGAAAGGGGAGGCGAGCTCGTCGAGCACCACCAATGCGTCGTCGGCGCGGGCGAGAAACAGAGACCACGACGGATCATCGCCGGTGGCGCCCATGGACGAGCGCGGGCGCCGCGGTGTCGAGCTCGACTGGACGGCGGCGGCGGCGGCGAGCACCGAGCAGCCGATGGACGGATTGGAGTACTACTTCCAATACTACAATCATCTGGAGGAGATAATGAGCTGCGACCCAACGACGACAACGGATGAGTAA (SEQ ID NO. 1).
[0056] After PCR, the PCR stock solution was obtained for agarose gel electrophoresis. 4 g of agar powder was dissolved by heating with 1% TAE solution. 2.5 μL of nucleic acid dye was added to configure the agarose gel. Horizontal gel electrophoresis tank of Beijing Junyi was used for gel electrophoresis (voltage 150 volts, time 20 min). After electrophoresis, the gel imaging instrument of Mona was used for observation. The amplification band was as follows Figure 1As shown, it is illustrated that the band size is consistent with the published sequence length, and it is illustrated that the amplified is the required gene TAC8.
[0057] 2. Sequence comparison
[0058] The gene number (Os08g33530) of TAC8 was searched in the National Rice Data Center (https: / / www.ricedata.cn / gene / ), and the published genomic sequence of the gene was obtained. After downloading the genomic sequence, the sequencing result sequence of the amplified PCR stock solution (sequencing was completed by Shengong Biotechnology Co., Ltd.) was compared using bioinformatics software BioXM2.7.1. The sequence comparison result is shown in Figure 2 As shown, it is illustrated that the amplified sequence is consistent with the gene in the database.
[0059] 3. Design and synthesis of SgRNA
[0060] The linker primer required for knocking out the target gene TAC8 was designed, the PAM sequence was selected as NGG, the snoRNA promoter was selected as Μ6, the Gμide Seqμence Length was selected as 20bp, the Target Genome was selected as Oryza sative (MSΜ), and the LocμsTag was selected as the LOC number corresponding to the gene. The knocking out primer with GC content of 45%-70%, off-target evaluation equal to or greater than 0.7 (or 0.6), Offtarget <100, TSL of 2 or 3; GSL <=6; CBP <=7; TBP <=12; IBP <=6 was selected, the forward primer F was GCCG+target sequence, and the reverse primer R was the reverse complement sequence of AAAC+target sequence. The primer sequences are as follows:
[0061] Forward primer CRF-1: GCCGCCGGCAGGATGAGGAGACGC (SEQ ID NO. 5);
[0062] Reverse primer CRR-1: AAACGCGTCTCCTCATCCTGCCGG (SEQ ID NO. 6).
[0063] Μ-F / gR-R, Pps-GGL / Pgs-GGR primer sequences are universal primers for constructing Crispr-Ca9;
[0064] Μ-F: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO. 19);
[0065] gR-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO. 20);
[0066] Pps-GGL: (5'-3') TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG (SEQ ID NO. 21);
[0067] Pgs-GGR: (5'-3') AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC (SEQ ID NO. 22);
[0068] After the synthesis of primers in Changsha Qianke Biological Company.
[0069] 4. Knockout vector construction
[0070] The vector used in this experiment is pYLCRISPR / Cas9 binary vector system, sgRNA intermediate vector pYLgRNA-OsM6a. The target point linker connection amplification method is used to construct sgRNA expression cassette, and the detailed process is as follows:
[0071] (1) Preparation of target double-linker
[0072] The linker front primer CRF-1 (SEQ ID NO. 5) and the rear primer CRR-1 (SEQ ID NO. 6) are mixed into 0.5 μmol / L in 0.5×TE buffer. About 90℃ 30s, move to room temperature to cool and complete the annealing.
[0073] (2) Construction of sgRNA expression cassette
[0074] The construction system is as follows:
[0075] Concentration Reaction solution System 10 μl 10X T4 DNA ligase bμffer contains 10 mmol / L ATP 1 μl 10X Cμt Smart Bμffer 1 μl 0.5 μmol / L Linker primer front: CRF-1; back: CRR-1 0.5 μl 20 ng / μl OsM6a grna plasmid (66195 Addgene) 1 μl 10 μ BsaI 0.1 μl 400 μ T4 ligase (full formula gold) 0.1 μl dd H2O 6.3 μl
[0076] After mixing the above reaction solution, PCR amplification was carried out, and the PCR temperature system was as follows:
[0077] Cycle number: 5 cycles, to obtain SgRNA expression cassette.
[0078] (3) First round PCR: sgRNA amplification
[0079] The reaction system of the first round PCR is as follows:
[0080]
[0081] After mixing the above reaction solution, PCR amplification was carried out, and the PCR temperature system was as follows:
[0082]
[0083] Run gel verification by gel electrophoresis (such asFigure 3 A), see the gel electrophoresis step in the cloning of TAC8 gene; the amplified band position is high-low, and the amplified band size is 629bp (product M-F) and 284bp (product gRR), respectively, and the ligation is successful. After confirming the successful ligation, the first round of PCR product is taken for the second round of PCR.
