A kit for predicting the resistance of colorectal cancer patients to cetuximab or the efficacy of cetuximab

Abstract

The present invention provides a kit for predicting the resistance of colorectal cancer patients to cetuximab or the efficacy of cetuximab, comprising reagents for detecting the level of asparaginyl endopeptidase (AEP) protein or the expression level of its encoding gene. The present invention also provides the use of an asparaginyl endopeptidase inhibitor in the preparation of a drug for preventing or treating cetuximab resistance in colorectal cancer, and a pharmaceutical composition for treating colorectal cancer comprising an asparaginyl endopeptidase inhibitor and cetuximab. The present invention discovers for the first time that AEP can be used as a specific marker for predicting the efficacy of cetuximab treatment in advanced colorectal cancer, and can be used as a therapeutic target for improving the resistance of intestinal cancer cells to cetuximab or enhancing the sensitivity of cetuximab.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the field of cancer treatment technology. Background Art

[0002] Colorectal cancer is a malignant digestive tract tumor, and nearly half of patients have distant metastasis at the time of initial diagnosis. Targeted drugs for colorectal cancer include: monoclonal drugs targeting epidermal growth factor receptor (EGFR), represented by cetuximab and panitumumab; monoclonal drugs targeting vascular endothelial growth factor (VEGF), represented by bevacizumab.

[0003] In my country, the most widely used EGFR monoclonal antibody for colorectal cancer is cetuximab, which can bind to the extracellular region of EGFR, block EGFR activation and signal transduction, and thus play an anti-tumor role. The proto-oncogene RAS (including KRAS, NRAS, etc.) is an important molecule in the downstream signaling pathway of EGFR. Mutations in the RAS gene can affect the effect of EGFR inhibitors. A large number of literatures show that mutations in the proto-oncogene RAS are insensitive to treatments such as cetuximab. About 50% of patients with metastatic colorectal cancer have wild-type RAS genes, and these patients can benefit from EGFR monoclonal antibodies combined with chemotherapy.

[0004] Even for colorectal cancer patients with wild-type RAS genes, the median effective time of cetuximab is only about one year. The resistance mechanism is related to the presence of RAS gene heterogeneity in tumor tissues, changes in the EGFR signaling pathway or bypass activation, or mutations in the extracellular region of EGFR. However, the specific mechanism still needs to be further explored. Therefore, it is of great clinical significance to explore the molecular mechanism of cetuximab resistance in colorectal cancer and to find specific biomarkers that predict efficacy and effective therapeutic targets. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a kit for predicting the drug resistance of colorectal cancer patients to cetuximab or the efficacy of cetuximab, thereby avoiding excessive exposure of people who may not be effective to drug treatment, reducing side effects, and improving socioeconomic benefits.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides a kit for predicting the drug resistance of colorectal cancer patients to cetuximab or the efficacy of cetuximab, comprising a reagent for detecting the level of asparagine endopeptidase protein or the expression level of its encoding gene.

[0008] Asparaginyl endopeptidase (AEP), also known as δ-secretase or legumain (LGMN), is a cysteine endopeptidase of the C13 family. In humans, AEP is encoded by the LGMN gene located on chromosome 14q32.12. Information on the AEP protein and its encoding gene can be obtained from biological information databases such as NCBI, Genecards, and KEGG.

[0009] Preferably, the reagents for detecting the asparaginyl endopeptidase protein level include antibodies, oligopeptides, ligands, peptide nucleic acids, and aptamers that can specifically bind to AEP, including but not limited to AEP antibodies (R&D Systems, AF2199 and R&D Systems, DY4769).

[0010] Preferably, the reagents for detecting the asparaginyl endopeptidase gene expression level include primers, probes, and antisense nucleotides that can specifically amplify all or part of the AEP encoding gene, including but not limited to an oligothymine primer set, and the oligothymine primer set includes:

[0011] Forward primer as shown in SEQ ID NO.1: TCGTCCTACGCCTGTTACTA;

[0012] Reverse primer as shown in SEQ ID NO.2: GATCTTCCACGTCCGAATCTT.

[0013] The kit described in the present invention may further include one or more other component compositions, solutions, or devices suitable for extracting or detecting the asparaginyl endopeptidase protein or the expression level of its encoding gene.

