A method for preparing tocotrienols

Abstract

The invention discloses a method for preparing tocotrienol, and relates to the field of biotechnology. The invention applies cyclodextrin to the synthesis process of tocotrienol, and realizes the efficient synthesis and secretion of tocotrienol. The method of adding cyclodextrin of the invention has a simple process, convenient operation, increases the yield of tocotrienol, greatly improves the synthesis and secretion of tocotrienol by genetically engineered bacteria producing tocotrienol, and has good application prospects.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for preparing tocotrienols. Background Art

[0002] Tocotrienols have attracted wide attention due to their antioxidant effects, neuroprotection, cholesterol-lowering, osteoporosis-resistant and anti-cancer pharmacological properties. Due to the overly complex chemical synthesis route, the supply of tocotrienols on the market currently relies on plant extraction, which has the problems of occupying land resources and destroying the ecology. Constructing an engineered microbial cell factory to carry out tocotrienol biosynthesis is a highly potential alternative production approach. In 2008, δ-tocotrienol was synthesized in Escherichia coli for the first time, with a yield of 15 μg / g dry cell mass (DCW) (Christoph, Albermann, Shashank, et al. Biosynthesis of the Vitamin E Compound δ-Tocotrienol in Recombinant Escherichia coli Cells. Chembiochem, 2008.). In 2020, the biosynthesis of δ-tocotrienol was achieved in Saccharomyces cerevisiae, with a yield of 4.1 mg / L (Sun, Yang J, Lin X, et al. De Novo High-Titer Production Of Delta-Tocotrienol in Recombinant Saccharomyces cerevisiae. Journal of Agricultural & Food Chemistry, 2020, 68(29): 7710-7717.). In the same year, strain YS-M5 was constructed by metabolic modification of Saccharomyces cerevisiae, and the tocotrienol shake flask yield reached 7.6 mg / g DCW (Shen B, Zhou P, Jiao X, et al. Fermentation production of Vitamin E tocotrienols in Saccharomyces cerevisiae under cold-shock-triggered temperature control. Nature Communications, 2020, 11(1): 5155). In 2022, through metabolic modification of the Saccharomyces cerevisiae engineered strain YS-M5, the shake flask production of tocotrienols reached 82.68 mg / L (Jiao X, Shen B, Li M, et al. Secretory production of tocotrienols in Saccharomyces cerevisiae. ACS Synthetic Biology, 2022, 11(2): 788-799.).However, the tocotrienol production in these works is relatively low and cannot meet the needs of industrial production.

[0003] The isoprenoid side chain of tocotrienol is an unsaturated double bond with strong antioxidant properties. It is speculated that accumulation in cells may be harmful to cell viability. If the secretion of tocotrienol into the culture medium can be promoted by some extractants, inclusion agents or surfactants, it is expected to alleviate the cell stress caused by its membrane storage and reduce the damage to cell viability caused by the accumulation of tocotrienol in cells, while greatly simplifying downstream processing. The inclusion agent forms an inclusion complex with hydrophobic molecules such as isoprenoids and releases it into the culture medium, which may enhance cell membrane permeability and improve the stability of isoprenoid molecules in the culture medium, thereby increasing the yield of hydrophobic compounds and greatly improving the synthesis and secretion of compounds.

[0004] Cyclodextrin (CD) is a general term for a series of cyclic oligosaccharides produced by amylose under the action of cyclodextrin glucosyltransferase produced by Bacillus, usually containing 6 to 12 D-pyranose units. Studies have found that cyclodextrin has a catalytic effect in some reactions. In particular, F. Cramer first explained that cyclodextrin can stabilize pigments, and then found that it can form inclusion complexes, so its application in food, medicine, cosmetics, flavors, etc. has been continuously expanded, and research work in related fields has also become active.

