A kind of alicyclic bacteria T452 with high molecular weight aromatic hydrocarbon compound degradation function and its application

Abstract

The present invention discloses a lipophilic bacteria T452 having the function of degrading high molecular weight aromatic hydrocarbon compounds and its application. Alicycliphilus sp. T452 was deposited in the Guangdong Microbial Culture Collection Center (GDMCC) on December 12, 2022, with the address of 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC NO: 63025. The lipophilic bacteria (Alicycliphilus sp.) T452 of the present invention is a bacterium having the function of degrading aromatic hydrocarbon compounds, which can degrade polycyclic aromatic hydrocarbons, chlorinated aromatic hydrocarbons and tetrabromobisphenol A in polluted water or sediments under aerobic and nitrate reduction conditions, and provide strains and microbial preparations for the remediation of polluted water bodies. At the same time, the research on the lipophilic bacteria will provide theoretical guidance for its application in the remediation of polluted water bodies and the removal of aromatic hydrocarbon compounds.

Description

Technical field:

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to alicyclic bacteria T452 having the function of degrading high molecular weight aromatic hydrocarbon compounds under aerobic or anaerobic conditions and an application thereof. Background technology:

[0002] Aromatic hydrocarbons are ubiquitous in environmental media, and many of them are persistent organic pollutants, such as polycyclic aromatic hydrocarbons, halogenated aromatic hydrocarbons, and heterocyclic aromatic hydrocarbons. Most of these organic pollutants are biologically toxic, and some even have teratogenic, carcinogenic, and mutagenic effects, which are extremely harmful to human health and the ecological environment. Microbial degradation is an important way to remediate aromatic hydrocarbon pollution. The acquisition of degradation functional bacteria and the elucidation of their degradation mechanisms are urgent needs in the fields of pollution control and ecological restoration.

[0003] At present, many microorganisms with the ability to degrade aromatic hydrocarbons have been found in the environment. These microorganisms can use oxygen or nitrate, sulfate and trivalent iron as electron acceptors under anaerobic conditions to drive the degradation and transformation of aromatic hydrocarbons. However, due to the slow degradation process of most aromatic hydrocarbons, especially polycyclic aromatic hydrocarbons, halogenated aromatic hydrocarbons and heterocyclic aromatic hydrocarbons, which are high molecular weight and stable persistent organic pollutants, it is difficult to obtain degrading bacteria through conventional enrichment culture methods. At present, there are few reports on related degradation functional microorganisms. For example, only four strains of microorganisms have been reported to degrade benzo(a)pyrene, a typical high-ring aromatic hydrocarbon pollutant, under anaerobic conditions. This not only affects the scientific understanding of the microbial degradation mechanism of these high molecular weight aromatic hydrocarbons, but also greatly limits the effective control of such toxic organic matter. Therefore, the acquisition of microbial strains with high molecular weight aromatic hydrocarbon degradation function is of great significance to the scientific understanding of related degradation mechanisms and the effective control of related pollutants. Summary of the invention:

[0004] The purpose of the present invention is to provide an Alicycliphilus sp. T452 having the ability to degrade high molecular weight aromatic hydrocarbon compounds under aerobic, anaerobic or nitrate-reducing conditions. The strain was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on December 12, 2022, with the address being 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC NO: 63025.

[0005] The second object of the present invention is to provide an application of Alicycliphilus sp. T452 in removing high molecular weight aromatic hydrocarbon compounds.

[0006] Preferably, the Alicycliphilus sp. T452 is used for purifying high molecular weight aromatic hydrocarbon compounds in polluted air, water, sediment or soil.

[0007] Studies have found that in the sediments of a river in the Pearl River Delta that was once polluted by aromatic hydrocarbon compounds, there is a certain abundance of Alicycliphilus. The present invention enriched, cultured, separated and purified the riverbed mud that was once polluted by aromatic hydrocarbon compounds in Ronggui, Foshan, Guangdong, to obtain strain T452, which belongs to the genus Alicycliphilus and is named Alicycliphilus sp. T452.

