Tomato root-specific expression promoter pSlNRT2.5 and its application
By screening and cloning the tomato root-specific promoter pSlNRT2.5, constructing an expression vector and transforming it into plants, the problem that constitutive promoters cannot meet the expression needs of specific tissues was solved, tomato root-specific expression was achieved, and the plant's resistance to diseases, pests and diseases and stress resistance were improved.
Patent Information
- Application Number
- CN202211444682.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-18
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2042-11-18
AI Technical Summary
In existing technologies, constitutive promoters are continuously and stably expressed in plants, which cannot meet the gene expression needs of specific tissues and stages, and may cause damage to plants. There is a lack of efficient tomato root-specific promoters for transgenic research.
The tomato root-specific promoter pSlNRT2.5 was screened and cloned using transcriptome sequencing technology. An expression vector containing this promoter was constructed using PCR technology, and plant cells were transformed using Agrobacterium-mediated transformation to achieve root-specific expression of the exogenous gene.
This study achieved the specific expression of exogenous genes in tomato roots, improved the plant's resistance to diseases and pests and its stress resistance, and laid the theoretical foundation for new disease-resistant or stress-resistant crop varieties.
Smart Images

Figure CN115851728B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the tomato root-specific expression promoter pSlNRT2.5 and its applications. Background Technology
[0002] Plant gene expression is regulated at the transcriptional, post-transcriptional, and translational levels. Transcriptional expression is regulated by promoters, which largely determine the site, mode, timing, and level of gene expression. Promoters are classified into three types: constitutive, tissue-specific, and inducible promoters. In recent years, some strong constitutive promoters, such as the tobacco mosaic virus which exhibits high expression efficiency in dicotyledonous plants, have been observed to contribute to gene expression. 35S ( CaMV 35S Promoters and commonly used maize in monocotyledonous plants Ubiquitin and rice Actin Promoters are widely used in plant genetic engineering (Battraw and Hall 1990; McElroy et al. 1990; Christensen et al. 1992). However, constitutive promoter expression is usually unaffected by the external environment, and the promoter gene is continuously, stably, and efficiently expressed in all organs or tissues. This cannot meet the expression requirements of specific genes in specific tissues, and the continuous high-level expression of some target genes in all tissues may harm the host plant (Anami et al. 2013). With the rapid development of science and technology, expressing exogenous genes in organisms at specific times, in specific tissues, and at specific concentrations, so that they can function more economically and effectively, has become a hot topic in genetic engineering research.
[0003] Tissue-specific promoters drive the expression of exogenous genes only in specific tissues of the recipient plant, overcoming the limitations of constitutive promoters. Furthermore, gene expression at different developmental stages and in different tissues is also necessary for plant growth and development. Specific gene expression depends on the cis-acting elements present in the promoter. In addition to the TATA box, CAAT box, and GC box found in general promoters, tissue-specific promoters also contain elements essential for controlling tissue-specific expression. The type, number, and relative position of these elements determine their expression specificity. Tissue-specific promoters are found throughout various plant tissues, including promoters for vegetative organ-specific expression (green tissues, roots) and reproductive organ-specific expression (pistil, pollen, flower, seed, embryo and endosperm, fruit). In transgenic crop breeding research, utilizing efficient and tissue-specific expression promoters is the preferred method for cultivating efficient and safe transgenic crops.