[0014] The second aspect of the present invention provides a method for predicting the resistance information of colorectal cancer patients to cetuximab, including the following steps:

[0015] Obtain a biological sample of a colorectal cancer patient, and use the kit described in the above technical solution to detect the asparaginyl endopeptidase protein level or the expression level information of its encoding gene in the biological sample.

[0016] Preferably, the biological sample is the patient's tumor tissue or serum.

[0017] Preferably, the method further includes comparing the asparaginyl endopeptidase protein level or the expression level of its encoding gene in the biological sample with a control group or a preset limit value to obtain the prediction information on the resistance of colorectal cancer patients to cetuximab.

[0018] Preferably, the preset limit value is: the expression level of asparaginase endopeptidase protein in the patient's serum is 218.35 pb / mL; when the expression level of asparaginase endopeptidase protein > 218.35 pb / mL, it is a high expression level, and it is judged that the colorectal cancer patient has a high resistance to cetuximab; when the expression level of asparaginase endopeptidase protein ≤ 218.35 pb / mL, it is a low expression level, and it is judged that the colorectal cancer patient has a low resistance to cetuximab.

[0019] The third aspect of the present invention provides the use of an asparaginase endopeptidase inhibitor in the preparation of a drug for preventing or treating cetuximab resistance in colorectal cancer.

[0020] Preferably, the asparaginase endopeptidase inhibitor includes one or more of RR-11aanalog (authorized patent number: CN202110256005.0), small molecule inhibitor of asparaginase endopeptidase (authorized patent number CN201711329218.1), δ-secretase inhibitor 11 (PubChem CID: 1095027, J&K Scientific Ltd).

[0021] The fourth aspect of the present invention is a pharmaceutical composition for preventing or treating colorectal cancer, comprising cetuximab and an asparaginase endopeptidase inhibitor.

[0022] Preferably, the asparaginase endopeptidase inhibitor includes one or more of RR-11aanalog (authorized patent number: CN202110256005.0), AEP inhibitor (authorized patent number CN201711329218.1), δ-secretase inhibitor 11 (PubChem CID: 1095027, J&K Scientific Ltd).

[0023] Preferably, the ratio of cetuximab to the asparaginase endopeptidase inhibitor is 5 - 50 μg / ml : 20 - 40 μM; more preferably 10 μg / ml : 30 μM.

[0024] Compared with the prior art, the beneficial effects of the present invention are:

[0025] Through bioinformatics analysis, the present invention screens out the AEP gene related to the efficacy of cetuximab. Experiments find that AEP is related to the progression-free survival (PFS) of cetuximab clinically, and the PFS of patients with high AEP expression is short. Further research shows that the sensitivity of colorectal cancer cells with overexpressed AEP to cetuximab decreases and the drug resistance increases. After treating colorectal cancer cells with overexpressed AEP with an AEP inhibitor, the sensitivity to cetuximab is restored.

[0026] The present invention for the first time discovers that asparaginyl endopeptidase (AEP) is related to the resistance of colorectal cancer patients to cetuximab. AEP can be used as a specific marker for predicting the efficacy of cetuximab treatment for advanced colorectal cancer, thereby further providing a kit for predicting the resistance of colorectal cancer patients to cetuximab or the efficacy of cetuximab. Based on the research of the present invention, AEP can also be used as a therapeutic target for improving the resistance of intestinal cancer cells to cetuximab or enhancing the sensitivity of cetuximab, thereby further providing the application of AEP inhibitors in the preparation of drugs for preventing or treating colorectal cancer resistant to cetuximab, and a colorectal drug composition comprising cetuximab and an asparaginyl endopeptidase inhibitor. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a survival curve graph for bioinformatics analysis of the expression level of asparaginyl endopeptidase and the efficacy of cetuximab;

[0028] Figure 2 It is a graph for immunohistochemical detection of the expression level of AEP in the tumor tissues of patients;

[0029] Figure 3 It is a graph showing a close correlation between the expression level of AEP and the PFS of patients;

[0030] Figure 4 It is a graph showing the effect of verifying the knockdown or overexpression of AEP in cells;

[0031] Figure 5 It is a graph showing the sensitivity of cells with knockdown or overexpression of AEP to cetuximab;

[0032] Figure 6 It is a graph showing the therapeutic effect of cetuximab combined with an AEP inhibitor. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0033] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0034] Example 1

[0035] Download the baseline tumor tissue expression profile chip data (GSE5851) of 80 colorectal cancer patients with wild-type KRAS who received cetuximab treatment from the GEO database (website: https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc = GSE5851). Using the median gene expression level as the cutoff value, perform univariate analysis (log-rank), and P < 0.05 is considered statistically significant.