[0008] The inventors have isolated and obtained a strain T452 that can degrade high molecular weight aromatic hydrocarbon compounds under aerobic and anaerobic conditions from river sediments that were once contaminated by aromatic hydrocarbon compounds. The strain is located in the genus Alicycliphilus. Alicycliphilus is a type of bacteria with a wide range of xenobiotic degradation capabilities. Studies have reported the degradation function of this type of bacteria on several low molecular weight aromatic hydrocarbon pollutants such as benzene, toluene and naphthalene. The present invention analyzes the degradation capability of the strain on high molecular weight polycyclic aromatic hydrocarbons, focuses on illustrating the degradation kinetics and degradation pathway of the strain on the typical high-ring aromatic hydrocarbon pollutant benzo(a)pyrene, and reveals through genome analysis that the strain has a wide range of aromatic hydrocarbon degradation capabilities, establishes a method for strengthening the removal of high molecular weight aromatic hydrocarbon compounds using the strain, and provides technical support for the purification of polluted air, water, sediments and soil.

[0009] The Alicycliphilus sp. T452 of the present invention has the ability to degrade high molecular weight aromatic hydrocarbon compounds under aerobic or nitrate reduction conditions, and can remove high molecular weight aromatic hydrocarbon compounds in the air, water, sediment and soil, providing microbial strain resources and enhanced treatment methods for air purification, river restoration, wastewater treatment and soil management.

[0010] Alicycliphilus sp.T452 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on December 12, 2022, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC NO: 63025. Description of the drawings:

[0011] Figure 1 is a species phylogenetic diagram of Alicycliphilus sp. T452 in Example 1;

[0012] Figure 2is a transmission electron micrograph of Alicycliphilus sp. T452 in Example 1;

[0013] Figure 3 is a kinetic diagram of benzo(a)pyrene degradation by Alicycliphilus sp. T452 in Example 4;

[0014] Figure 4 This is the aromatic hydrocarbon degradation pathway of Alicycliphilus sp. T452 in Example 6. Specific implementation method:

[0015] In the following, in conjunction with the accompanying drawings, the present invention further describes in detail the alicyclic bacteria T452 having the function of degrading aromatic hydrocarbon compounds and its application through examples. The present invention is not limited to the description of the following examples.

[0016] Example 1: Classification and physiological characteristics of Lipocycline T452

[0017] Strain T452 was isolated from a river sediment in Ronggui, Foshan, Guangdong Province. Strain T452 was cultured using R2A solid medium. After the colony was formed, the 16S rRNA gene of strain T452 was PCR amplified and sequenced using universal primers 27F (agagtttgat cctggctcag) and 1492R (tacgacttaaccccaatcgc). The sequencing results were spliced ​​to obtain a nearly complete 16S rRNA gene sequence, as shown in SEQ ID NO.1. The 16SrRNA sequence in the GenBank database of NCBI was compared to obtain the sequence of closely related strains with high homology, and a phylogenetic tree was constructed on MEGA5 to determine the taxonomic status of strain T452. Strain T452 was morphologically observed using a transmission electron microscope. The carbon source utilization ability of strain T452 was determined using Biolog GENIII. The growth pH (5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10), temperature (4, 10, 15, 20, 25, 30, 35, 40, 43) and salinity (sodium sulfide equal amount, 0%, 1%, 2%, 3%, 4%, 5%, 10%) of strain T452 were measured using R2A liquid medium.