[0084] (4) Second round of PCR
[0085] The first round of PCR product is taken for the second round of PCR reaction, and the reaction system is 50μl, and the reaction system is as follows:
[0086]
[0087] After mixing the above reaction solution, PCR amplification is performed, and the PCR temperature system is as follows:
[0088]
[0089] (5) Purification of PCR product
[0090] The second round of PCR product is subjected to gel electrophoresis migration with 1% agarose gel, and then the position of the target band is observed on the gel imaging instrument (such as Figure 3 B), and the size of the target band is 800bp, and the band position is confirmed to be correct. After confirming that the band position is correct, the gel containing the target band is cut into a 2.0 EP tube, and a gel recovery kit (NA: omega, REF: D2500-02) is used for recovery. The specific recovery steps are as follows:
[0091] (1) Agarose gel electrophoresis separates DNA fragments;
[0092] (2) When the desired DNA fragment is completely separated, transfer the gel to the ultraviolet lamp, and cut the desired DNA fragment as quickly as possible and put it into a 2.0 centrifuge tube. (When cutting the gel, try to cut off the excess gel, and the DNA should not be exposed to the ultraviolet lamp for more than 30s)
[0093] (3) Add XP2 Binding Buffer that covers the DNA fragment, and melt the gel in the oven at 50-60°C until the gel is completely melted, and shake the mixture every 2-3min.
[0094] (4) Take a HiBind DNA Mini binding column and install it in a 2mL collection tube. Transfer the DNA / melted gel solution obtained in step 3 to the HiBind DNA Mini binding column, centrifuge at 10,000xg for 1min at room temperature, discard the filtrate in the collection tube, and collect the column in the 2mL collection tube.
[0095] (5) Transfer 300 μl XP2 Binding Buffer to the binding column, centrifuge at 12,000 x g for 1 min at room temperature, discard the flow-through;
[0096] (6) Place the HiBind DNA Mini Binding Column into the 2 mL collection tube. Transfer 700 μl of SPW Buffer (diluted with absolute ethanol) to the HiBind DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature, discard the flow-through;
[0097] (7) Repeat step 6;
[0098] (8) Place the HiBind DNA Mini Binding Column into the 2 mL collection tube. Centrifuge at 12,000 x g for 2 min at room temperature to spin down the HiBind DNA Mini Binding Column matrix residual liquid.
[0099] (9) Place the HiBind DNA Mini Binding Column into a clean 1.5 mL centrifuge tube. Add 18 μl Elution Buffer to the matrix of the HiBind DNA Mini Binding Column, let stand for 1 min at room temperature, centrifuge at 12,000 x g for 1 min to elute the DNA.
[0100] (10) Pipette 10 μl of the eluate from the 1.5 mL centrifuge tube onto the matrix of the HiBind DNA Mini Binding Column, centrifuge at 12,000 x g for 1 min to obtain the desired band of DNA fragment. After obtaining the DNA product containing the desired fragment, proceed to the subsequent experiment;
[0101] (6) Clone the sgRNA expression cassette into the pYLCRISPR / Cas9 vector
[0102] This step uses "Golden Gate" cloning method based on Bsa I (No. Thermo; LOT: 00882417) enzyme cutting and connection (Gibson et al. developed an "isothermal in vitro recombination reaction", also known as "Gibson Assembly" can carry out the connection of multiple PCR fragments (Gibson, et al., 2009; Gibson, et al., 2010; Gibson, 2011), by the method of "cutting and connecting", the sgRNA expression cassette is connected with the binary vector pYLCRISPR / Cas9, the reaction system is 15 μl, and the reaction system of the connection is as follows:
[0103]
[0104] After mixing the above reaction solution, PCR amplification is carried out, and the PCR temperature system is
[0105]
[0106] (7) Transformation of the connection product
[0107] Using Trelief.5a, take competent cells at -80°C, add 10 μl of ligation product, mix gently (gentle pipetting or tap the tube wall several times), and stand for 5 min on ice; heat shock at 42°C for 45-60 s, quickly transfer to ice bath, and stand for 2 min (do not shake the sample during the ice standing process, or the transformation efficiency will decrease); add 700 μL of sterile liquid LB medium without antibiotics to the centrifuge tube, mix, and recover at 37°C and 200 rpm for 20 min (for every 5 min increase in recovery time, the transformation efficiency increases by 3-5 times); take an appropriate volume of the recovered liquid and evenly spread it on the Kana-containing antibiotic medium, and incubate in a 37°C incubator overnight. The next day, pick a single colony and add it to liquid LB medium containing Kana antibiotic for shake culture, and then use the plasmid extraction kit (NO. omega; REF: D6943-02) to extract the colony plasmid. The plasmid extraction specific experimental steps are as follows: inoculate the E. coli with the plasmid in 5 mL of LB / antibiotic culture solution, and incubate at 37°C on a shaker for 12-16 h; transfer 4 ml of the bacterial solution to 2 ml of a centrifuge tube, centrifuge at 10,000 x g at room temperature for 1 min to collect the bacteria; discard the filtrate, add 250 μl of Solμtion I / RNase A mixing solution, and vortex to fully suspend the cells; add 250 μl of Solμtion II to the resuspended mixing solution, and gently invert to mix for 4-6 times. (Avoid vigorous mixing of the lysis solution, and the lysis reaction should not exceed 5 min) Add 350 μl of Solμtion III, and gently invert several times until a white flocculent precipitate is formed. Centrifuge at 12,000 x g at room temperature for 10 min; transfer the supernatant to a HiBind Miniprep DNA binding column, centrifuge at 12,000 x g at room temperature for 1 min, and discard the filtrate; re-mount the column in the collection tube, add 500 μl of HBC Bμffer (diluted with isopropyl alcohol), centrifuge at 12,000 x g at room temperature for 1 min, and discard the filtrate; re-mount the binding column in the collection tube, add 700 μl of DNAWash Bμffer (diluted with anhydrous ethanol), centrifuge at 12,000 x g at room temperature for 1 min, and discard the filtrate; discard the filtrate, and repeat the previous step; discard the filtrate, re-mount the binding column in a clean 1.5 mL centrifuge tube, add 30 μl of Elμtion Bμffer to the column matrix, stand for 1 min, and centrifuge at 13,000 x g for 1 min to elute the DNA; store the eluted DNA at -20°C, and take 10 μl of the plasmid to GenScript for sequencing to obtain the correct plasmid vector;
[0108] (8) Genetic transformation of the vector
[0109] The recombinant inbred line NIL(tac8) is used as the genetic receptor material, the knock-out vector is sent to Wuhan Boyuan Biological Company for genetic transformation, the transgenic positive plants are obtained, and the transgenic rice is planted in the Yun Garden base of Hunan Agricultural University, and the normal field soil and fertilizer management is carried out. Phenotypic identification is carried out after the transgenic rice seedlings mature.