[0004] Plant roots are the foundation of a plant, the sole pathway for absorbing water and inorganic salts, and vital organs for the synthesis and storage of nutrients. Furthermore, roots play a crucial role in protecting the above-ground parts of plants under conditions of drought, salinity, and heavy metal pollution. Therefore, roots play a pivotal role throughout the entire life cycle of a plant. As important nutrient organs, understanding root-specific expression genes, especially their promoters, is of significant value for crop improvement. Root-specific expression systems are primarily used to study the effects of transgenic plants on plant resistance to pests and diseases, enhancing plant resistance to soil-borne pathogens (Huang et al., 2006), salt tolerance, improving plant adaptability to harsh environments (Gao et al., 2011), and altering plant metabolic pathways to increase and improve plant yield and nutrient composition (Xu et al., 2010). It has been reported that... AtWRKY6 Root-specific expression promoter drives cytokinin oxidase 3 ( CKX3 ) is specifically expressed in the roots of tobacco and Arabidopsis thaliana, increasing root biomass by 60% and improving the plant's resistance to drought and heavy metal stress (Werner et al. 2010). Using chickpeas WRKY31 Root-specific expression gene promoters drive chickpeas CKX6 Genes specifically expressed in chickpeas lead to more developed root systems, enhanced drought resistance, and increased mineral content in seeds (Khandal et al. 2020). Zhang et al. (2016) utilized tobacco root-specific genes... NtREL1 Promoter drives soybean resveratrol synthase gene ( AhRS The promoters are specifically expressed in tobacco roots. This demonstrates that root-specific promoters can enhance plant resistance, increase yield, and improve quality, showing promising development potential. The above reports, utilizing transgenic technology to analyze promoter function in different plants, indicate that using model plants such as Arabidopsis thaliana and tobacco as vectors, heterologous transgenic analysis confirms that the function of promoters from other plants is widely recognized and accepted.
[0005] In recent years, multi-gene transformation systems that simultaneously construct several genes onto a single expression vector have gradually replaced traditional methods of repetitive transformation and hybridization for improving nutritional quality (Lin et al. 2003; Wakasa et al. 2006). In such multi-gene expression systems, each gene requires a specific promoter to drive expression, avoiding transgene silencing due to excessive homology of the introduced sequence (Naqvi et al. 2010). To date, most promoters isolated from tomatoes are specifically expressed in leaves and seeds; research on root-specific promoters is limited, and most are cloned from known root-specific genes. Therefore, isolating and identifying superior root-specific promoters is crucial. The inventors previously cloned… SlTIP , SlMT3Two root-specific promoters exist for tomato, but the number of usable root-specific promoters is still relatively small, especially those with high expression efficiency and small fragment size. Therefore, studying the impact of tomato root-specific promoters on the expression efficiency of exogenous genes has important theoretical significance and application value for the targeted expression of exogenous genes in tomatoes. Summary of the Invention
[0006] The purpose of this invention is to provide a tomato root-specific promoter pSlNRT2.5 and its application. This promoter can drive the specific expression of the target gene in plant roots, laying a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific crop tissues through genetic engineering and obtaining new disease-resistant or stress-resistant crop varieties through transgenic methods.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The tomato root-specific promoter pSlNRT2.5 has any of the following nucleotide sequences:
[0009] 1) The nucleotide sequence shown in SEQ ID NO.1 of the sequence listing;
[0010] 2) A nucleotide sequence that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing and has the function of regulating the specific expression of the target gene in plant roots;
[0011] 3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing under highly stringent conditions.
[0012] The stringent conditions are hybridization and washing of the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.
[0013] Primer pairs were used to amplify the tomato root-specific promoter pSlNRT2.5, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0014] Gene expression cassettes containing the tomato root-specific promoter pSlNRT2.5.
[0015] Expression vectors containing the tomato root-specific promoter pSlNRT2.5.
[0016] Recombinant bacteria containing the tomato root-specific promoter pSlNRT2.5.
[0017] The application of the tomato root-specific promoter pSlNRT2.5 in initiating the expression of target genes.
[0018] Furthermore, the initiation of target gene expression refers to initiating target gene expression in plants.
[0019] Furthermore, the expression is root-specific.
[0020] Using the aforementioned plant expression vector, the promoter sequence of this invention can be constructed upstream of any target gene and introduced into plant cells to obtain root-specific transgenic plants. The plant expression vector carrying the promoter sequence of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, direct DNA transformation, microinjection, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed is Arabidopsis thaliana.
[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0022] 1. This promoter is a tomato root-specific expression promoter screened by transcriptome sequencing technology. This method is fast, convenient, and highly accurate.
[0023] 2. This promoter can specifically drive the expression of downstream target genes in plant roots, but not in other tissues or organs, thus exhibiting tissue expression specificity.
