dsRNA for inhibiting watermelon vine blight pathogen and its application
By synthesizing dsRNA targeting the PAT1 and PAT2 genes of watermelon vine blight pathogen and spraying it on the surface of watermelon plants, effective inhibition of watermelon vine blight pathogen was achieved, solving the problem of watermelon vine blight pathogen infection and improving the yield and quality of melon crops.
Patent Information
- Application Number
- CN202211050056.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-31
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-08-31
AI Technical Summary
Existing technologies make it difficult to effectively control the infection and spread of watermelon vine blight, which seriously affects the yield and quality of melon crops.
Double-stranded RNA (dsRNA) targeting the PAT1 and PAT2 genes of watermelon vine blight pathogen was designed and synthesized. By spraying it on the surface of watermelon plants, it induced gene silencing, inhibiting the infection of the pathogen and the occurrence of the disease.
It significantly inhibits the growth of vine blight pathogens and the expansion of lesions, reduces the formation of pycnidia, reduces the severity of the disease, and provides a green prevention and control method.
Smart Images

Figure CN115851716B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology and relates to dsRNA for inhibiting watermelon vine blight pathogen and application thereof. Background Art
[0002] Gummy stem blight is a typical worldwide soil-borne disease and one of the most important diseases in melon production. It primarily affects 23 species of cucurbits from at least 12 genera, including watermelon, muskmelon, cucumber, bitter melon, loofah, wax gourd, and wax gourd (Keinath 2011). Caused by Stagonosporopsis spp., gummy stem blight occurs throughout the plant's growth cycle and can infect and damage various parts of the cucurbit plant. It is most severe in the middle and late stages of growth, with stems and leaves being the primary sites of infection. As the plant grows, symptoms of gummy stem blight begin to appear during the bud formation stage and gradually worsen. Initially, small, water-soaked spots may appear on the leaves, gradually developing into whorled, yellow-brown spots or V-shaped lesions. In severe cases, black, dot-like pycnidia may be observed at the affected sites. In the early stages of the disease, brown, water-soaked lesions may appear on the stems and vines. As the disease progresses, the lesions may extend several to several dozen centimeters along the stems and vines. Later, scattered black particles may appear on the lesions. However, the disease does not harm the plant's vascular tissue or roots. Fruit may also become affected when vine blight is severe. Symptoms primarily occur near the ground, initially as small, water-soaked spots. Later, the fruit surface dries and cracks, and the lesions gradually enlarge, forming cracked, sunken spots. In severe cases, densely packed small black spots may be observed, causing fruit rot (Gusmini et al. 2017; Keinath et al. 1995). In recent years, due to changing climatic conditions, the incidence of the disease has been increasing year by year, and its spread is increasingly difficult. The disease develops rapidly and, once established, is difficult to control, significantly impacting the yield and quality of melons, severely harming the melon industry in my country and around the world.
[0003] RNA interference (RNAi) technology refers to the use of artificially synthesized in vitro or in vivo dsRNA to specifically degrade homologous mRNA into small 21-23nt fragments within cells, thereby silencing the corresponding gene. It is an important tool for studying gene function. RNAi is a protective mechanism in organisms against the invasion of foreign genetic material. It has four important characteristics: high efficiency, specificity, heritability, long-range effects, and ATP dependence (Hernandez-Soto and Chacon-Cerdas 2021). Using RNAi technology, researchers can design interference primers for a specific gene according to the research purpose, synthesize double-stranded RNA (dsRNA), and then introduce dsRNA into the body through reasonable and effective means to interfere with the expression of the target gene and explore the function of the gene (Abdellatef et al. 2021).