[0110] Sequencing shows that the knock-out mutant strain inserts a "GAGGAG" fragment at the nucleotide position of the TAC8 coding region Figure 4 A), and through the field tillering angle phenotype investigation of the transgenic strain NIL(TAC8), it is found that the tillering angles of the three different mutant types of transgenic plants are 32.20°, 32.99° and 25.69°, which are significantly lower than the tillering angle 58.97° of the wild type NIL(tac8). It is found that the bending degree of the wild type is significantly greater than that of the mutant, especially in the grain filling period, the blade angles of the mutant are 0.08°, 0.09° and 0.11°, which are significantly lower than the blade angle 0.80° of the wild type Figure 4 B, 4C, 4D, 4E). Therefore, after the gene knockdown of TAC8 in the background rice plant, the tillering angle of the mutant plant is significantly lower than that of the wild type, so TAC8 is the major gene controlling the tillering angle of rice.
[0111] Example 2
[0112] The TAC8 overexpression vector is constructed by the method of homologous recombination, and the TAC8 overexpression strain is obtained
[0113] The specific construction steps are as follows:
[0114] 1. Overexpression primer design and synthesis
[0115] The primer with a recombination linker is designed. First, 18-24bp is selected before and after the CDS sequence as the gene CDS sequence amplification primer, second, two enzyme digestion sites (Sam1 and BamH1) are selected in the MCN (multiple cloning site region) of the overexpression vector pHF611, 12-15bp is selected before the enzyme digestion site Sam1 as the front primer (F) recombination linker, and 12-15bp is selected after the enzyme digestion site BamHI as the reverse complementary recombination linker. At this time, the overexpression primer sequence is obtained, F: recombination linker sequence + enzyme digestion site sequence (enzyme digestion site: Sma1) + CDS sequence amplification primer F; R: recombination linker sequence reverse complementary sequence + enzyme digestion site sequence (enzyme digestion site: BamHI) + CDS sequence amplification primer R.
[0116] The overexpression of the connecting primer is: OE-F: TACGCTGGATCCC GGG ATGTCCGCGCCGTCGTCGT (SEQ ID NO. 7);
[0117] OE-R: GGCCGCACTAGT AAGCTT TCCGTTGTCGTCGTT (SEQ ID NO. 8).
[0118] The designed primer sequence is synthesized in Genescript.
[0119] 2, TAC8 overexpression vector construction
[0120] The vector used in this experiment is pHF611 (constructed by Hunan Agricultural University South Grain and Oil Collaborative Innovation Center National Key Laboratory) vector, the vector map is shown in Figure 5 C, and the target gene fusion vector is constructed by homologous recombination method.
[0121] The near-isogenic line of TAC8 is constructed by backcrossing after hybridizing D50 (light body rice) with rice variety HB277 (large angle germplasm material), and then sampling the leaf tissue of the near-isogenic line (NILTAC8), the sampling size is 3 cm leaf, the sample is quickly placed in liquid nitrogen for storage, and the sample RNA is extracted using Trizol, and the RNA extraction and reverse transcription steps are as follows:
[0122] (1) Put the rice leaves in a 2 mL RNase-free centrifuge tube, freeze quickly in liquid nitrogen, and grind to powder with a high-speed grinder, add 1 mL Trizol extraction solution and vortex, and stand for 10 min in ice bath;
[0123] (2) Add 300 μL chloroform (National Pharmaceutical) to the extraction solution, shake well, stand at room temperature for 5 min, and centrifuge at 12,000 g at 4°C for 15 min;
[0124] (3) Carefully pipette the supernatant (about 400 μL) into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of pre-cooled isopropanol (National Pharmaceutical) to the supernatant, mix well by inverting, and stand on ice for 10 min;
[0125] (4) 12,000 g 4°C centrifugation for 10 min; discard the supernatant, add 1 mL 75% ethanol (National Pharmaceutical), invert several times, 4°C 10000 g centrifugation for 20S, discard the supernatant;
[0126] (5) Add 1 mL 75% ethanol (National Pharmaceutical), invert several times, 10000 g 4°C centrifugation for 20S, room temperature air dry, remove residual ethanol;
[0127] (6) Add 30-40 μl DEPC-treated water, dissolve the RNA thoroughly, measure the total RNA concentration with a nucleic acid concentration detector, and after detecting the RNA quality by 1% agarose gel electrophoresis, store at -80°C for standby use.
[0128] After obtaining the near-isogenic line tac8, the extracted RNA was subjected to reverse transcription using the kit of the reagent EasyScript One-Step gRNA Removal and cDNA Synthesis SuperMix (REF: AE311) to obtain the near-isogenic line NILTAC8 total cDNA. The reverse transcription system is shown as follows:
[0129]
[0130] The PCR program setting system is 50°C for 15-30 min and 85°C for 5 s.
