L-3-aminoisobutyric acid producing strain, construction method and use thereof

Abstract

The present invention provides a method for constructing an L-3-aminoisobutyric acid production strain, the constructed L-3-aminoisobutyric acid production strain, and its use for fermentation production of L-3-aminoisobutyric acid. Plasmids overexpressing glmE, mutS and gad and plasmids overexpressing ppsA, icd, ppc and gltA are co-expressed in W3110 (ΔptsGΔsucA) chassis bacteria to construct an L-3-aminoisobutyric acid production strain. The Escherichia coli engineered bacteria constructed by the present invention can use glucose as a substrate to produce homochiral L-3-aminoisobutyric acid, and the shake flask yield can reach 580 mg / L.

Description

Technical Field

[0001] The invention belongs to the field of metabolic engineering, and specifically relates to an L-3-aminoisobutyric acid producing strain, a construction method thereof and use thereof for producing L-3-aminoisobutyric acid. Background Art

[0002] 3-aminoisobutyric acid, also known as β-aminoisobutyric acid (BAIBA), is a non-genetically encoded amino acid derived from the catabolism of thymine and valine. 3-aminoisobutyric acid exists in two isomeric forms, and both enantiomers of 3-aminoisobutyric acid can be detected in human urine and plasma. In plasma, the L enantiomer is the main type due to active renal reabsorption. In contrast, urine contains almost only D-3-aminoisobutyric acid, but the concentration is usually very low because D-3-aminoisobutyric acid is further broken down by 3-aminoisobutyric acid transaminase into methylmalonic semialdehyde and propionyl-CoA. 3-aminoisobutyric acid can reduce fat content by increasing fatty acid oxidation and reducing de novo fat synthesis in the liver of mice, which can promote the protective effect of exercise on metabolic diseases, improve insulin resistance and inflammation in skeletal muscle cells, and improve metabolic abnormalities caused by type 2 diabetes. In addition, 3-aminoisobutyric acid is also an important chemical raw material and drug intermediate, and has a broad market prospect for medicinal and chemical use.

[0003] The main production of 3-aminoisobutyric acid relies on chemical synthesis, which not only consumes a large amount of hydrochloric acid, but also uses expensive catalysts, and ultimately produces highly toxic substances, causing environmental pollution. In 2015, Cortes et al. produced D-3-aminoisobutyric acid by combining fermentation with diazotization reaction using Pseudomonas aeruginosa 10145; however, diazotization is not environmentally friendly, and the main physiological effect in the human body is L-3-aminoisobutyric acid. Therefore, it is very necessary to develop an environmentally friendly method for producing L-3-aminoisobutyric acid with high yield fermentation and related L-3-aminoisobutyric acid production strains. Summary of the invention

[0004] In one aspect, the present invention provides a method for constructing an L-3-aminoisobutyric acid producing strain, the method comprising the following steps:

[0005] (1) knocking out the glucose transporter gene ptsG and the ketoglutarate dehydrogenase gene sucA in the genome of Escherichia coli W3110 to obtain the gene knockout strain W3110;

[0006] (2) constructing a recombinant expression plasmid expressing the glutamate mutase genes glmE and mutS and the glutamate decarboxylase gene gad;

[0007] (3) constructing a recombinant expression plasmid expressing the phosphoenolpyruvate synthase gene ppsA, the isocitrate dehydrogenase gene icd, the phosphoenolpyruvate carboxykinase gene ppc, and the citrate synthase gene gltA;

[0008] (4) Transforming the recombinant expression plasmid obtained in step (2) and the recombinant expression plasmid obtained in step (3) into the gene knockout strain W3110 to obtain an L-3-aminoisobutyric acid producing strain.

[0009] In some embodiments, the sequence of the gene glmE in step (2) is shown as SEQ ID NO. 1. In some embodiments, glmE may be derived from Clostridium cochlearium.

[0010] In some embodiments, the sequence of the gene mutS in step (2) is shown as SEQ ID NO. 2. In some embodiments, mutS may be derived from Clostridium tetanomorphum.

[0011] In some embodiments, the sequence of the gene gad in step (2) is shown as SEQ ID NO. 3. In some embodiments, gad may be derived from Thermococcus kodakarensis.

[0012] In some embodiments, the sequence of the gene ppsA in step (3) is shown as SEQ ID NO.4.

[0013] In some embodiments, the sequence of gene icd in step (3) is as shown in SEQ ID NO.5.

[0014] In some embodiments, the sequence of the gene ppc in step (3) is as shown in SEQ ID NO.6.