[0036] The analysis results are as Figure 1As shown, the expression level of asparaginyl endopeptidase (AEP) gene is closely related to the progression-free survival (PFS) of patients (P = 0.00133). Patients with high expression of asparaginyl endopeptidase (AEP) gene have a short PFS.

[0037] Example 2

[0038] Forty-four patients with metastatic colorectal cancer admitted to the Department of Oncology, Zhongshan Hospital, Fudan University from August 2016 to April 2017 were collected. These patients were newly diagnosed with advanced colorectal adenocarcinoma, had not received prior systemic palliative treatment, and were planned to receive cetuximab treatment as first-line palliative treatment. Tumor biopsy specimens (obtained by colonoscopy or surgery) and peripheral blood were collected at the time of initial diagnosis of the patients. The expression levels of asparaginyl endopeptidase (AEP) in the tumor tissues and peripheral blood sera of the tested patients were detected by immunohistochemistry and ELISA methods respectively.

[0039] The steps of immunohistochemistry are as follows:

[0040] (1) Place the tissue white slices in an oven at 60 °C for 30 minutes or overnight at 37 °C, and then soak them in xylene solution for 30 minutes;

[0041] (2) Immerse the tissue sections in xylene solutions I and II in turn, each for 10 minutes;

[0042] (3) Immerse the tissue sections in ethanol solutions with concentrations of 95%, 80%, and 75% for 5 minutes each;

[0043] (4) Wash the sections with PBS solution 2 - 3 times, 5 minutes each time;

[0044] (5) Add 5% hydrogen peroxide to the wet box to completely cover the tissue and inactivate endogenous peroxidase;

[0045] (6) Then wash the sections with PBS solution 2 - 3 times, 5 minutes each time;

[0046] (7) Microwave heat repair: Heat the citrate repair solution in the microwave, put in the tissue sections, continuously heat with low power in the microwave for 7 minutes, cut off the power and cool for 2 minutes, and then continue to heat with low power for 2 minutes. Take out the sections and place them in a ventilated place to cool to room temperature. Wash the sections with PBS solution 3 times, 5 minutes each time;

[0047] (8) Drop 65% BSA to block the sections, at room temperature for 40 minutes, and discard the excess liquid;

[0048] (9) Add the primary antibody AEP antibody, at 37 °C for 1 - 2 hours or overnight at 4 °C. Re-warm at 37 °C for 45 minutes the next day after overnight incubation;

[0049] (10) Wash with PBS solution 3 times, 5 minutes each;

[0050] (11) Add the secondary antibody of solution A (no dilution required), soak the whole tissue section, incubate at room temperature for 1 hour, then wash with PBS solution 3 times, 5 minutes each time;

[0051] (12) Add 1 ml of solution B and 20 μl of DAB, mix well, drop this working solution onto the section, develop for 5 - 10 minutes, and observe the staining degree under the microscope. It is appropriate when positive staining appears and there is no yellow background;

[0052] (13) Rinse with PBS or tap water for 10 minutes to terminate the reaction;

[0053] (14) Evenly drop a small amount of hematoxylin onto the section, counterstain for 2 minutes, then slowly rinse under running water for 10 - 15 minutes;

[0054] (15) Place the tissue section in ethanol solutions with concentrations of 75%, 80%, and 90% for 5 minutes each in sequence;

[0055] (16) Then place it in xylene solutions I and II for 10 minutes each;

[0056] (17) Mount the section with neutral balsam, cover it with a coverslip, without leaving air bubbles in the tissue area, observe and take pictures under the microscope.

[0057] The immunohistochemistry scoring method is as follows: According to the staining intensity, it can be divided into 0 points (no staining), 1 point (light staining), 2 points (medium staining), and 3 points (strong staining); according to the staining area, it can be divided into 1 point (≤25%), 2 points (>25%, ≤50%), 3 points (>50%, ≤75%), and 4 points (>75%). Multiply the scores of the staining intensity and the staining area, and the product ranges from 0 - 12 points. Define 0 - 6 as low expression and 7 - 12 points as high expression. The results are as Figure 2 shown: The two left pictures are examples of high expression of AEP, and the two right pictures are examples of low expression of AEP.