[0131] (3) Target gene amplification
[0132] Using the cDNA obtained by reverse transcription as a template, the high-fidelity enzyme KOD (NO. TOYOBO; REF: KFX-101) was used to amplify the target gene with the reverse-transcribed cDNA as a template and the seamless cloning primers OE-F: TACGACGTTCCAGATTACGCT GGATCCATGTCCGCGCCGTCGTCGT (SEQ ID NO. 23); OE-R: TCTACTCACTTAGCGGCCGCACTAGT AAGCTTTTACTCATCCGTTGTCGTCGTT (SEQ ID NO. 24) as the front and rear primers. The PCR amplification system was 50 μl, and the amplification system was as follows:
[0133]
[0134] After mixing the above reaction solution, PCR amplification (ETC811 Plus PCR instrument) was performed, and the PCR program reaction system was as follows:
[0135]
[0136] (4) Linearization of overexpression vector pHF611
[0137] The pHF611 vector was double-digested with restriction enzymes BamHI and HindIII (NO. NEB; REF: R0141L, R0136L) using the following reaction system: 1 μl of restriction enzyme BamHI, 1 μl of HindIII, 39 μl of ddH2O, 4 μl of pHF611 plasmid vector, and 5 μl of 10x buffer (supplied with the enzyme), and the enzyme digestion was performed at 37°C for 2h40min.
[0138] (5) Purification of linearized vector product and PCR product of amplified fragment
[0139] The amplified TAC8 CDS sequence and the stock solution of the linearized vector fragment after digestion were subjected to 1% agarose gel electrophoresis (NO. QiaGen; REF. TSJ001), and the position of the target band was observed on a gel imaging instrument (Monad gel imaging system QuickGel6100) (Figs. A and B). Figure 5 A, B), Fig. A represents the size of the linearized vector sequence after digestion, which is 8756bp; Fig. B represents the size of the amplified TAC8 CDS sequence, which is 792bp; the gel blocks containing the bands at positions of 8756bp and 792bp were cut off, and the bands were recovered using a gel recovery kit. (The gel recovery step is the same as the knockout vector construction)
[0140] (6) Product ligation and transformation
[0141] The target gene fragment and the linearized vector were ligated at a concentration ratio of 1:3, and the ligation reaction system was 20 μl. The ligation system was as follows:
[0142]
[0143] The above reaction solution was mixed and subjected to ligation reaction, and the ligation temperature system was 50°C, and the ligation time was 1h.
[0144] After the product ligation was completed, E. coli transformation was performed, and LB solid plates were coated and incubated in an incubator at 37°C overnight. (The vector transformation step is the same as the knockout vector transformation)
[0145] (7) Picking bacteria
[0146] Some colonies were picked into LB liquid medium containing kanamycin, and the shaking speed was 220rpm and the temperature was 37°C, and the culture was performed for 16h. After the bacterial solution was shaken to be turbid, a plasmid extraction recovery kit was used to extract the plasmid of the bacterial solution (the extraction step is the same as the knockout plasmid extraction), and then the plasmid was sent to QiaGen sequencing department for sequencing, and the overexpression vector containing the target gene was screened.
[0147] (8) Vector transformation
[0148] After the construction of the vector, the plasmid vector was sent to Wuhan Boyuan Company for genetic transformation, and the transformation receptor material was TAC8 near-isogenic line NIL(tac8) constructed by D50 and rice variety HB277.
[0149] After obtaining the overexpression transgenic plants, the transgenic rice seedlings were planted in the Yunyuan base of Hunan Agricultural University, with normal water and fertilizer management and normal irrigation measures. The phenotypes were investigated at the heading stage. Real-time fluorescent quantitative PCR was performed on wild type and overexpression lines to determine that the TAC8 expression of overexpression lines was significantly higher than that of wild type, for example Figure 6 -B), and the expression of TAC8 in overexpression plants was significantly higher than that in TAC8 near-isogenic line NIL. After the rice plants grew to the mature stage, the wild type and overexpression lines were investigated for field agronomic traits, for example Figure 6 -A, C), and the investigation found that the radian value of the tillering angle of overexpression lines was 0.61, which was significantly greater than the radian value of the tillering angle of wild type 0.29. At the same time, we investigated the bending of the stem base of wild type and overexpression, and found that the bending of the stem base of overexpression lines was significantly greater than that of wild type, which more intuitively showed that the tillering angle of overexpression plants was greater than that of wild type.
[0150] Therefore, using NIL(tac8) as the genetic receptor material, TAC8 was knocked out and overexpressed by molecular techniques to prove that TAC8 is the main effective site controlling the tillering angle of rice, which can change the size of the tillering angle of rice, and has important significance for molecular breeding of rice and selection of ideal plant type.