[0015] In some embodiments, the sequence of the gene gltA in step (3) is shown as SEQ ID NO. 7. In some embodiments, ppsA, icd, ppc and gltA may all be derived from Escherichia coli W3110.

[0016] In some embodiments, the recombinant expression plasmid obtained in step (2) and the recombinant expression plasmid obtained in step (3) are transformed simultaneously or sequentially in step (4) by thermal transformation or electrotransformation.

[0017] In another aspect, the present invention provides an L-3-aminoisobutyric acid producing strain, which is constructed according to the above method.

[0018] In another aspect, the present invention provides a use of the L-3-aminoisobutyric acid producing strain as described above, wherein the strain is used for producing L-3-aminoisobutyric acid.

[0019] In some embodiments, the method of producing L-3-aminoisobutyric acid is fermentation.

[0020] In some embodiments, the culture medium used for fermentation consists of: (NH4)2SO4 10 g / L, KH2PO4 5 g / L, yeast extract 2 g / L, MgSO4·7H2O 1 g / L, glucose 15 g / L, pH 7.0.

[0021] The present invention uses genetic engineering to knock out relevant genes in the Escherichia coli genome and express recombinant plasmids to construct an engineered strain, which can produce L-3-aminoisobutyric acid through shake flask fermentation, with a yield of up to 580 mg / L. It not only avoids the pollution caused by chemical reactions, but also effectively increases the yield of chiral L-3-aminoisobutyric acid, and has the potential for scaled-up production. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The schematic diagram of the structure of the glmE, mutS and gad gene expression plasmid pSE380-kan-glmE-mutS-gad constructed in the present invention.

[0023] Figure 2 The present invention provides a schematic structural diagram of the ppsA, icd, ppc and gltA gene expression plasmid pTrc99a-ppsA-icd-ppc-gltA constructed in the present invention. DETAILED DESCRIPTION

[0024] Now will refer to preferred embodiments of the present invention in detail, further illustrate its embodiment.Although the present invention will be described in conjunction with preferred embodiments, it should be understood that they are not intended to limit the present invention to these embodiments.On the contrary, the present invention is intended to cover substitutions, modifications and equivalents, which may be included within the spirit and scope of the present invention as defined in the claims.

[0025] As used herein, the term "or" is intended to include "and" and "or." In other words, the term "or" may also be replaced with "and / or."

[0026] As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0027] As used herein, the term "comprises" or "includes" or variations thereof refer to the following instances where the term is used in its non-limiting sense, meaning that items following the term are included, but items not specifically mentioned are not excluded. It also includes the more restrictive verbs 'consisting essentially of' and 'consisting of'.

[0028] The following examples are descriptions of selected embodiments of the present invention and are not intended to limit the scope of the present invention. For process parameters not specifically described, conventional techniques may be used.

[0029] Materials and methods

[0030] In the present invention, the whole gene synthesis, primer synthesis and sequencing are all completed by Suzhou Jinweizhi Biotechnology Co., Ltd. Molecular biology experiments include plasmid construction, restriction enzyme digestion, ligation, preparation of competent cells, transformation, preparation of culture medium, etc., mainly referring to "Molecular Cloning Experiment Guide" (3rd edition), edited by J. Sambrook, DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by testing.

[0031] LB medium: 10 g / L tryptone, 10 g / L sodium chloride, 5.0 g / L yeast extract solid medium plus 20 g / L agar powder, pH = 7.0).

[0032] Fermentation medium: (NH4)2SO410g / L, KH2PO45g / L, yeast extract2g / L, MgSO4·7H2O1g / L, glucose15g / L, pH adjusted to 7.0.

[0033] Determination of L-3-aminoisobutyric acid content: (1) Sample treatment: Take the fermentation broth after culture, centrifuge it at 8000 rpm and 4°C for 10 min, then take the supernatant, and derivatize it with phenylisothiocyanate (PITC) at 37°C and alkaline conditions for 30 min; (2) Use a C18 (1250×4.6 mm, 5 μm) chromatographic column, the mobile phase is 0.1% trifluoroacetic acid-acetonitrile gradient elution, maintain the column temperature at 35°C, the detection wavelength is 248 nm, the detection time is 60 min, and the peak time is 24 min.

[0034] Determination of the chirality of L-3-aminoisobutyric acid: (1) Sample treatment: Take the fermentation broth after cultivation, centrifuge it at 8000 rpm, 4°C for 10 min, then take the supernatant, and derivatize it with fluorenylmethoxycarbonyl chloride (Fmoc-Cl) under alkaline conditions for 30 min; (2) Use ChIRALPAKIC (1250×4.6 mm, 5 μm) chromatographic column, use isopropanol (containing 0.1% formic acid)-n-hexane (10:90) as the mobile phase for gradient elution, maintain the column temperature at 35°C, the detection wavelength is 252 nm, the detection time is 30 min, and the peak time is 14 min.