[0018] The results showed that the 16S rRNA gene sequence of strain T452 was similar to that of Alicycliphilus denitrificans K601 T The highest similarity (98.7%) is observed in the phylogenetic tree, and it is adjacent to the genus Lipocyclum ( Figure 1). This indicates that strain T452 belongs to a species of the genus Lipocyclus. After 3 days of culture on R2A solid medium, strain T452 formed 1-2 mm transparent colonies with round, protruding, smooth surface and neat edges. Transmission electron microscopy showed that the bacteria were 1.0-1.8 μm long, 0.5-0.7 μm wide, and had a single flagellum ( Figure 2 ). The growth temperature range is 20-40℃, the growth pH range is 6.0-9.0, and the maximum salt tolerance is 2%. The carbon sources used include lactic acid, glycerol, D-fructose-6-phosphate, L-alanine, L-aspartic acid, L-glutamic acid, L-pyroglutamic acid, L-serine, L-galacturonan, D-glucuronic acid, glucuronamide, mucic acid, saccharic acid, methylpyruvic acid, citric acid, α-keto-glutaric acid, D-malic acid, L-malic acid, α-hydroxy-butyric acid, hydroxybutyric acid, Tween 40, α-keto-butyric acid, propionic acid and acetic acid.

[0019] Morphological, physiological, biochemical and molecular taxonomic identification showed that strain T452 belongs to the species of the genus Alicycliphilus and was named Alicycliphilus sp. T452. It was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on December 12, 2022, with the address at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070, and the collection number is GDMCC NO: 63025.

[0020] Example 2: Degradation characteristics of polycyclic aromatic hydrocarbons by alicyclic bacteria T452

[0021] The alicyclic bacteria T452 were activated on R2A and the OD 600 The concentration of 0.01 was inoculated into R2A liquid medium containing 10 g / L potassium nitrate and cultured anaerobically at 180 rpm until the OD 600 When the concentration of pyrene, benz(a)anthracene and benzo(a)pyrene was 0.4 (1 day), 500 μg / L pyrene, benz(a)anthracene and benzo(a)pyrene were added respectively. After culturing for another 2 days, the degradation rate of each PAH was extracted and determined by UPLC. A sterile control group was set up, R2A liquid culture medium containing 10 g / L potassium nitrate and 500 μg / L pyrene, benz(a)anthracene and benzo(a)pyrene were added, and the alicyclic bacteria T452 was not inoculated. After anaerobic placement at 180 rpm for 2 days, the concentration of each PAH was determined.

[0022] The results showed that the PAHs in the sterile control group did not decrease significantly, while the treated group inoculated with strain T452, including pyrene, benzo(a)anthracene and benzo(a)pyrene, decreased by about 60%, 62% and 56%, respectively. This indicates that strain T452 has the ability to degrade high molecular weight PAHs such as pyrene, benzo(a)anthracene and benzo(a)pyrene.

[0023] Example 3: Degradation characteristics of benzo(a)pyrene by alicyclic bacteria T452 under aerobic and nitrate-reducing conditions

[0024] The alicyclic bacteria T452 were activated on R2A and the OD 600 The concentration of 0.01 was inoculated into R2A liquid medium containing 10 g / L potassium nitrate and cultured anaerobically at 180 rpm until the OD 600 When the OD value was 0.2 (about 18 hours), the cells were collected by centrifugation at 8000 g, washed with M9 inorganic salt medium, and then the cells were counted according to the OD value. 600 The culture medium was inoculated with 0.25% benzo(a)pyrene and 2g / L potassium nitrate in M9 inorganic salt medium, and cultured under anaerobic and aerobic conditions. Each experimental treatment group was replicated 3 times, and the sterilization control group was replicated 3 times. Samples were taken on the 0th and 4th days to measure the changes in benzo(a)pyrene concentration.

[0025] The results showed that the degradation rate of benzo(a)pyrene was about 38% under aerobic conditions, while the degradation rate was about 62% under nitrate reduction conditions, indicating that strain T452 has the ability to degrade benzo(a)pyrene under both aerobic and nitrate reduction conditions, and is more efficient under anaerobic nitrate reduction conditions.