[0151] Example 3
[0152] TAC8 haplotype analysis and design of marker primer RM5887
[0153] Haplotype analysis refers to the combination of alleles at multiple loci on the same chromosome. By performing haplotype analysis on the main effective site TAC8 of rice tillering angle, a single SNP site or fragment upstream and downstream of TAC8 that has a decisive significance on the function of the gene is determined, so as to better explain how TAC8 determines the size of the tillering angle of rice. The specific steps of haplotype analysis are as follows:
[0154] Haplotype analysis requires the genotypes of the target gene TAC8 in different germplasm populations and the corresponding phenotypes of the target trait. First, SNP variation information of the genes upstream and downstream of TAC8 within a 2K region is obtained from a website. The searched SNP variation information is exported in Excel format. Excel's built-in functions are used to filter and sort the results, retaining gene IDs with a major allele frequency below 80% and discarding SNPs with a deletion frequency above 8%. This yields the variation marker information for the upstream and downstream 2K region of TAC8. A total of 12 SNP sites with differences and 2 missing SNP sites are found in the variation region. The selected gene IDs are then returned to the website http: / / RiceVarMap2(ncpgr.cn). In the Geniomic Variation drop-down menu, "Search for Genotype With Variation" is selected. The ID information of the selected variants was entered into the corresponding input box. All rice cultivars were selected to obtain the SNP variant information of the TAC8 in the selected location region in the 3K rice cultivar population. The genotype information of 109 collected germplasm materials was obtained by screening the genotype files of the 3K rice cultivar population. The genotypes of the 109 materials were classified and summarized. Germplasm materials with the same SNP mutation information at each gene location were classified as a haplotype. The results showed that there were 5 haplotypes in the 109 germplasm materials. The haplotypes of TAC8 were analyzed using the SNP information of the variant sites (as shown in Table 1), combined with the source information of the 3K germplasm materials and the subspecies names (as shown in Table 2). Haplotype 1 was found to be mainly composed of japonica rice varieties (2 intermediate japonica rice accessions, 7 temperate japonica rice accessions, and 13 tropical japonica rice accessions); haplotype 2 was mainly composed of indica rice (18 accessions); haplotype 3 was mainly composed of intermediate indica rice (7 accessions); haplotype 4 was mainly composed of indica rice and intermediate indica rice (16 accessions and 6 accessions, respectively); and haplotype 5 was mainly composed of intermediate indica rice (15 accessions). This analysis, combined with the gene structure of TAC8 (…), revealed that haplotype 1 was mainly composed of japonica rice varieties (2 intermediate japonica rice accessions, 7 temperate japonica rice accessions, and 13 tropical japonica rice accessions); haplotype 2 was mainly composed of indica rice (18 accessions); haplotype 3 was mainly composed of intermediate indica rice (7 accessions); haplotype 4 was mainly composed of indica rice and intermediate indica rice (16 accessions and 6 accessions, respectively); and haplotype 5 was mainly composed of intermediate indica rice (15 accessions). Figure 7 A), corresponding to the TAC 8-fold SNP variant sites and the rice subpopulation structure corresponding to each haplotype ( Figure 7 B).
[0155] Table 1 109 germplasm materials
[0156]
[0157]
[0158]
[0159]
[0160] Table 2. Source information and subspecies names of 3K germplasm materials
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168] TAC1 is a major-effect QTL that controls tillering angle in rice and is widely present in rice germplasm populations. While identifying the TAC8 haplotype, we also combined it with the functional variation sites of TAC1. Existing technology has confirmed that the TAC1 genome at position 2885bp is a single base "A" in the spread-type plants and a single base "G" in the compact-type plants. The single-base mutation directly determines the change in tillering angle and is common in rice. Therefore, in order to eliminate the interference of TAC1 on the tillering angle of each haplotype, the haplotypes of 109 germplasm materials TAC1 (LOC_Os09g35980) were analyzed. The haplotype analysis process was the same as that of TAC8. Since our main purpose was to determine the distribution of single bases at position 2885bp of TAC1 in the genome sequence, we only selected the SNP variation at physical position 2731844 on chromosome 9. The analysis results are shown in Appendix Table 1.
[0169] Based on the haplotype distribution of TAC8, the SNP at physical location 20731844 on chromosome 9 for haplotypes 1, 2, 3, and 4 is "G". Only 19 accessions of haplotype 5 showed genotyping at this location. Figure 8 A), and statistically analyzed the national distribution of the five haplotypes ( Figure 8 B). Based on the tillering angle survey of 109 germplasm materials sown at the Hunan Agricultural University Yunyuan Base in 2020 (Table 3),
[0170] Table 3. Tillering angles of 109 germplasm materials sown at the Hunan Agricultural University Yunyuan Base in 2020
[0171]
[0172]
[0173]
[0174] The correspondence between the phenotype and genotype of each material was plotted, and a box plot of the tiller angle corresponding to each haplotype was drawn (Fig. 5A). Figure 8 A), analysis showed that the tiller angle value of haplotype 5 / A was significantly higher than that of the other 5 types, and the tiller angle value of haplotype 5 / G was also significantly higher than that of the other 5 types, and the tiller angle of haplotype 4 / G was the smallest. Therefore, it can be determined that the haplotype analysis of TAC8 is not affected by the single base mutation of the major gene TAC1, and thus after eliminating the interference of the tiller angle of TAC1 haplotype, it can be determined that the deletion of the 44bp fragment at-838 in the promoter region of TAC8 is the functional fragment of TAC8 that determines the tiller angle. The deletion of this fragment will cause the tiller angle to become smaller, resulting in a compact plant with a smaller tiller angle.