[0004] With advances in scientific research and technology, RNA technology has been directly or indirectly applied to pest and disease control, achieving promising results. Spray-induced gene silencing (SIGS) builds on this theory by synthesizing dsRNA encoding the pathogenicity genes of target pathogens and spraying them onto plant surfaces. The dsRNA is then absorbed by the fungus, inhibiting the target and thus suppressing the occurrence of the disease (Hoang et al. 2022; Rank and Koch 2021). This technology has been successfully applied to the control of various pests and diseases, overcoming the environmental and human hazards of pesticides and achieving environmentally friendly pest and disease control. Directly spraying in vitro-transcribed BcERG-dsRNA onto the surface of host plants inhibits the expression of genes in the ergosterol biosynthesis pathway, which are involved in biofilm formation and function, effectively suppressing the occurrence of gray mold (Duanis-Assaf et al. 2022). Similarly, in vitro transcribed BcCYP51-dsRNA, Bcchs1-dsRNA, and BcEF2-dsRNA have also been shown to be effective in controlling gray mold (Nerva et al. 2020). Fusarium graminearum, the main pathogenic fungus of wheat fusarium head blight, can be inhibited by spraying silencing the fungal toxin biosynthesis gene TRI5-dsRNA, the fungal cytochrome P450 lanosterol C-14-a-demethylase gene CYP3-dsRNA involved in ergosterol biosynthesis, and the key pathogenic genes AGO-dsRNA and DCL-dsRNA (Koch et al. 2016; Tretiakova et al. 2022; Werner et al. 2020).
[0005] Therefore, with the rapid development of modern molecular biology and genetics, as well as more in-depth research on the molecular mechanisms of interaction between plants and pathogens, spray-induced gene silencing has very bright application prospects and practical operability, and is expected to become a powerful and versatile alternative technology for controlling crop diseases.
[0006] The references involved are as follows:
[0007] Abdellatef E, Kamal NM, Tsujimoto H (2021). Tuning Beforehand: A Foresighton RNA Interference (RNAi) and In Vitro-Derived dsRNAs to Enhance CropResilience to Biotic and Abiotic Stresses. Int J Mol Sci, 22(14);
[0008] Duanis-Assaf D,Galsurker O,Davydov O,et al(2022).Double-stranded RNAtargeting fungal ergosterol biosynthesis pathway controls Botrytis cinereaand postharvest gray mold.Plant Biotechnol J,20(1):226-237;
[0009] Gusmini G,Rivera-Burgos LA,Wehner TC(2017).Inheritance of resistance to gummy stem blight in watermelon.Hortscience,52(11):1477-1482;
[0010] Hernandez-Soto A,Chacon-Cerdas R(2021).RNAi Crop ProtectionAdvances.Int J Mol Sci, 22(22);
[0011] Hoang BTL,Fletcher SJ,Brosnan CA,et al(2022).RNAi as a Foliar Spray:Efficiency and Challenges to Field Applications.Int J Mol Sci,23(12);
[0012] Keinath AP(2011).From native plants in central europe to cultivatedcrops worldwide:The emergence of Didymella bryoniae as a Cucurbitpathogen.Hortscience,46(4):532-535;
[0013] Keinath AP,Farnham MW,Zitter TA(1995).Morphological,pathological,andgenetic differentiation of Didymella bryoniae and Phoma Spp isolated fromCucurbits.Phytopathology,85(3):364-369;
[0014] Koch A,Biedenkopf D,Furch A,et al(2016).An RNAi-Based Control ofFusarium graminearum Infections Through Spraying of Long dsRNAs Involves aPlant Passage and Is Controlled by the Fungal Silencing Machinery.PLoSPathog,12(10):e1005901;
[0015] Nerva L, Sandrini M, Gambino G, et al (2020). Double-Stranded RNAs (dsRNAs) as a Sustainable Tool against Gray Mold (Botrytis cinerea) in Grapevine: Effectiveness of Different Application Methods in an Open-AirEnvironment. Biomolecules, 10 (2);
[0016] Rank AP,Koch A(2021).Lab-to-Field Transition of RNASprayApplications-How Far Are We? Front Plant Sci,12:755203;
[0017] Tretiakova P, Voegele RT, Soloviev A, et al(2022).Successful Silencing of the Mycotoxin Synthesis Gene TRI5 in Fusarium culmorum and Observation ofReduced Virulence in VIGS and SIGS Experiments.Genes(Basel),13(3);
[0018] Werner BT, Gaffar FY, Schuemann J, et al (2020). RNA-Spray-MediatedSilencing of Fusarium graminearum AGO and DCL Genes Improve Barley DiseaseResistance. Front Plant Sci, 11:476. Summary of the Invention
[0019] The technical problem to be solved by the present invention is to provide a dsRNA for inhibiting watermelon vine blight pathogen and application thereof.
[0020] In order to solve the above technical problems, the present invention provides a dsRNA for inhibiting watermelon vine blight pathogen, wherein the nucleotide sequence of the dsRNA1 is:
[0021] .