[0005] So far, the production of tocotrienols in Saccharomyces cerevisiae is relatively low. Therefore, how to promote the synthesis and secretion of tocotrienols is a problem that needs to be solved by those skilled in the art. Summary of the invention

[0006] The object of the present invention is to provide a method for promoting the synthesis and secretion of tocotrienols by adding cyclodextrin.

[0007] To achieve the above object, the present invention provides the use of cyclodextrin in the preparation of tocotrienol.

[0008] The type of the cyclodextrin is β-cyclodextrin, modified β-cyclodextrin, α-cyclodextrin, modified α-cyclodextrin, γ-cyclodextrin or modified γ-cyclodextrin,

[0009] Preferably, the cyclodextrin is 2,6-dimethyl-β-cyclodextrin or 2-hydroxypropyl-β-cyclodextrin.

[0010] The invention provides a method for preparing tocotrienol. When fermenting and culturing an engineering strain for producing tocotrienol, cyclodextrin is added, and after fermentation and culturing, tocotrienol is extracted and obtained.

[0011] The type of the cyclodextrin is β-cyclodextrin, modified β-cyclodextrin, α-cyclodextrin, modified α-cyclodextrin, γ-cyclodextrin or modified γ-cyclodextrin,

[0012] Preferably, the cyclodextrin is 2,6-dimethyl-β-cyclodextrin or 2-hydroxypropyl-β-cyclodextrin.

[0013] In a method for preparing tocotrienols, the amount of cyclodextrin added is 2.5-60 mM, preferably 20-60 mM, more preferably 30-50 mM, and most preferably 30 mM.

[0014] In a method for preparing tocotrienols, the cyclodextrin is added at a time of 0-72 h after inoculation, preferably 0-36 h, and most preferably 24 h.

[0015] The engineered strain is an engineered strain of Saccharomyces cerevisiae capable of producing tocotrienols. The engineered strain is an engineered strain of Saccharomyces cerevisiae capable of producing tocotrienols into which a gene of a biosynthetic pathway of tocotrienols is introduced.

[0016] Specifically, the engineered strain is also introduced with a gene encoding at least one of the following proteins:

[0017] (1) Pleiotropic drug resistance transcription factors Pdrlp and Pdr3p,

[0018] (2) Multi-directional drug resistance family transporters Pdr5p, Pdr8p, Pdr10p, Pdr11p, Pdr12p, Aus1p, Yol075cp, Yor1p and Ste6p.

[0019] The GenBank number of the gene encoding the pleiotropic drug resistance transcription factor Pdr1p is NM_001180878.1, the GenBank number of the gene encoding the pleiotropic drug resistance transcription factor Pdr3p is NM_001178245.1, the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Pdr5p is NM_001183572.3, the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Pdr8p is NM_001182153.1, the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Pdr10p is NM_001183748.1, and the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Pdr11p is NM_001183572.3. nk is NM_001179363.1, the GenBank number of the gene encoding the multi-drug resistance family transporter Pdr12p is NM_001183872.1, the GenBank number of the gene encoding the multi-drug resistance family transporter Aus1p is NM_001183329.2, the GenBank number of the gene encoding the multi-drug resistance family transporter Yol075cp is NM_001183430.1, the GenBank number of the gene encoding the multi-drug resistance family transporter Ste6p is NM_001179774.1, and the GenBank number of the gene encoding the multi-drug resistance family transporter Yor1p is NM_001181410.3.

[0020] The present invention applies cyclodextrin to the synthesis process of tocotrienol, and realizes the efficient synthesis and secretion of tocotrienol. At the same time, the multidirectional drug resistance transcription factor Pdr3p or the multidirectional drug resistance family transport protein Pdr5p or the multidirectional drug resistance family transport protein Pdr10p or the multidirectional drug resistance family transport protein Pdr11p or the multidirectional drug resistance family transport protein Pdr12p or the multidirectional drug resistance family transport protein Aus1p or the multidirectional drug resistance family transport protein Yol075cp or the multidirectional drug resistance family transport protein Ste6p, especially the multidirectional drug resistance transcription factor encoding gene Pdr1p or the transport protein encoding gene Pdr8p or the transport protein encoding gene Yorlp is introduced into the cell of the engineering strain producing tocotrienol, so that the corresponding transcription regulatory factor or transport protein is expressed in the engineering strain producing tocotrienol, participates in the synthesis and extracellular secretion of tocotrienol, and constructs a genetic engineering bacterium capable of efficiently synthesizing and secreting tocotrienol.