[0175] Taking the presence or absence of the deletion of this fragment as the breakthrough point, the location at 838 upstream of the TAC8 gene was found, and a molecular marker RM5887 forward primer was designed at the functional fragment, and a corresponding reverse primer was designed, and the amplified fragment size was 78bp. The primer sequences of RM5887 are as follows: upstream primer 5'-TACCTCGAGGTACCGGTACATT-3'(SEQ ID NO. 9), downstream primer 5'-ATGTCCATACTGTCCAGCTA-3'(SEQ ID NO. 10). In order to verify whether the plant phenotype with smaller tiller angle caused by the deletion of the functional fragment at 838 upstream of the TAC8 gene promoter region corresponds to the field phenotype of rice, 28 germplasm materials with different tiller angle distributions were selected from 109 germplasm populations (provided in Table 5), and the corresponding material leaf DNA was extracted as a template. RM5887 was used as the amplification primer to perform PCR amplification using the gold medal high-fidelity enzyme of Genesee. The amplification system was as follows: gold medal enzyme 25μl, forward primer 2μl, reverse primer 2μl, template 1μl, ddH2O 20μl; the PCR cycle system was 94℃ for 3min, 94℃ for 30s, 55℃ for 30s, 72℃ for 3s, 35 cycles, 72℃ for 10min. After obtaining the PCR stock solution, 2% agarose gel electrophoresis was used for band observation, and the results are as follows (Fig. 5B). Figure 9As shown, in combination with the investigation of the field tillering angle size phenotype of the corresponding template germplasm material, the tillering angle material greater than 25° is generally identified as the larger tillering angle material, and the lanes producing the 78bp band of interest are phenotyped, and the result analysis finds that: lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 18, 19, 21, 22, 23, 24, 25, 26 produce 78bp bands in the target region, and the data of the lanes are corresponded to the field phenotype data respectively: 12.81°, 29.95°, 14.24°, 29.62°, 35.91°, 32.74°, 28.54°, 29.63°, 42.28°, 28.11°, 30.67°, 31.00°, 27.70°, 38.97°, 28.04°, 27.34°, 11.37°, 47.74°, 31.38°, 28.64°, according to the correspondence between the presence or absence of electrophoretic bands and field phenotypes, it is found that the field tillering angles of lanes 1, 3, 23 are 12.81°, 14.24°, 16.69°, but the target bands are amplified in the larger tillering angle germplasm, and the rest of the lanes are consistent with the expectation after removing the three lanes, the lanes producing bands are larger tillering angle germplasm materials; lanes 11, 14, 15, 16, 17, 20, 23, 27, 28 do not amplify the bands corresponding to the field phenotype in the target region, and the tillering angles of the nine lanes are: 12.78°, 41.27°, 28.58°, 17.02°, 16.34°, 28.11°, 11.37°, 14.59°, 13.53°, respectively, except that the field phenotypes of lanes 14, 15, 20 are large angle germplasm, which is not consistent with the expectation that the germplasm materials without amplifying bands are small angle materials, the other lanes without bands are corresponding to the field phenotype, and the germplasm represented by lanes 11, 16, 17, 23, 27, 28 is smaller tillering angle germplasm material.
[0176] Therefore, according to the deletion of the 44bp functional fragment of the TAC8 promoter region, the field tillering angle phenotype of the germplasm population material can be relatively accurately distinguished, but the accuracy is not very accurate, and auxiliary means is needed to improve the accuracy of molecular primer verification.
[0177] Example 4
[0178] With the main tillering angle locus TAC1 as an auxiliary means, a dCAPS primer is designed, and the specific method is as follows:
[0179] 1. TAC1 is located to a 35kb region on chromosome 9 in the F2 population of the hybrid of the introduced line IL55 of indica rice IR24 and japonica rice ASOMINORI, and it is found that TAC1 is mutated to "AGGA" in 21 wild rice and to "GGGA" in 88 compact japonica rice, and the mutation of single base "A" to "G" reduces the expression level of TAC1, resulting in compact plant structure with a tiller angle close to 0. According to the mutation of single base here, a dCAPS marker primer is designed, and the specific design method is as follows: first, find the position of single base mutation at 2884bp-2888bp of TAC1 genome, and introduce two bases "CC" in the sequence of the amplification primer RM529 before designing the primer, because the enzyme cutting site sequence of restriction endonuclease SmaI is "CCCGGG", the enzyme cutting site of restriction endonuclease SmaI is successfully introduced in the PCR product with TAC1 mutation base "G", and the amplification fragment size is 244bp, because the TAC1 gene in compact material is mutated to "G", and the single base at this position of the plant with larger tiller angle is "A", which cannot produce the enzyme cutting site of endonuclease SmaI.
[0180] The sequence of the dCAPS marker primer is
[0181] Forward primer: RM529F-AAGAAATTCCCTTTCACCTTTCCC (SEQ ID NO. 11);
[0182] Reverse primer: RM529R-TACAAGACACGTCAACTGTAGC (SEQ ID NO. 12).
[0183] Select the same 28 germplasm population materials with different tiller angle sizes (Table 4).