[0024] 3. Plant roots are important nutrient organs, which breeding experts can utilize. SlNRT2.5 Promoter-specific expression of target genes in roots can enhance plant resistance to pests and diseases, salt and alkali tolerance, alter plant metabolic pathways, and improve plant yield and nutrient composition. SlNRT2.5 Promoters lay the theoretical foundation for improving the expression and accumulation of exogenous genes in specific tomato tissues through genetic engineering, and for obtaining new disease-resistant or stress-resistant crop varieties through transgenic methods. Attached Figure Description
[0025] Figure 1 For tomatoes SlNRT2.5 Electrophoretic pattern of promoter PCR amplification.
[0026] Figure 2 For tomatoes SlNRT2.5 A schematic diagram of the promoter-fused GUS gene expression vector p1300GN-pSlNRT2.5.
[0027] Figure 3 The image shows the double enzyme digestion identification pattern of the p1300GN-pSlNRT2.5 vector.
[0028] Figure 4 Electrophoretic pattern of PCR amplification of T1 generation Arabidopsis thaliana plants transfected with p1300GN-pSlNRT2.5 vector.
[0029] Figure 5 The results of GUS staining of roots and aerial parts of Arabidopsis thaliana plants transfected with p1300GN-pSlNRT2.5 vector T1 generation. Detailed Implementation
[0030] Tomato is a typical model plant, and 'Micro-Tom' is a dwarfing mutant of tomato that possesses the basic characteristics of tomato, as well as the advantages of shorter plant size and shorter growth cycle, making it more suitable for functional genomics research. This invention screens for root-specific promoters in tomato based on transcriptome sequencing analysis of different tissues, clones the tomato root-specific expression gene promoter using PCR technology, and replaces the promoter in pCAMBIA1300GN (p1300GN). 35S promoter and GUS Reporter gene fusion was used to obtain transgenic positive plants through Agrobacterium-mediated transgenic experiments. The promoter expression site and promoter activity were analyzed by GUS histochemical staining and GUS enzyme activity detection. Combined with promoter cis-acting element analysis, the tomato root-specific expression promoter pSlNRT2.5 with strong activity and stable function was screened out. This provides an effective way to find tomato root-specific expression promoters and lays a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific crop tissues through genetic engineering and obtaining new disease-resistant or stress-resistant crop varieties by applying transgenic methods.
[0031] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the present invention shall fall within the scope of the present invention.
[0032] Unless otherwise specified, all methods used in the following examples are conventional methods. Primers and sequencing were performed by Beijing Meiji Sino Biotechnology Co., Ltd. Rapid endonuclease was purchased from Thermo Fisher Scientific. DNA gel extraction kits, DNA markers, etc. were purchased from Dalian Baosheng Biotechnology Co., Ltd. The tomato 'Micro-Tom', wild-type Arabidopsis thaliana Col-0, Escherichia coli competent strain TOP10, Agrobacterium tumefaciens competent strain GV3101, and the modified plant genetic expression vector p1300GN used in the experiment were all preserved in the inventor's laboratory.
[0033] Example 1
[0034] tomato SlNRT2.5 Obtaining the full-length sequence of the promoter
[0035] By analyzing the gene expression transcriptome data of flower buds, flowers, roots, leaves, and fruits at different stages of the tomato variety Heinz, a member gene of the nitrate transporter 2 family specifically expressed in roots was screened. SlNRT2.5 (Solyc11g069735). Based on the predicted sequence of Solyc11g069735 from the tomato whole genome sequence, a 2000bp upstream fragment (nucleotide sequence shown in SEQ ID NO.1) was selected as the promoter sequence of this gene, and primers were designed. The upstream primer F used was acgacggccagtgcc. aagctt TAAGAAAATATGACAATAAATAGC (SEQ ID NO.2), downstream primer R is GGACTGACCACCCGG GGATCC TTTAGGCAAAAAAACAAAAAAGTGATTAA AATG (SEQ ID NO.3). In upstream primer F, the first 15 bases ACGACGGCCAGTGCC form the homologous recombination arm of the p1300GN vector, followed by AAGCTT. Hin The dIII restriction site, the remaining sequence is SlNRT2.5 Upstream amplification primer sequence; in downstream primer R, the first 15 bases GGACTGACCACCCGG are the homologous recombination arm of the p1300GN vector, followed by GGATCC. Bam HI restriction site, the remaining sequence is SlNRT2.5 Downstream amplification primer sequences.