[0021] The present invention is beneficial in that:

[0022] 1. The present invention applies cyclodextrin to the synthesis process of tocotrienol, thereby achieving efficient synthesis and secretion of tocotrienol.

[0023] 2. The method of adding cyclodextrin of the present invention has a simple process and is easy to operate, which increases the yield of tocotrienols and greatly improves the synthesis and secretion of tocotrienols by genetically engineered bacteria that produce tocotrienols, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Figure 2 is a graph showing the intracellular and extracellular tocotrienol production of the engineered strain when cultured with different cyclodextrins.

[0025] Figure 2 This is a graph showing the effects of the amount and time of 2-hydroxypropyl-β-cyclodextrin addition on the production of tocotrienols inside and outside the engineered strain.

[0026] Figure 3 This is the map of the yeast integrative plasmid PUMRI-21-DPP1-pGAL1-PDR1.

[0027] Figure 4 The results show the effect of overexpression of PDR transcription factor and transporter on the secretion and production of tocotrienols. DETAILED DESCRIPTION

[0028] Example 1

[0029] Extraction and detection of tocotrienols in fermentation supernatant and cells.

[0030] 1. Extraction of tocotrienols from culture supernatant

[0031] (1) Take 2 mL of yeast fermentation broth (in a 2 mL centrifuge tube), centrifuge at 12000 rpm for 3 min, and take 1 mL of the supernatant into a new 2 mL centrifuge tube;

[0032] (2) Add 500 μL of ethyl acetate and vortex for 5 min;

[0033] (3) After thorough mixing, place in ultrasound for 10 min (add ice to the ultrasound machine to keep it low temperature);

[0034] (4) Centrifuge at 12000 rpm for 10 min, take 300 μL of the upper organic phase, and place it in a rotary evaporator until there is no organic phase;

[0035] (5) Add 300 μL of acetone to (4) and re-dissolve.

[0036] 2.2. The specific method for extracting tocotrienols from the organic phase of the fermentation broth is as follows:

[0037] The fermentation broth was centrifuged at 4000 rpm for 5 min, and the organic phase was collected. The organic phase was diluted 10-30 times with acetone, filtered with a 0.22 μm organic filter head, and then subjected to HPLC detection.

[0038] 3.HPLC detection conditions are as follows:

[0039] Tocotrienols and their content in Saccharomyces cerevisiae were detected by HPLC. The liquid phase analysis instrument was Shimadzu LC-20AT, and the chromatographic column was C18-H column (4.6×250mm, 5μm, Agilent, ZORBAX, SB-C18, America). Gradient elution was adopted, and the mobile phase was pure water (A) and acetonitrile (B). The gradient elution program was 0-10min, from 30% A / 70% B to 10% A / 90% B; 10-40min, from 10% A / 90% B to 100% A / 0% B; 40-80min, 0% A / 100% B; 80-81min, from 0% A / 100% B to 30% A / 70% B. The flow rate was 0.8mL / min, the column temperature was 40℃, and the measurement wavelength was 292nm.

[0040] Example 2

[0041] Chassis construction of Saccharomyces cerevisiae YBVT15.