[0035] Construction of gene knockout strain W3110 (ΔptsGΔsucA)

[0036] Wild-type Escherichia coli W3110 (ATCC27325) was used as the starting strain and made into competent cells. The transformation method and preparation of competent cells were all referred to the "Molecular Cloning Experiment Guide" (third edition), and the Pcas9 plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) was transformed into Escherichia coli W3110 to obtain the Escherichia coli W3110-Pcas9 strain. In order to knock out the ptsG gene in the genome of the Escherichia coli W3110-Pcas9 strain, Escherichia coli W3110 was used as a template, and primers ptsG-F1 / ptsG-R1 and ptsG-F2 / ptsG-R2 were used to amplify the fragments ptsG-up and ptsG-down respectively; then ptsG-F1 / ptsG-R2 was used as primers, and the fragments ptsG-up and ptsG-down were used as templates to amplify the ptsG-up-down fragment. The N20 region of the knockout site was designed through the CHOPCHOP website. Using pTarget plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) as a template, pTarget-F1 / pTarget-R1 primers were amplified to obtain pTarget-ptsG. The E. coli W3110-Pcas9 strain was made competent, and 200ngpTarget-ptsG and 600ngptsG-up-down fragments were transferred into the E. coli W3110-Pcas9 competent cells to screen out the E. coli W3110 knockout ptSG strain, namely E. coli W3110 (ΔptsG). The Pcas9 plasmid was transformed into E. coli W3110 (ΔptsG) to obtain the E. coli W3110 (ΔptsG)-Pcas9 strain. In order to knock out the sucA gene in the genome of Escherichia coli W3110 (ΔptsG)-Pcas9 strain, Escherichia coli W3110 was used as a template, and primers sucA-F1 / sucA-R1 and sucA-F2 / sucA-R2 were used to amplify the fragments sucA-up and sucA-down respectively; then sucA-F1 / sucA-R2 was used as primers, and fragments sucA-up and sucA-down were used as templates to amplify the sucA-up-down fragment. The N20 region of the knockout site was designed through the CHOPCHOP website. Using the pTarget plasmid as a template, pTarget-sucA was obtained by amplification with pTarget-F2 / pTarget-R2 primers. The Escherichia coli W3110 (ΔptsG)-Pcas9 strain was made competent, and 200 ng of pTarget-sucA and 600 ng of sucA-up-down fragments were transferred into the Escherichia coli W3110 (ΔptsG)-Pcas9 competent cells to screen out the Escherichia coli W3110 ptSG gene and sucA gene knockout strain, namely Escherichia coli W3110 (ΔptsG, ΔsucA).The primers used are as follows:

[0037] ptsG-F1: CGTTGAATGAGTTTTTTTAAAGCTCGTA

[0038] ptsG-R1: AATTGAGAGTGCTCCTGAGTATGG

[0039] ptsG-F2: CCCATACTCAGGAGCACTCTCAATTTCCGTAAGACGTTGGGGAG ptsG-R2: TGGTGTTAACTGGCAAAATCGC

[0040] pTarget-F1: CTAGTCCGCAGTTGTTGCCTATGGCATCGTTTTAGAGCTAGAA ATAGCAAGTTAAApTarget-R1: AACGATGCCATAGGCAACAACTGCGGACTAGTATTATACCTA GGACTGAGCTAGCTGTC

[0041] sucA-F1: ACCGTAGGCCTGATAAGAC

[0042] sucA-R1: CGTGATCCCTTAAGCATCTTTTTTA

[0043] sucA-F2: AAAGATGCTTAAGGGATCACGATAAAGGATACACAATGAGTAGC GTA sucA-R2: ACGCTTTCTCTTCAGATTTGG

[0044] pTarget-F2: ACTAGTGAGTTGCTCGATACGCACAATGGGTTTTAGAGCTAGA AATAGCAAGTTAAApTarget-R2: AACCCATTGTGCGTATCGAGCAACTCACTAGTATTATACCTAG GACTGAGCTAGCTGTCConstruction of pSE380-kan-glmE-mutS-gad expression plasmid