[0026] Example 4: Degradation kinetics of benzo(a)pyrene by Lipocyclin T452 under nitrate-reducing conditions

[0027] The alicyclic bacteria T452 were activated on R2A and the OD 600 The 0.01% benzo(a)pyrene was inoculated into R2A liquid medium containing 5 g / L potassium nitrate, 1 mg / L benzo(a)pyrene was added, and a sterilization control group was set up. The degradation rate and OD of benzo(a)pyrene were measured at 0, 4, 8, 12, 24, 48, 72, and 96 hours. 600 and changes in nitrate concentrations.

[0028] The results are as follows Figure 3 As shown, the nitrate content of strain T452 decreased significantly during its growth ( Figure 3 A), indicating that the bacteria use nitrate as an electron acceptor for growth and reproduction. The added 1 mg / L of benzo(a)pyrene was also gradually degraded and removed during the anaerobic growth of the strain ( Figure 3 B), the final degradation rate reached 40.6% after 100 hours, which was significantly different from the control group (p<0.01).

[0029] Example 5: Degradation characteristics of tetrabromobisphenol A by alicyclic bacteria T452 under aerobic conditions

[0030] The alicyclic bacteria T452 were activated on R2A and the OD 600The concentration of tetrabromobisphenol A was determined by inoculating 0.2% of the sample into M9 inorganic salt medium containing 10 mg / L tetrabromobisphenol A, with 3 replicates and a sterilization control group. Samples were taken on the 0th and 7th days to determine the changes in the concentration of tetrabromobisphenol A.

[0031] The results showed that the tetrabromobisphenol A in the sterilization control group decreased by 12.9%, while the tetrabromobisphenol A in the treatment group with the addition of Lipocycline T452 decreased by 42.3%, which was significantly lower than the sterilization control group (p<0.01), indicating that Lipocycline T452 has a higher tetrabromobisphenol A degradation ability.

[0032] Example 6: Genomic analysis reveals the pathway for degradation of aromatic hydrocarbons by Lipocycline T452

[0033] The total DNA of A. lipolytica T452 was extracted, and its genome framework map was determined by the second-generation sequencing method. The offline data was assembled using SPAdes V3.13.1 software, and Prodigal v2.6.3 and eggNOG-mapper were used for gene prediction and annotation, respectively, and the metabolic pathway was reconstructed using KEGG-mapper.

[0034] The results showed that there were a large number of genes related to the degradation of aromatic hydrocarbons in the genome of strain T452 ( Figure 4 ), such as benzene and phenol, which enter the TCA cycle through the catechol degradation pathway and are then degraded ( Figure 4 A); Degradation pathways of 3-chlorocatechol, 3-fluorocatechol, etc. ( Figure 4 B, 4C); and the degradation pathways of toluene, methylphenol and 3-methylcatechol ( Figure 4 D).

[0035] SEQ ID NO.1

[0036]

[0037]

[0038]

Claims

1. A lipophilic bacterium ( Alicycliphilus sp.) T452, whose deposit number is: GDMCC NO: 63025.

2. The lipophilic bacteria according to claim 1 ( Alicycliphilus sp.) T452 is used in the degradation of aromatic hydrocarbon compounds, wherein the aromatic hydrocarbon compounds are pyrene, benzo(a)anthracene, benzo(a)pyrene or tetrabromobisphenol A.

3. The use according to claim 2, characterized in that: Application of Lipocyclilla virescens T452 in the degradation of aromatic hydrocarbons under aerobic conditions.

4. The use according to claim 2, characterized in that: Application of Lipocyclilla virescens T452 in the degradation of aromatic hydrocarbons through nitrate respiration under anaerobic conditions.

5. The use according to claim 2, characterized in that: The application of the alicyclic bacteria T452 in purifying polluted water, sediment or soil by degrading aromatic hydrocarbon compounds.

6. The use according to claim 5, characterized in that: The method is to prepare a bacterial solution of the alicyclic bacteria T452 and add it to wastewater, sediment or soil to remove aromatic hydrocarbon pollutants.

7. The use according to claim 5, characterized in that: By combining the lipophilic bacteria T452 with functional carrier materials, it can be used in wastewater treatment, sediment remediation or soil treatment.

Images