[0042] The chassis Saccharomyces cerevisiae YBVT15 was preserved in the laboratory and constructed as follows: the coding gene sequence of HMG-CoA reductase (HMG1, GenBank No.: NC_001145.3) and the coding gene sequence of geranylgeranyl pyrophosphate synthase mutant (CrtE03M) from Phaffia rhodozyma (sequence as SEQ ID NO.27) was integrated into the genome of Saccharomyces cerevisiae BY4741 to obtain strain YBVT02, and the coding gene sequences of p-hydroxyphenylpyruvate dioxygenase (HPPD, GenBank No.: NP_172144) from Arabidopsis thaliana, homogentisate phytyltransferase (SyHPT, GenBank No.: BAA17774) from Synechocystis sp. PCC6803, and tocopherol cyclase (TC, GenBank No.: NP_567960) from Arabidopsis thaliana were integrated into the genome of Saccharomyces cerevisiae YBVT02 to obtain strain YBVT05; in strain YBVT05, a mutant of 3-deoxy-D-arabinoheptulose-7-phosphate synthase (Aro4) that is not inhibited by tyrosine feedback was introduced. K229L ) encoding gene (sequence shown in SEQ ID NO.28), chorismate mutase mutant (Aro7 G141S) (sequence as shown in SEQ ID NO.29), transketolase (TKL1) (sequence as shown in SEQ ID NO.30), and the gene sequence encoding the tyrosine-inhibited prephenate dehydrogenase (TyrC) from Zymomonas mobilis (sequence as shown in SEQ ID NO. NO.31), and at the same time, the coding genes of 3-deoxy-D-arabino-heptulose-7-phosphate synthase (Aro3, GenBank No.: NP_010320.3) and phenylpyruvate decarboxylase (Aro10, GenBank No.: NP_010668.3) were knocked out to obtain strain YBVT10; the coding genes of rate-limiting enzymes SyHPT (GenBank No.: BAA17774) and TC (GenBank No.: NP_567960) were overexpressed in strain YBVT10 to obtain strain YBVT11; the coding gene of a mutant of geranylgeranyl pyrophosphate synthase (CrtE03M) from Phaffia rhodozyma was overexpressed in strain YBVT11 (the sequence is shown in SEQ ID NO.27) and the mitochondrial NADH kinase encoding gene (POS5, GenBank No.: NC_001148.4) were overexpressed in strain YBVT13; in strain YBVT13, the encoding gene of the mutant of geranylgeranyl pyrophosphate synthase (CrtE03M) from Phaffia rhodozyma was overexpressed at the ROX1 (GenBank No.: NP_015390.1) site (the sequence is shown in SEQ ID NO.27) and the DOS2 (GenBank No.: NP_010353.3) site was knocked out to obtain strain YBVT15.

[0043] Example 3

[0044] Optimization of culture conditions for tocotrienol-producing yeast strains.

[0045] The strain YBVT15 was inoculated into YPD medium or SD medium and fermented at 30°C for 96 hours. After that, 5 mM 2,6-dimethyl-β-cyclodextrin or 2-hydroxypropyl-β-cyclodextrin was added to the medium. A control group was set up without adding cyclodextrin to the medium. After 96 hours of fermentation, the total production and secretion of intracellular and extracellular tocotrienols of the strain YBVT15 were recorded. The results showed that by analyzing the tocotrienol production and secretion ratio of the engineered strain YBVT15, Figure 1 As shown in the results, 2-hydroxypropyl-β-cyclodextrin was confirmed to be an ideal tocotrienol inclusion agent.

[0046] In order to further promote the synthesis and secretion of tocotrienols, the addition amount and time of 2-hydroxypropyl-β-cyclodextrin were optimized.

[0047] (1) Selection of the amount of 2-hydroxypropyl-β-cyclodextrin added

[0048] The strain YBVT15 was inoculated into YPD medium or SD medium and fermented at 30°C for 96 hours. 24 hours after inoculation, 0mM, 2.5mM, 5mM, 10mM, 20mM, 30mM, 40mM, 50mM, and 60mM 2-hydroxypropyl-β-cyclodextrin were added to the medium respectively. After 96 hours of fermentation, the fermentation broth was collected by centrifugation, and the supernatant of the fermentation broth was extracted with an organic solvent and then subjected to HPLC detection after rotary evaporation. The results are shown in FIG. Figure 2 As shown, when the addition amount of 2-hydroxypropyl-β-cyclodextrin was 30 mM, the total amount of tocotrienols reached 187.71 mg / L, and the extracellular part accounted for 8.33%. Compared with the control group with 0 mM addition, the total amount of tocotrienols increased by 157%.