[0036] Genomic DNA was extracted from the tomato variety 'Micro-Tom' using the CTAB method. The reaction mixture was as follows: 5 µL 10× buffer, 2 µL dNTPs, 2 µL DNA template, 1 µL DMSO, 1.5 µL each of upstream primer F and downstream primer R, 0.5 µL Kod Plus-Neo polymerase, and 36.5 µL ddH2O. The reaction conditions were: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 50–64℃ annealing for 30 s, 68℃ extension for 1 min, 30 cycles; and 68℃ incubation for 10 min. After PCR, 5 µL of the reaction mixture was subjected to agarose gel electrophoresis. The results showed that the PCR product consisted of only one 2000 bp DNA band. Figure 1 Lane 1 is marked with a DL5000 marker, with bands from top to bottom of 5000 bp, 3000 bp, 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lane 2 is... SlNRT2.5 Promoter, recover and purify this fragment.
[0037] Experiment Example 2
[0038] SlNRT2.5 Construction of plant expression vectors for promoters
[0039] Using Thermo Fisher Scientific Hin dⅢ and Bam p1300GN was double-digested with HI. The double digestion system was as follows: Hin d Ⅲ 2 µL, Bam HI 2 µL, p1300GN plasmid 20 µL, FastDigest green buffer 4 µL, ddH2O 12 µL. Digestion was performed at 37℃ for 1 h. The digestion products were purified by agarose gel electrophoresis according to the DNA gel extraction kit instructions. The purified PCR fragment was ligated with the digested and recovered empty vector using homologous recombination to construct a DNA-containing... GUS The plant expression vector p1300GN-pSlNRT2.5 ( Figure 2 The ligation system consisted of: 2.5 µL vector backbone, 2.5 µL purified PCR fragment, 5 µL 2×EasyGeno Assembly Mix, and incubation at 50 °C for 30 min. Then, 10 µL of the ligation product was added to a centrifuge tube containing 50 µL of competent TOP10 cells, gently mixed, incubated on ice for 30 min, heat-shocked at 42 °C for 90 s, incubated on ice for 2 min, and 800 µL of LB liquid medium was added. The mixture was incubated at 37 °C for 45 min, and 200 µL of the bacterial culture was spread onto LB medium plates containing 50 µg / L kanamycin. The plates were incubated upside down at 37 °C for 12–16 h, and the results were observed. The colony PCR reaction system consisted of: 1 µL primer F, 1 µL primer R, 10 µL 2×A8 Mixture, single colony, and 8 µL ddH2O. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 2 min, for 35 cycles; and incubation at 72℃ for 5 min. Plasmid DNA was extracted from positive clones and subjected to double enzyme digestion. Vectors with correct digestion were sent to Beijing Meijisinuo Biotechnology Co., Ltd. for sequencing. Recombinants with correct double enzyme digestion verification and sequencing results were named p1300GN-pSlNRT2.5 (…). Figure 3 ). Figure 3 Lane 1 is the DL5000 Marker, Lane 2 is the recombinant p1300GN-pSlNRT2.5, and Lane 3 is the recombinant p1300GN-pSlNRT2.5. Hin dⅢ and Bam Results of HI double digestion.