[0184] Table 4 28 germplasm population materials with different tiller angle sizes
[0185]
[0186]
[0187] DNA as template, using dCAPS marker primer RM529 (SEQ ID NO. 11-12) for amplification, PCR amplification system is 50 μl: MegaFi Fidelity 2x PCR MasterMix (No. abm, Lot. 20D07A) 25 μl, RM529 front primer 2 μl, RM529 rear primer 2 μl, template 1 μl, ddH2O 20 μl; PCR amplification procedure is: 98℃ 30s, 98℃ 10s, 55℃ 30s, 72℃ 8s, 30 cycles, 72℃ reannealing 2min; amplification gel map is as follows Figure 10 A, after amplification to obtain the target band, the gel recovery kit is used for target fragment recovery (the gel recovery step is the same as the knockout vector construction gel recovery step), because the single base of the tiller angle main effect locus TAC1 is "G" DNA as template amplification of PCR stock solution due to the artificial construction of SmaI enzyme cutting site, therefore can be endonuclease SmaI enzyme cutting into two fragments, the fragment size is 21bp, 223bp. The single base of the tiller angle main effect locus TAC1 is "A" DNA as template amplification of PCR stock solution can not be cut, only one band of 244bp, the recovered DNA fragment using restriction endonuclease SmaI (No. Thermo; LT-02241) for enzyme cutting, enzyme cutting system is 20 μl, 10x cut Smart buffer 2 μl, the amplified fragment 5 μl, restriction endonuclease SmaI 1 μl, ddH2O 12 μl; enzyme cutting temperature is 37℃, enzyme cutting time is 2h 40min, the product after enzyme cutting is run by 2% agarose gel electrophoresis, the gel map after enzyme cutting is as follows Figure 10As shown in Figure B, the size of the band generated by the gel can distinguish whether the DNA template of different germplasm materials can be cut by enzyme, and combined with the data of tillering angle phenotype of these materials planted in the base of Yunguan, Hunan Agricultural University in 2021, it can be found that the two lanes generated are the germplasm materials that can be cut by enzyme, which are small tillering angle germplasm materials. Combined with the 2% gel electrophoresis gel, lanes 1, 3, 4, 5, 7, 9, 10, 11, 16, 17, 21, 22, 23, 27, 28 generate two bands, respectively 223bp and 21bp band type, combined with the tillering angle size of each lane recorded in Table 5, the tillering angle of these germplasm materials in the field is: 12.81°, 14.24°, 29.62°, 35.91°, 28.54°, 42.24°, 28.11°, 12.78°, 17.02°, 16.34°, 28.04°, 27.34°, 11.37°, 14.59°, 13.53°, combined with the size of the tillering angle in the field, it can be found that lanes 4, 5, 7, 9, 10, 21, 22 are germplasm materials with larger tillering angle, but they are cut into two bands. However, the dCAPS marker for TAC1 compensates for the lack of TAC8 molecular marker RM5887 to correctly predict the tillering angle of lanes 1, 3, 23 of the germplasm materials. Lanes 2, 6, 8, 12, 13, 14, 15, 18, 19, 20, 24, 25, 26 all generate a band in the corresponding area, which is not cut by restriction endonuclease SmaI, combined with the corresponding lane germplasm in Table 5, the tillering angle in the field is: 29.95°, 32.74°, 29.63°, 30.67°, 30.99°, 41.27°, 28.58°, 27.70°, 38.97°, 28.11°, 47.74°, 31.38°, 28.64°, and the combination of the two observations shows that the tillering angle phenotype of the germplasm materials corresponding to the single band lane is a large angle material, which is consistent with the expectation. But part of the germplasm materials planted in the field have a phenotype of a larger tillering angle plant type, such as: lanes 4, 5, 7, 9, 10, 21, 22 are small tillering angle germplasm materials, and after enzyme cutting and 2% agarose gel electrophoresis, it is found that they are not cut into two fragments by endonuclease SmaI; However, the RM529 molecular marker compensates for the lack of the molecular marker RM5887 designed for TAC8 to correctly predict the tillering angle size of lanes 1, 3, 23 of the corresponding germplasm materials. Therefore, the dCAPS marker primer designed by the major locus TAC1 can predict the phenotype of most plants, and can compensate for the accuracy of the molecular marker RM5887 of TAC8 molecular marker prediction, but the accuracy of the single marker is still to be improved.
[0188] Therefore, the application can more accurately predict the tiller angle of the related germplasm by simultaneously performing molecular marker selection on the template DNA of the target germplasm by using the molecular marker RM5887 designed based on the discovered tiller angle major locus TAC8 and the dCAPs marker RM529 designed for TAC1, and providing a better solution for breeding of an ideal plant type.
[0189] Example 5
[0190] Double-PCR amplification
[0191] The method of multiplex PCR is used to simultaneously amplify the DNA of 28 germplasms with different tiller angles by using the marker primer RM5887 and the dCAPs marker primer RM529, and the primer design is performed according to a universal multiplex PCR method (a patent of Zhang Chunqing of Shandong Agricultural University):
[0192] Universal adapter-F: 5'-CTCGTAGACTGCGTACCA-3' (SEQ ID NO. 13);
[0193] Universal adapter-R: 5'-TACTCAGGACTCATCGTC-3' (SEQ ID NO. 14).
[0194] The PCR amplification is performed by using a two-stage cycle mode PCR amplification program, and the PCR amplification system is as follows: the PCR amplification program is as follows: ① pre-denaturation at 98℃ for 2 min; ② the first stage of cycle is "one-by-one annealing cycle", the cycle number is 3: denaturation: 98℃, 10s; annealing one by one in the order from high to low according to the annealing temperature of the multiple pairs of primers before adding the universal adapter, and the annealing time of each annealing temperature is 15s; extension: 72℃, 5s; ③ the second stage of cycle: cycle number: 28-32; denaturation: 94℃, 40s; annealing and extension process combined: 70℃, 50s; ④ final extension: 72℃, 5 min. The specific multiplex primer design is shown in Table 5:
[0195] Table 5: Adapter and primer parameters of marker primers RM5887 and RM529
[0196]
[0197]
[0198] The primers in the above table only list one group with the best effect, and in fact, according to the primer design principle, the inventors have designed more groups of primers, but the specificity of other primers is poor, and only this group has the best effect.