[0045] Using the pet29a plasmid as a template and kan-F / kan-R as primers, the kan fragment was amplified; using the pSE380 plasmid as a template and pSE380-F / pSE380-R as primers, the pSE380 fragment was amplified. pSE380 and kan were connected using GenBuilder2×MasterMix (Nanjing GenScript Biotechnology Co., Ltd.). The connection product was transformed into Escherichia coli DH5α competent cells (purchased from Novartis), and the recombinant expression plasmid pSE380-kan was identified on the premise of ensuring the correct reading frame. The sequence was correct after sequencing. The primers used are as follows:

[0046] kan-F: TAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGCCATATT CAACGGGAA kan-R: ATATATGAGTAAACTTGGTCTGACAGTTAGAAAAACTCATCGAGC ATCAAATG

[0047] pSE380-F: CTGTCAGACCAAGTTTACTCATATAT

[0048] pSE380-R:ACTCTTCCTTTTTCAATATTATTGAAGC

[0049] The plasmid pUC118-glmE-mutS-gad synthesized by General Biotech and the plasmid pSE380-kan constructed as above were double-digested with EcoRI / HidIII (purchased from Takara) to obtain the gene and vector fragments. After T4 ligation, they were transformed into Escherichia coli DH5α competent cells (purchased from Novazonics). Under the premise of ensuring the correct reading frame, the recombinant expression plasmid pSE380-kan-glmE-mutS-gad was identified. After sequencing, the sequence was correct, and its structure is as follows: Figure 1 As shown in Figure 2, overexpression of glmE, mutS and gad enabled the strain to produce L-3-aminoisobutyric acid.

[0050] In addition to pSE380-kan, the present invention also selects other plasmids, such as pQE30, pQE60 series, pGEX-4T-1, pGEX-5X-1 series, pBAD24, pBR322, pACYC184, etc., or performs appropriate resistance modification, expresses glutamate mutase genes glmE, mutS and glutamate decarboxylase gene gad, and constructs a recombinant expression plasmid, so that it has the ability to produce L-3-aminoisobutyric acid. In addition, in addition to being constructed on the same plasmid, any two genes can be constructed on one plasmid, and the third gene can be constructed on another plasmid; or the three genes can be constructed on different plasmids.

[0051] Construction of pTrc99a-ppsA-icd-ppc-gltA expression plasmid

[0052] Using the genome of E. coli W3110 as a template, ppsA-F / ppsA-R as primers were used to PCR amplify the ppsA gene. Using the genome of E. coli W3110 as a template, icd-F / icd-R as primers were used to PCR amplify the icd gene. Using the genome of E. coli W3110 as a template, ppc-F / ppc-R as primers were used to PCR amplify the ppc gene. Using the genome of E. coli W3110 as a template, gltA-F / gltA-R as primers were used to PCR amplify the gltA gene. Then, using the amplified ppsA and icd gene fragments as templates, ppsA-F / icd-R as primers were used to amplify the gene ppsA-icd. Using the amplified ppc and gltA gene fragments as templates, ppc-F / gltA-R as primers were used to amplify the gene ppc-gltA. The original plasmid pTrc99a was double-digested with EcoRI / HidIII (purchased from Takara) to obtain the vector fragment pTrc99a-PD. Finally, pTrc99a-PD, ppsA-icd and ppc-gltA were connected using GenBuilder2×Master Mix (Nanjing GenScript Biotechnology Co., Ltd.). The connection product was transformed into DH5α (purchased from Novazonics). Under the premise of ensuring the correct reading frame, the recombinant expression plasmid pTrc99a-ppsA-icd-ppc-gltA was identified. After sequencing and alignment, the sequence was correct, and its structure is as follows Figure 2 As shown. The plasmid overexpressed ppsA, icdA, ppc and gltA genes to enable it to produce L-glutamic acid. The primers used are as follows:

[0053] ppsA-F: ACAGGAAACAGACCATGGAATTCATGTCCAACAATGGCTCGTC ppsA-R: TTTCCATTATATCTCCTTCTTAAAGTTTTATTTCTTCAGTTCAGCC AGGCT icd-F: AAGAAATAAAACTTTAAGAAGGAGATATAATGGAAAGTAAAGTAG TTGTTCCGG icd-R: CGGAATATTGTTCGTTCATTATATCTCCTTCTTAAAGTTTTACATGT TTTCGATGATCGCGTC ppc-F: CGATCATCGAAAACATGTAAAACTTTAAGAAGGAGATATAATGAACGAACAATATTCCGCATT ppc-R: GCTTTGTATTCAGCCATTATATCTCCTTCTTAAAGTTTTAGCCGGTATTACGCATACC gltA-F: GTAATACCGGCTAAAACTTTAAGAAGGAGATATAATGGCTGATA CAAAAGCAAAACTgltA-R:TCCGCCAAAACAGCCAAGCTTTTAACGCTTGATATCGCTTTTAAA GTC