[0022] The present invention also provides the use of the dsRNA in preparing a preparation for preventing and treating watermelon vine blight pathogen.
[0023] As an improvement of the application of the present invention: dsRNA is sprayed on watermelons in vitro.
[0024] Description: Generally, it can be used from the seedling stage to the fruiting stage of watermelon. Spray the leaves and stems of watermelon at a concentration of 50ngμl -1The dosage depends on the size of the watermelon plant. Generally, it is advisable to spray until a layer of water film is evenly attached to the surface of the leaves and stems but no water droplets are formed.
[0025] The present invention also provides the above-mentioned dsRNA target: the dsRNA target sequence consists of the PAT1 gene target sequence of the fusobacterium wilt shown in SEQ ID NO.1 and the PAT2 gene target sequence of the fusobacterium wilt shown in SEQ ID NO.2.
[0026] The nucleotide sequence of the PAT1 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.3;
[0027] The nucleotide sequence of the PAT2 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.4.
[0028] The present invention also provides the use of the above dsRNA target in preparing dsRNA for inhibiting watermelon vine blight pathogen.
[0029] That is, provided is the use of the PAT1 gene and the PAT2 gene of the watermelon vine blight pathogen as targets in the preparation of a preparation for inhibiting the watermelon vine blight pathogen.
[0030] Watermelon vine blight pathogen has two palmitoyltransferase genes, protein S-acyl transferases 1 (PAT1) and protein S-acyl transferases 1 (PAT2). This study synthesizes double-stranded RNA in vitro and sprays to silence the expression of PATs, effectively inhibiting vine blight pathogen infection and providing a new method for green control of watermelon vine blight pathogen.
[0031] In summary, the present invention provides, for the first time, the PAT1 and PAT2 genes of P. fusca. Specific regions within these two genes were selected as target sequences to design and synthesize dsRNAs that simultaneously target both PAT1 and PAT2 genes of P. fusca. Plate-based antibacterial experiments revealed that dsRNA treatment resulted in abnormal, curled hyphae, with numerous, short lateral branches, and reduced pycnidia formation in the later stages. In vitro application of dsRNA to watermelon leaves revealed that treatment significantly inhibited the expansion of lesions and suppressed the expression of both PAT1 and PAT2 genes, thereby achieving disease control. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The specific embodiments of the present invention are further described in detail below with reference to the accompanying drawings.
[0033] Figure 1 This is a graph showing the detection results of the in vitro synthesized dsRNA of the present invention (3 lanes from the right).
[0034] Figure 2 This is a graph showing the results of the dsRNA of the present invention inhibiting the sclerotia of the fungus on a plate.
[0035] Figure 3 This is a graph showing the results of the inhibition of hyphae and pycnidium of the dsRNA of the present invention on the mycelium and pycnidium of the fungus fusobacterium.
[0036] Figure 4 This is a diagram showing the results of the dsRNA of the present invention in controlling vine blight pathogens.
[0037] Figure 5 To detect the expression of PAT1 and PAT2 of Psoralea corylifolia by qRT-PCR. DETAILED DESCRIPTION
[0038] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0039] Example 1
[0040] The nucleotide sequence of the PAT1 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.3;
[0041] The nucleotide sequence of the PAT2 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.4.
[0042] The target for controlling watermelon vine blight consists of the PAT1 gene target sequence of the vine blight pathogen shown in SEQ ID NO. 1 and the PAT2 gene target sequence shown in SEQ ID NO. 2. Based on the target gene sequences, primers containing a T7 promoter were designed using the primer design software Primer Premier 5 and sent to Shanghai Jierui Bioengineering Co., Ltd. for primer synthesis.
[0043] The target gene primer sequences are as follows:
[0044] PAT1-F
[0045] TAATACGACTCACTATAGGGAGAGTCAAGACGTCCGACGGC
[0046] PAT1-R
[0047] CGACACCATTTTCTACTCTTGCGTCTTCTCCAGGCTCTC
[0048] PAT2-F
[0049] GAGAGCCTGGAGAAGACGCAAGAGTAGAAAATGGTGTCG
[0050] PAT2-R
[0051] TAATACGACTCACTATAGGGAGAGTCGGGATTGCTCCCAGC
[0052] Template preparation was performed using the Novozymes RNAisolater Total RNA Extraction Reagent kit to extract total RNA from the fungus, which was then reverse transcribed into cDNA to obtain the template required for PCR amplification.