[0058] The detection method of ELISA is enzyme - linked immunosorbent assay. The operation steps are as follows:

[0059] (1) Dilute the Capture antibody with PBS solution without carrier protein to an appropriate concentration, add 100 μL of the diluted Capture antibody to each well in a 96 - well plate, and incubate overnight at room temperature;

[0060] (2) Wash three times with Wash Buffer, completely discard the washing solution, and invert it on a clean absorbent paper;

[0061] (3) Add 300 μL of Reagent Diluent to each well, incubate at room temperature for at least 1 hour; repeat the washing according to step (2);

[0062] (4) Add 100 μL of the diluted sample or standard to each well, seal and incubate at room temperature for 2 hours, and repeat the washing according to step (2);

[0063] (5) Add 100 μL of AEP antibody to each well, seal and incubate at room temperature for 2 hours, and wash according to step (2);

[0064] (6) Add 100 μl of Substrate Solution to each well, incubate in the dark at room temperature for 20 minutes;

[0065] (7) Add 50 μl of Stop Solution to each well, gently shake to mix, and the color in the well changes from blue to yellow;

[0066] (8) Read the OD value at a wavelength of 450 nm within 30 minutes;

[0067] (9) Prepare a standard curve and calculate the protein expression level.

[0068] The test results showed that the average value of AEP expression level in the patient serum was 234.88 ± 87.11 pg / ml, the median was 218.35 ± pg / ml, and the range was 101.67 - 423.33 pg / ml. Taking the median as the critical value, the expression level of AEP was divided into high expression (>218.35 pg / ml) and low expression (≤218.35 pg / ml). As Figure 3 shown, it was found that the expression level of AEP in the patient tumor tissue (left figure) and serum (right figure) was closely related to the progression-free survival (PFS) of the patients. The median PFS of the patients with high expression was shorter than that of the patients with low expression.

[0069] The above results showed that high expression of AEP was related to the short progression-free survival time after cetuximab treatment.

[0070] Example 3

[0071] Lentivirus transfection was used to transfect rectal cancer cells Caco2 and rectal cancer cells NCI-H508 to knockdown AEP (AEP-KD) or overexpress AEP (AEP-OE), and stable expressing cell lines were screened out. The specific steps are as follows:

[0072] (1) Construct AEP interference or overexpression plasmid vectors;

[0073] (2) 18 - 24 hours before lentivirus transfection, evenly spread the cells into a six-well plate and continue culturing;

[0074] (3) When the cell density reaches about 60 - 80%, discard the culture medium and wash twice with PBS;

[0075] (4) Add serum-free medium containing 0.1% polybrene, and according to the lentivirus operation manual, add an appropriate amount of virus suspension and mix well;

[0076] (5) Continue culturing for 24 hours, observe the cell status, discard the medium containing the virus, and replace it with fresh complete medium;

[0077] (6) Continue culturing, and observe the transfection situation under a fluorescence microscope 72 hours later;

[0078] (7) Use Western blot and ELISA methods to detect the knockdown or overexpression effects, and screen to obtain the stably expressed AEP knockdown cell lines AEP-KD (Caco2-AEP-KD and NCI-H508-AEP-KD) and the stably expressed AEP overexpression cell lines AEP-OE (Caco2-AEP-OE and NCI-H508-AEP-OE).

[0079] The results are as Figure 4 shown. Figure 4A shows the Western blot detection results of Caco2 and NCI-H508 cells, and Figure 4B shows the ELISA detection results in the supernatants of Caco2 and NCI-H508 cells. The results show that the expression levels of AEP in the cells of AEP knockdown group 1 (AEP-KD1) and AEP knockdown group 2 (AEP-KD2) are significantly decreased compared with the blank control group (control) and the knockdown empty plasmid group (KD-NC). The expression level of AEP in the cells of the AEP overexpression group (AEP-OE) is significantly increased compared with the blank control group (control) and the overexpression empty plasmid group (OE-NC).