[0040] Experimental Example 3
[0041] Genetic transformation of Arabidopsis thaliana and detection of positive plants
[0042] The constructed binary expression vector p1300GN-pSlNRT2.5 and the p1300GN control vector (containing the 35S promoter) were introduced into Agrobacterium GV3101 using the heat shock method. The Arabidopsis plants to be transformed were topped, and the open flower buds were removed before transformation. Add 20 μL of Agrobacterium GV3101 bacterial suspension containing p1300GN-pSlNRT2.5 plasmid and p1300GN plasmid to 3 mL LB (50 μg / mL Kan) liquid medium and incubate at 28℃ and 180 r / min for 36-48 h. Transfer the bacterial suspension to a centrifuge tube and centrifuge at 12000 r / min for 1 min at room temperature to collect the bacterial cells, discarding the supernatant. Resuspend the precipitate in 1 mL 1 / 2 MS + 5% sucrose solution, centrifuge at 12000 r / min for 1 min, and discard the supernatant. Resuspend the precipitate again in 1 mL 1 / 2 MS + 5% sucrose solution, then add 0.2 μL of 0.02% Silwet-L77 and mix thoroughly. Use a 200 μL pipette to transfer the bacterial cells to unopened flower buds, label them, and cover with plastic film overnight to improve transformation rate. Seeds mature approximately one month later, are harvested, dried, and vernalized at 4℃ for 2 days, labeled as T0 generation seeds. T0 generation Arabidopsis seeds were disinfected with 10% NaClO for 10 min, washed 5 times with sterile water, and sown on the surface of MS medium containing 40 μg / mL hygromycin. They were vernalized at 4°C for 2 days and then cultured in a 23°C incubator.
[0043] Genomic DNA was extracted from wild-type Arabidopsis thaliana, p1300GN-pSlNRT2.5 plasmid, and p1300GN plasmid, and selected... GUS Amplification of the target gene was performed. Positive transgenic plants were screened using plant expression vector primers GUS F: ATGTTACGTCCTGTAGAAACC (SEQ ID NO.4) and GUS R: CGGCAATAACATACGGCGTGACATC (SEQ ID NO.5). The PCR amplification reaction system was: 1 μL template, 0.5 μL GUS F, 0.5 μL GUS R, 10 μL 2×A8 Mixture, and 8 μL ddH2O. Transgenic materials that tested positive by PCR were classified as T1 generation (e.g., ...). Figure 4 (As shown). Figure 4Lane 1 (labeled M) represents the DL2000 marker, with molecular weights of 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. Lane 2 (labeled 1) is the positive control using the plasmid as a template, lane 3 (labeled 2) is the negative control using wild-type plants as a template, and lanes 4-15 (labeled 3-14) represent different p1300-pSlNRT2.5 transgenic Arabidopsis plants. Seeds produced by T0 generation transgenic plants and plants grown from those seeds are T1 generation, and so on. T2 and T3 represent the second and third generations of transgenic plants, respectively.
[0044] Experiment Example 4
[0045] GUS histochemical staining of transgenic plants
[0046] Detection using histochemical staining method GUS Gene expression in plant tissue cells. T1 generation transgenic Arabidopsis seedlings obtained in Example 3 were subjected to GUS histochemical staining, with wild-type and transgenic p1300GN (containing...) as the staining agents. 35s The promoter-controlled vector Arabidopsis thaliana served as both negative and positive controls. The Arabidopsis thaliana plants were rinsed with sterile water, surface moisture was removed, and each plant was placed in a 2 mL centrifuge tube. An appropriate amount of GUS staining solution (GUS staining kit SL7160-2 purchased from Coolaber) was added to each tube, and the tubes were incubated at 37°C for at least 1 hour. After removing the staining solution, the plants were destained with 70% ethanol until the leaves of the negative control material turned white. SteREO Discovery V.12 was used for scanning and photography. The blue color against the white background represents the GUS expression site. Results showed that no blue color was observed in the roots and aerial parts of wild-type Arabidopsis thaliana, indicating the presence of GUS expression. 35S The roots and aerial parts of plants transformed with the promoter control vector were both blue, while GUS expression was consistently undetectable in the aerial parts of plants transformed with the recombinant vector p1300GN-pSlROOT1, with strong specific expression only in the roots (e.g., Figure 5 (As shown). Therefore, this starter driver... GUS The gene is highly expressed only in Arabidopsis roots and not in other tissues and organs, meaning it is a root-specific promoter with significant application value in plant genetic engineering. For example, vectors containing this promoter can be constructed to enhance plant resistance to stress and lodging, transforming recipient plants to artificially create resistant, high-quality, and high-yielding materials for agricultural production.
Claims
1. Application of the tomato root-specific promoter pSlNRT2.5 in promoting the expression of target genes in plant roots, wherein the nucleotide sequence of the tomato root-specific promoter pSlNRT2.5 is the nucleotide sequence shown in SEQ ID NO.1, and the plant is tomato or Arabidopsis thaliana.