[0053] The gene cloning PCR amplification system is as follows:
[0054]
[0055] Mix the reagents according to the system in the table above in an eight-tube strip, place it in a PCR instrument, and set the PCR program as follows.
[0056] Reaction procedure:
[0057]
[0058] PCR product electrophoresis detection:
[0059] The extracted DNA was separated by agarose gel (1%) in a horizontal electrophoresis tank (120 V, 25 min), the gel was stained with Gel Red staining solution, and the size of the amplified fragment was observed by gel imaging.
[0060] Recovery and purification of PCR products
[0061] The product was detected by electrophoresis. If the experimental band matched the target gene band size, the agarose gel was cut out and the product was purified using the Axygene gel recovery kit.
[0062] Description: The target genes of the present invention are the target sequence of the PAT1 gene (SEQ ID NO.1) and the PAT2 gene (SEQ ID NO.2) of the fungus Psoralea corylifolia.
[0063] The purification method is as follows:
[0064] (1) Cut the agarose gel containing the target gene under ultraviolet light, chop it and weigh the gel. One weight is considered as one gel volume.
[0065] (2) Add 3 gel volumes of Buffer DE-A to the centrifuge tube, mix with the colloid, and heat in a 75°C water bath. Take it out every 2 minutes and mix it upside down until the gel is completely melted.
[0066] (3) Add 0.5 volume of Buffer DE-B to the tube and mix by inverting.
[0067] (4) Transfer the mixture to the 2 mL centrifuge tube provided in the kit, centrifuge at 12000 rpm for 1 min, and discard the filtrate.
[0068] (5) Add 700 μL of Buffer W1, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.
[0069] (6) Add 700 μL of Buffer W2, centrifuge at 12,000 rpm for 30 s, discard the filtrate, and repeat once.
[0070] (7) Place the preparation tube back into a 2 mL centrifuge tube and leave it empty for 1 minute.
[0071] (8) Add 30 μL of 65°C deionized water to the middle of the prepared membrane and centrifuge at 12,000 rpm for 3 minutes to elute the DNA.
[0072] Finally, 30 μL of PCR products were obtained.
[0073] Example 2
[0074] In vitro synthesis of dsRNA was performed according to MEGAscript RNAi kit instructions (Life Technologies, Carlsbad, CA) were used to introduce T7 promoter sequences into the 5' and 3' ends of the RNAi fragment by PCR. After purification, the DNA fragment containing T7 promoters at both ends was used for in vitro transcription. The synthesized dsRNA sequence was:
[0075] .
[0076] The dsRNA can simultaneously target the indicated gene sequence on PAT1 and the indicated gene sequence on PAT2.
[0077] The nucleotide sequence of the PAT1 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.3; the nucleotide sequence of the PAT2 gene of the watermelon vine blight pathogen is shown in SEQ ID NO.4.
[0078] The target sequence of the PAT1 gene of the fungus Psoralea corylifolia is shown in SEQ ID NO.1, and the target sequence of the PAT2 gene is shown in SEQ ID NO.2.
[0079] The in vitro transcription system is as follows:
[0080]
[0081] Note: The DNA template is 0.1 μl of each of the two PCR products obtained in Example 1;
[0082] According to MEGAscript Add 80 μl of Nuclease-free Water to the dsRNA obtained by in vitro transcription using the RNAi kit. Then, add 2.5 times the volume of Nuclease-free Water and 1 / 10 the volume of 3M sodium acetate to precipitate the dsRNA. The purified dsRNA can be analyzed by 1.0% agarose gel electrophoresis and then used for downstream experiments (e.g. Figure 1 ).
[0083] The nucleotide sequence of the dsRNA is as described above.
[0084] Example 3
[0085] Adjust the concentration of in vitro transcribed dsRNA to 50 ng μl before use -1 , use RNase-free water.
[0086] Plate inhibition effect experiment: Watermelon vine blight pathogen stored at -80℃ was inoculated onto PDA plates for activation and cultured in a 26℃ incubator for about 2 days. After the fungus covered the plate, a sterilized punch was used to evenly punch out circular mycelial blocks with a diameter of 8mm from the outer edge of the colony and inoculated into the center of the PDA plate. 20μl dsRNA (50ngμl -1 ) was dripped onto the mycelial block and cultured in a 26°C incubator. The effects of dsRNA on the growth of sclerotia and mycelia of the fungus were observed at different time points (72h, 96h, and 120h). The same volume of water was used instead of dsRNA as a control.