[0049] (2) Selection of the time of adding 2-hydroxypropyl-β-cyclodextrin

[0050] The strain YBVT15 was inoculated into YPD medium or SD medium and fermented at 30°C for 96 h. According to the optimization results of the addition amount in (1), 30 mM 2-hydroxypropyl-β-cyclodextrin was added to the medium at 0 h, 24 h, 36 h, 48 h, and 72 h after inoculation. After 96 h of fermentation, the fermentation broth was centrifuged and collected. The supernatant of the fermentation broth was extracted with an organic solvent and then subjected to HPLC detection after rotary evaporation. The results are shown in Table 1. Figure 2 As shown, when 2-hydroxypropyl-β-cyclodextrin was added 24 h after inoculation, the total amount of tocotrienols reached 187.71 mg / L, with the extracellular portion accounting for 8.33%. Compared with the control group in which 2-hydroxypropyl-β-cyclodextrin was added directly after inoculation, the total amount of tocotrienols increased by 4.50%.

[0051] In summary, the optimized culture conditions of the yeast strain producing tocotrienol are as follows: the addition amount of 2-hydroxypropyl-β-cyclodextrin is 30 mM, and the addition time is 24 h after inoculation.

[0052] Example 4

[0053] Construction of tocotrienol synthesis and secretion synthetic strains.

[0054] 1. Using the genome of the laboratory-preserved strain Saccharomyces cerevisiae BY4741 as a template, use the following primers:

[0055] PDR1-F-BamHI:CGGGATCCATGCGAGGCTTGACACC,

[0056] PDR1-R-SalI:ACGCGTCGACAACTTTTATCTATACAAACGTAT,

[0057] PDR3-F-BamHI:

[0058] CGGGATCCATGAAAGTGAAGAAATCAACTAGATCAA,

[0059] PDR3-R-SalI:

[0060] ACGCGTCGACTTGCGTTTTCATAAGAAGGGATATGAAG,

[0061] PDR5-F-XhoI:CCCTCGAGATGCCCGAGGCCAAGCTT,

[0062] PDR5-R-NheI:

[0063] CTAGCTAGCCTATTATTTCTTGGAGAGTTTACCGTTCT,

[0064] PDR8-F-Sal1:ACGCGTCGACATGGATGGATCCCATTTTCCTATG,

[0065] PDR8-R-Sac11:

[0066] TCCCCGCGGTTATAAATCGAAATGATATTGTTTATAAAATTTCTTTTTGTC;

[0067] PDR10-F-SalI:ACGCGTCGACATGTTGCAAGCGCCCTCAA,

[0068] PDR10-R-NheI:

[0069] CTAGCTAGCAATTATTTCTTTAATTTTGCTTTTCTTTGGAAC,

[0070] PDR11-F-XhoI:

[0071] CCGCTCGAGATGTCTCTTTCCAAATATTTTAATCCAATTC,

[0072] PDR11-R-SacII:

[0073] TCCCCGCGGTTATACGCTTTGTTCGTTTGGATTATG,

[0074] PDR12-F-XhoI:

[0075] CCGCTCGAGATGTCTTCGACTGACGAACATATTG,

[0076] PDR12-R-SacII:

[0077] TCCCCGCGGTTATTTCTTCGTGATTTTATTTTCGTCAC,

[0078] SNQ2-F-BamHI:CGGGATCCATGAGCAATATCAAAAGCACGCA,

[0079] SNQ2-R-SalI:

[0080] ACGCGTCGACTTACTGCTTCTTTTTCCTTATGTTTTTAAT,

[0081] STE6-F-Xhol:

[0082] CCGCTCGAGATGAACTTTTTAAGTTTTAAGACTACAAAACAC,

[0083] STE6-R-Sac11:

[0084] TCCCCGCGGTTAACTGCTTTGGTTGGAAACAATTTG;

[0085] YOR1-F-BamHI:CGGGATCCATGTCTATAGAGACCCTTTATGACG,

[0086] YOR1-R-SalI:

[0087] ACGCGTCGACTTAACTTCTGTTCTCGAAATCATTTTCCA,

[0088] YOL075C-F-XhoI:CCGCTCGAGATGTCACAGCAGGAGAATGG,

[0089] YOL075C-R-SacII:

[0090] TCCCCGCGGTCACCATTTTATCCACTCCAATTTTG,

[0091] AUS1-F-XhoI:CCGCTCGAGATGTCAATTTCAAAGTACTTCACTC,

[0092] AUS1-R-SacII:TCCCCGCGGTTAGTTCTGTACAGGCTTCTTCC,

[0093] YOL075C-F-NotI:

[0094] AAGGAAAAAAGCGGCCGCATGTCACAGCAGGAGAATGG,

[0095] YOL075C-R-SpeI:

[0096] CTAGACTAGTTCACCATTTTATCCACTCCAATTTTG,

[0097] High-fidelity enzyme (Prime STARTM HS DNA polymerase) was used for PCR amplification. The reaction system (50 μL) was as follows:

[0098]

[0099] The PCR program is as follows:

[0100]

[0101]

[0102] To clone the genes encoding transcription factors regulating multi-drug resistance (Pdr1p (GenBank No.: NM_001180878.1), Pdr3p (GenBank No.: NM_001178245.1)) and the genes encoding multi-drug resistance family transporters (Pdr5p (GenBank No.: NM_001183572.3), Pdr8p (GenBank No.: NM_001182153.1), Pdr10p (GenBank No.: NM_001183748.1), Pdr11p (GenBank No.: NM_001178245.1)). No.: NM_001179363.1), Pdr12p (GenBank No.: NM_001183872.1), Auslp (GenBank No.: NM_001183329.2), Yol075cp (GenBank No.: NM_001183430.1), Ste6p (GenBank No.: NM_001179774.1), Yor1p (GenBank No.: NM_001181410.3), Snq2p (GenBank No.: NM_001180319.1);

[0103] 2. Use PCR technology and double enzyme digestion method to clone the target gene into the integrated PUMRI-21-DPP1 vector plasmid. The integrated plasmid PUMRI-21-DPP1 is to clone the coding gene of DPP1 into the SfI site of the plasmid PUMRI-21. For details, please refer to the patent, application number CN201510001391.3. Pdrlp, Pdr3p, Pdr5p, Pdr8p, Pdr10p, Pdr1lp, Pdr12p, Aus1p, Yol075cp, Yorlp, Ste6p, Snq2p are expressed under the GAL1 promoter to obtain the recombinant plasmid PUMRI-21-DPP1-PDR1 with the target gene (see the map). Figure 3 As shown, the full name is PUMRI-21-DPP1-pGAL1-PDR1), PUMRI-21-DPP1-PDR3, PUMRI-21-DPP1-PDR5, PUMRI-21-DPP1-PDR8, PUMRI-21-DPP1-PDR10, PUMRI-21-DPP1-PDR11, PUMRI-21-DPP1-PDR12, PUMRI-21-DPP1-YOL075C, PUMRI-21-DPP1-STE6, PUMRI-21-DPP1-AUS1, PUMRI-21-DPP1-YOR1, PUMRI-21-DPP1-SNQ2.