[0054] In addition to pTrc99a, the present invention also selects other suitable plasmids, such as pQE30, pQE60 series, pGEX-4T-1, pGEX-5X-1 series, pBAD24, pBR322, pACYC184, etc., to express phosphoenolpyruvate synthase gene ppsA, isocitrate dehydrogenase gene icd, phosphoenolpyruvate carboxykinase gene ppc and citrate synthase gene gltA, to construct a recombinant expression plasmid, so that it has the ability to produce L-glutamic acid. In addition, in addition to being constructed on the same plasmid, the above genes can also be constructed on one plasmid, and the fourth gene can be constructed on another plasmid; or any two genes can be constructed on one plasmid, and the other two genes can be constructed on another plasmid; or any two genes can be constructed on one plasmid, and the other two genes can be constructed on different plasmids; or the four genes can be constructed on different plasmids.

[0055] Construction of L-3-aminoisobutyric acid engineering strain

[0056] The Escherichia coli W3110 ptSG gene and sucA gene knockout strain was made into a competent state, and the constructed recombinant expression plasmids pSE380-kan-glmE-mutS-gad and pTrc99a-ppsA-icd-ppc-gltA were transformed together into the competent state of the Escherichia coli W3110 ptSG gene and sucA gene knockout strain. After resistance plate screening and colony PCR identification, the L-3-aminoisobutyric acid engineering strain was obtained.

[0057] Production of L-3-aminoisobutyric acid by bacterial fermentation

[0058] The engineered strain constructed as above was cultured in 5 mL LB liquid medium at 37°C and 180 rpm in a shaker for 16 h, then inoculated with 2% and transferred to a 250 mL shake flask containing 30 mL fermentation medium. When the bacterial OD600 was 0.6-0.8, IPTG with a final concentration of 0.2 mM was used for induction, and the culture was transferred to a shaker at 25°C and 180 rpm for 24-30 h. The content of L-3-aminoisobutyric acid was determined.

[0059] The results showed that by co-expressing a plasmid overexpressing glmE, mutS and gad and a plasmid overexpressing ppsA, icd, ppc and gltA in the W3110 (ΔptsGΔsucA) chassis bacteria, the engineered strain modified by the present invention can achieve an L-3-aminoisobutyric acid production of up to 580 mg / L without producing the D configuration.

[0060] The above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any technician familiar with the present invention may make various changes, modifications, substitutions and variations to these embodiments without departing from the principles and purpose of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A method for constructing an L-3-aminoisobutyric acid producing strain, characterized in that: The method comprises the following steps: (1) Knockout the glucose transporter gene ptsG and the ketoglutarate dehydrogenase gene sucA in the genome of Escherichia coli W3110 to obtain the gene knockout strain W3110; (2) constructing a recombinant expression plasmid expressing glutamate mutase genes glmE and mutS and glutamate decarboxylase gene gad, wherein the sequence of the gene glmE is shown in SEQ ID NO. 1, the sequence of the gene mutS is shown in SEQ ID NO. 2, and the sequence of the gene gad is shown in SEQ ID NO. 3; (3) constructing a recombinant expression plasmid expressing the phosphoenolpyruvate synthase gene ppsA, the isocitrate dehydrogenase gene icd, the phosphoenolpyruvate carboxykinase gene ppc and the citrate synthase gene gltA, wherein the sequence of the gene ppsA is shown in SEQ ID NO. 4, the sequence of the gene icd is shown in SEQ ID NO. 5, the sequence of the gene ppc is shown in SEQ ID NO. 6, and the sequence of the gene gltA is shown in SEQ ID NO. 7; (4) Transforming the recombinant expression plasmid obtained in step (2) and the recombinant expression plasmid obtained in step (3) into the gene knockout strain W3110 to obtain the L-3-aminoisobutyric acid producing strain.

2. The method according to claim 1, characterized in that The recombinant expression plasmid obtained in step (2) and the recombinant expression plasmid obtained in step (3) are transformed simultaneously or successively in step (4) by means of thermal transformation or electrotransformation.

3. An L-3-aminoisobutyric acid producing strain, characterized in that The strain was constructed according to the method of claim 1.

4. Use of the L-3-aminoisobutyric acid producing strain as claimed in claim 3, characterized in that: The strain produces L-3-aminoisobutyric acid by fermentation.

Images