[0087] See the results Figure 2 and Figure 3 .
[0088] according to Figure 2 and Figure 3 , it can be found that: the results showed that compared with the control, the growth of the fungus was severely inhibited after dsRNA treatment, and the hyphae grew deformed and curled, with many and short branches on the side branches.
[0089] Example 4
[0090] Watermelon leaves that were in the vine-growing stage and in good growth condition were used as treatment samples.
[0091] 20 μl dsRNA (50 ng μl -1 ) was dripped onto the surface of a watermelon leaf sample. Twelve hours later, a 5 mm diameter mycelial block of vine blight pathogen was placed inverted with the hyphae facing downwards in the same location as the dsRNA. The leaves were observed for disease development three days later. An equal volume of water was used in place of the dsRNA as a control.
[0092] Watermelon leaves treated with dsRNA showed milder disease symptoms (smaller lesions and less obvious rot) compared to the water-treated group. Figure 4 The results are shown in Figure 2 (two replicates out of several replicates). At the same time, RNA was extracted from watermelon leaves and the expression of PAT1 and PAT2 of the fusarium wilt pathogen was detected by qRT-PCR. The results showed that compared with the control, the dsRNA treatment group could significantly inhibit the expression levels of PAT1 and PAT2 of the fusarium wilt pathogen ( Figure 5 ).
[0093] Primers used for detection:
[0094] PAT1-qRT-F2:TCCCGCTGCTGTTCGTCTAC
[0095] PAT1-qRT-R2:TGAGCAGGCAGTAGAGGACGA
[0096] PAT2-qRT-F2:GGAATGAGGTGTTGGGCGT
[0097] PAT2-qRT-R2:CCTCTTCTCCTCTTCCTCTTTCCT
[0098] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.
Claims
1. A dsRNA for inhibiting watermelon vine blight pathogen, characterized in that: The nucleotide sequence of the dsRNA is as follows: GUCAAGACGUCCGACGGCGGCGUGCGCUUCUGCAACAAGUGCCAGACACACAAGCCCGACCGCACCCACCACUGCUCCACCUGCAAGCGCUGCGUCCUCAAAAUGGACCACCACUGCCCCUGGCUGGCCACCUGCGUUGGCCUGCGCAACUACAAGGCCUUCCUGCUGUUCCUCAUCUACCUGACCCUGUUCUGCUGGGUCUGCUUCGCCACCUCGGCCACCUGGGUCUGGACUGAGGUCCUGACCGACAACCAGUACACCGAGUCCUUUAUGCCCAUCAACGACGUCCUGCUGGCCGUCCUGUCCGGCAUCAUCGGCAUCGUCAUCACCGGAUUUACUGCUUGGCACCUGUGGCUUACCGUCAGGGGCCAGACCACCAUCGAGAGCCUGGAGAAGACGCAAGAGUAGAAAAUGGUGUCGUAAAUGCGAUGCUGCGAAGCCGCCGCGGGCACAUCAUUGUAAAGAGUGUGGGAGAUGCAUCCCCAAAAUGGACCACCACUGUCCCUGGACAUCAAACUGCGUCUCACACACCACAUUCCCACACUUCCUCCGCUUCCUGCUCUCAGCCACCCUCGGCCUCCUCUACCUAGACACCCUCCUCUUCCCACGCAUCUCCCACCUAUGGUCAACACGCCACCUCGCCGCCUCCCUCGGCCCAUCACCCUUACAACUCGCCCACCUCCUCACCACCUUCCUCACCACAACAUUCACCCUCUUCCUCCUCUCCAUCCUGCUAGCGCGCAACCUCUGGUCCCUAGCCGUAAACACCACCACCAUCGAAAGCUGGGAGCAAUCCCGAC。 2. Use of the dsRNA according to claim 1 in the preparation of a preparation for preventing and treating Didymella bryoniae.
3. The use according to claim 2, characterized in that: Spray dsRNA in vitro on watermelon.
Citation Information
Patent Citations
Disease-resistant gene C1t11p3 of watermelon and encode protein and application thereof
CN109207483A
DsRNA for inhibiting rhizoctonia solani and application of dsRNA
CN112063623A