[0199] After the components are mixed evenly, multiple PCR is used for amplification. The amplification system is 50 μL, in which gold MIX is 40 μL, each pair of universal adapter primers (synthesized by Chengke, Changsha) is 2 μL, 2 μL of DNA, and the specific PCR program is as follows:
[0200]
[0201] After the PCR amplification is completed, 0.8 μL of the PCR amplification product, 0.4 μL of restriction endonuclease Smal, 1 μL of buffer, and 7.8 μL of ddH2O are taken; the enzyme cutting temperature is 37 °C; after the components are mixed evenly, enzyme cutting is performed, and the enzyme cutting time is 2 h 40 min. The original solution after enzyme cutting is also subjected to gel electrophoresis using 2% agarose. The voltage of electrophoresis is 150 V, and the time is 25 min. After the gel is run, the position of the target band is observed using a gel imaging instrument (Monad gel imaging system QuickGel 6100). The results of gel electrophoresis are as follows: Figure 11As shown, two bands were found in lanes 1, 3, 11, 16, 17, 23, 27, 28 at the positions of 203bp and 21bp by observation, and the corresponding tiller angle of each lane of germplasm material was 12.81°, 14.24°, 12.78°, 17.02°, 16.34°, 11.37°, 14.59°, 13.53° respectively, which were all germplasm materials with smaller tiller angles, and the results of running the glue were consistent with the actual field phenotype; two bands were produced in lanes 2, 6, 8, 12, 13, 14, 15, 18, 19, 24, 25, 26 at the positions of 244bp and 78bp, which corresponded to the fact that TAC1 molecular marker RM529 could not be cut and 78bp band produced by TAC8 molecular marker amplification, and the double selection of the two molecular markers predicted that these lanes were germplasm materials with larger tiller angles, and the corresponding field tiller angle examined in Table 5 was 29.95°, 32.74°, 29.63°, 30.67°, 30.99°, 41.27°, 28.58°, 27.66°, 38.97°, 47.74°, 31.38°, 28.64°, which were all germplasm materials with larger tiller angles, consistent with the results of gel electrophoresis; three bands were produced in lanes 4, 5, 7, 9, 10, 21, 22 at the positions of 203bp, 78bp, 21bp, and the corresponding field tiller phenotype was 29.61°, 35.91°, 28.54°, 42.28°, 28.11°, 28.04°, 27.34° respectively, although these germplasm materials could be cut by restriction enzyme SmaI, there was a 78bp band produced by the molecular marker primer RM5887 designed for TAC8, and the tiller angle phenotype data of the corresponding germplasm in the field could determine that the germplasm in this lane was a germplasm material with larger tiller angle; lane 20 only produced a 244bp band amplified by molecular marker RM529, and no 78bp product amplified by molecular marker RM5228, and whether the band was produced by RM529 amplification was used as the judgment standard, the tiller angle of the germplasm material corresponding to this lane was determined to be a germplasm material with larger tiller angle, and the field tiller angle phenotype data of the germplasm material provided in Table 5 was 28.11°, which was consistent with the actual situation. However, whether the 78bp band was amplified by another primer RM5228 using TAC8 as a molecular marker was used as a judgment standard, and since no 78bp band appeared at the corresponding position, it was determined that this germplasm material was a germplasm material with smaller tiller angle, and the field tiller angle of the corresponding field germplasm material in this lane was 28.11°, which was not consistent with the actual situation.Therefore, the prediction of the tillering angle of the germplasm material by one marker alone cannot accurately qualify the size of the tillering angle of the lane germplasm material after corresponding with the field phenotype, and the application uses two pairs of primers to simultaneously mark selection, takes the marker primer RM5887 designed by TAC8 of the tillering angle of rice as the main part, and takes the molecular marker primer RM529 designed by TAC1 as the auxiliary part, through the means of multiplex PCR, uses the 2% agarose gel electrophoresis without toxicity to observe, greatly avoids the possibility of prediction error, and can more accurately predict the tillering angle of the unknown germplasm material, and speeds up the process of molecular breeding.
[0202] The above-mentioned examples are for further illustrating the technical content of the application, but do not represent that the embodiments of the application are limited to this, and any transformation or technical extension according to the application is regarded as the protection scope of the application without departing from the principle of the application.
Claims
1. A primer for amplifying a gene controlling the tillering angle of rice, characterized by, The sequences are shown as SEQ ID NO. 15- SEQ ID NO.
18.
2. Application of the primer for amplifying the gene for controlling rice tillering angle in predicting the tillering angle of rice according to claim 1.
3. Application of the primer for amplifying the gene for controlling rice tillering angle in rice breeding according to claim 1.
4. Application of the primer for amplifying the gene for controlling rice tillering angle in preparing a kit for identifying the tillering angle of rice or rice breeding according to claim 1.
5. A kit characterized in that, 5. The kit comprises the primer for amplifying the gene for controlling rice tillering angle according to claim 1.
6. Application of the kit according to claim 5 in identifying the tillering angle of rice or rice breeding.
7. A method for detecting a molecular marker for controlling the tillering angle gene of rice, characterized in that, The method comprises the following steps: S1, extracting genomic DNA of different rice germplasm; S2, PCR amplification: using multiplex PCR amplification method to amplify the genomic DNA of the target germplasm; the sequence of the amplification primer is shown as SEQ ID NO. 15- SEQ ID NO. 18; S3, performing gel electrophoresis on the PCR product, and determining the tillering angle of the target germplasm according to the electrophoresis result; the rice germplasm producing 244bp band in the target region is the rice germplasm with larger tillering angle, and the rice germplasm producing 203+21bp band and 78bp band in the target region is also the rice germplasm with larger tillering angle, wherein the larger tillering angle refers to the tillering angle greater than 25°.
8. The method of claim 7, wherein the molecular marker for detecting the rice tiller angle gene is selected from the group consisting of SEQ ID NOs: 1 to 4. The method further comprises verification, and the verification step comprises: planting the target germplasm, investigating the field tillering angle, corresponding to the marker result one by one, and determining the accuracy of the developed marker.
Citation Information
Patent Citations
Cloning and application of the rice tillering angle gene TAC3
CN107937409B