[0104] 3. The plasmids constructed above were integrated into the high-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method (High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method. Nature Protocols, 2007.) strain YBVT15, which produced a high amount of tocotrienols, and spread on an amino acid-deficient SD plate; PCR was used to verify the correctly integrated strains YBVT15: PDR1, YBVT15: PDR3, YBVT15: PDR5, YBVT15: PDR8, YBVT15: PDR10, YBVT15: PDR11, YBVT15: PDR12, YBVT15YOI075C, YBVT15: AUS1, YBVT15: STE6, YBVT15: YOR1, and YBVT15: SNQ2;

[0105] Among them, strain YBVT15: PDR1 indicates that the recombinant plasmid PUMRI-21-DPP1-PDR1 with the target gene is integrated into the high-producing tocotrienol strain YBVT15, that is, the multi-drug resistance transcription factor encoding gene Pdr1p is integrated; the others are the same.

[0106] 4. The correct transporter overexpression strain constructed in step 3 was cultured according to the culture conditions optimized in Example 3. HPLC analysis showed that strains YBVT15: PDR1 (integrated into strain YBVT15 the pleiotropic drug resistance transcription factor encoding gene Pdr1p), YBVT15: PDR8 (integrated into strain YBVT15 the pleiotropic drug resistance family transporter encoding gene Pdr8p) and YBVT15: YOR1 (integrated into strain YBVT15 the pleiotropic drug resistance family transporter encoding gene Yorlp) showed good tocotrienol synthesis and secretion efficiency ( Figure 4 ), the total amount of tocotrienols reached 224.61mg / L, 188.11mg / L and 208.03mg / L, and the secretion ratios were 11.44%, 12.19% and 10.42%, respectively.

Claims

1. Application of cyclodextrin in promoting the increase of tocotrienol production in the process of preparing tocotrienol by fermentation of Saccharomyces cerevisiae; The cyclodextrin is 2,6-dimethyl-β-cyclodextrin or 2-hydroxypropyl-β-cyclodextrin.

2. A method for preparing tocotrienols, characterized in that: When fermenting and culturing an engineered strain of Saccharomyces cerevisiae that produces tocotrienol, cyclodextrin is added, and after fermentation and culturing, tocotrienol is extracted; The cyclodextrin is 2,6-dimethyl-β-cyclodextrin or 2-hydroxypropyl-β-cyclodextrin.

3. The method for preparing tocotrienols according to claim 2, characterized in that: The added amount of the cyclodextrin is 2.5-60 mM.

4. The method for preparing tocotrienols according to claim 3, characterized in that: The added amount of the cyclodextrin is 20-60 mM.

5. The method for preparing tocotrienols according to claim 4, characterized in that: The added amount of the cyclodextrin is 30-50 mM.

6. The method for preparing tocotrienols according to claim 5, characterized in that: The added amount of the cyclodextrin is 30 mM.

7. The method for preparing tocotrienols according to claim 2, characterized in that: The cyclodextrin is added at 0-72h after inoculation.

8. The method for preparing tocotrienols according to claim 7, characterized in that: The cyclodextrin is added at 0-36h after inoculation.

9. The method for preparing tocotrienols according to claim 8, characterized in that: The cyclodextrin was added 24 hours after inoculation.

10. The method for preparing tocotrienols according to claim 2, characterized in that: The engineered strain is an engineered strain of Saccharomyces cerevisiae into which a gene of tocotrienol biosynthesis pathway is introduced and which can produce tocotrienol.

11. The method for preparing tocotrienols according to claim 10, characterized in that: The engineered strain is also introduced with a gene encoding at least one of the following proteins: (1) Pleiotropic drug resistance transcription factor Pdr1p, (2) Pluronic drug resistance family transporter Pdr8p, (3) Multi-directional drug resistance family transporter protein Yor1p.

12. The method for preparing tocotrienols according to claim 11, characterized in that: The GenBank number of the gene encoding the pleiotropic drug resistance transcription factor Pdr1p is NM_001180878.1, the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Pdr8p is NM_001182153.1, and the GenBank number of the gene encoding the pleiotropic drug resistance family transporter Yor1p is NM_001181410.3.

Images