[0080] According to the cell IC 50 value (about 50 μg / mL for Caco2 cells and about 1 μg / mL for NCI-H508 cells), set a series of concentration gradients of cetuximab to treat for 48 hours. The culture conditions are normal culture in a 37 °C saturated humidity incubator under 5% CO2. The concentration range of cetuximab in Caco2 cells is 0 - 250 μg / mL, and the concentration gradients are set as 0, 5, 10, 50, 100, 250 μg / mL; the concentration range of cetuximab in NCI-H508 cells is 0 - 50 μg / mL, and the concentration gradients are set as 0, 0.5, 1, 5, 10, 50 μg / mL. Use the CCK-8 method to detect the cell proliferation ability, and the results are as Figure 5As shown, the left figure is Caco2 cells and the right figure is NCI-H508 cells. The results show that after the intervention of cetuximab, compared with the blank control group (control) and the AEP knockdown empty plasmid group (AEP-KD-NC), the cell proliferation of the AEP knockdown group 1 (AEP-KD1) and the AEP knockdown group 2 (AEP-KD2) is significantly reduced, that is, the sensitivity to cetuximab is increased; compared with the blank control group (control) and the AEP overexpression empty plasmid group (AEP-OE-NC), the cell proliferation of the AEP overexpression group (AEP-OE) is significantly increased, that is, the sensitivity to cetuximab is reduced.

[0081] The above results show that the cells with overexpressed AEP have a decreased sensitivity to cetuximab and an increased drug resistance.

[0082] Example 4

[0083] The small molecule inhibitor of asparagine endopeptidase (authorized patent number CN201711329218.1) (20 μM and 40 μM) was added to the culture media of Caco2-AEP-OE and NCI-H508-AEP-OE cells, and the cells were treated simultaneously with cetuximab (50 μg / ml and 5 μg / ml respectively), and the cells were placed in a conventional incubator with 5% CO2 at 37 °C under saturated humidity for culture. The CCK8 method was used to detect the cell viability. The operation steps are as follows:

[0084]

[0085] Small molecule inhibitor of asparagine endopeptidase

[0086] (1) The NCI-H508-AEP-OE and Caco2-AEP-OE cells prepared in Example 3 were digested with trypsin, and the digestion time was appropriately extended to ensure that the adherent cells could be dispersed into single suspended cells;

[0087] (2) The cells were counted using a cell counter, the cell density was calculated, and the cells were diluted to a density of 20,000 cells / ml. The cells were seeded in a 96-well plate, with 100 μL of culture medium in each well, and the number of cells in each well was 2,000;

[0088] (3) The next day, the drugs were added according to the concentration gradient, with 3 replicates for each concentration, and the cells were treated for 48 hours;

[0089] (4) Detect the cell viability with CCK8 reagent

[0090] (5) Dilute CCK8 with serum-free medium at a ratio of 1:10 and store it in the dark;

[0091] (6) Wash the culture medium in the wells with a vacuum pump, but avoid sucking the adherent cells out by contacting the bottom with the pipette tip;

[0092] (7) Operate 12 wells each time to prevent the complete evaporation of the residual culture medium in the wells from affecting cell viability;

[0093] (8) Add the diluted CCK8 reagent stored in the dark into the wells, 100 μL per well;

[0094] (9) Incubate the 96-well plate at 37 °C in the dark for 2 hours;

[0095] (10) Detect the absorbance at OD450nm with an enzyme-linked immunosorbent assay (ELISA) reader.

[0096] The results are as Figure 6 shown. The upper figure is the detection result of Caco2-AEP-OE cells, and the lower figure is the detection result of NCI-H508-AEP-OE cells. The results show that after the cells with overexpressed AEP are treated with an AEP inhibitor (black), the sensitivity to cetuximab is restored.

[0097] The above results show that the AEP inhibitor can restore the sensitivity of drug-resistant cells to cetuximab.

[0098] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of asparaginyl endopeptidase inhibitor in the preparation of a drug for treating cetuximab resistance in colorectal cancer; The asparaginyl endopeptidase inhibitor is the following small molecule inhibitor of asparaginyl endopeptidase:

2. A pharmaceutical composition for treating colorectal, characterized in that, Comprising cetuximab and an asparaginyl endopeptidase inhibitor; The asparaginyl endopeptidase inhibitor is the following small molecule inhibitor of asparaginyl endopeptidase:

3. The pharmaceutical composition according to claim 2, wherein The ratio of cetuximab to asparaginyl endopeptidase inhibitor is 5-50 μg / ml: 20-40 μM.

Images