Genetically modified cell lines producing recombinant glycoproteins with n-glycans having terminal mannose

Abstract

The present invention provides a genetically modified cell line producing a recombinant glycoprotein having N-glycans with terminal mannose and a method for producing the recombinant glycoprotein or a method for generating the cell, clone or cell line. The cell line comprises an insertion of less than 600 bp in the coding region of a chromosomal sequence encoding MGAT1.

Description

TECHNICAL FIELD

[0001] The present application relates generally to a genetically modified cell line producing a recombinant glycoprotein having N-glycans with terminal mannose and a method for producing the recombinant glycoprotein or a method for generating the cell, clone or cell line. BACKGROUND

[0002] One commercially useful glycoprotein is β-glucocerebrosidase, which catalyzes the hydrolysis of glucocerebroside to ceramide and glucose. Accumulation of glucosylceramide in peripheral macrophages due to the deficiency of β-glucocerebrosidase in vivo causes cellular enlargement, which can lead to Gaucher's disease, an autosomal recessive lysosomal storage disease that causes dysfunction and degeneration of the spleen, liver, and bone marrow, and exogenous administration of recombinantly expressed β-glucocerebrosidase is considered an attractive way to treat Gaucher's disease in the art.

[0003] The problem is that unmodified human β-glucocerebrosidase derived from placenta is hardly taken up by cells in need, such as dendritic cells and macrophages, via mannose receptor-mediated endocytosis due to the lack of exposed mannose residues. Accordingly, there is an increasing need to facilitate the mannose receptor-mediated uptake of glycoproteins, such as β-glucocerebrosidase, by cells in need by producing recombinantly expressed glycoproteins having N-glycans with terminal mannose, for example, by removing the residues that block the mannose in the N-glycans (exposing the mannose as the terminal residue of the N-glycans).

[0004] Therefore, there is a need for cell lines engineered to produce recombinant glycoproteins with N-glycans having terminal mannose. In addition, there is also a need for these engineered cell lines to stably produce proteins with terminal mannose residues while retaining high protein productivity, high quality, and high enzyme activity. SUMMARY

[0005] The inventors of the present application have surprisingly found a genetically modified cell line lacking the mannosyl (alpha-1, 3-)-recombinant glycoprotein beta-1, 2-N-acetylglucosaminyltransferase 1 (MGAT1) gene by insertion mutation, wherein the cell line comprises less than 600 bp of an insertion in the coding region of the chromosomal sequence encoding MGAT1 by RCA selection. The recombinant glycoprotein produced by the cell line according to the present application has high protein productivity, high protein quality, and high enzyme activity.

[0006] In various aspects of the application, one provides a cell line lacking mannosyl (a-l,3-)-glycoprotein beta-l,2-N-acetylglucosaminyltransferase 1 (MGAT1), wherein the cell line comprises an insertion of less than 600 bp in the coding region of the chromosomal sequence encoding MGAT1. In a specific embodiment, the cell line comprises an insertion of less than 400, 200, 100, 50, 30, 10, or 5 bp in the coding region of the chromosomal sequence encoding MGAT1. In a specific embodiment, the cell line comprises an insertion of 1 bp in the coding region of the chromosomal sequence encoding MGAT1. In a specific embodiment, the chromosomal sequence encoding MGAT1 is modified using a targeted endonuclease-mediated genome editing technology, for example, a clustered regularly interspaced short palindromic repeat (CRISPR), a zinc finger nuclease (zFN), or a transcription activator-like effector nuclease (TALEN). In a specific embodiment, the cell is an animal cell, preferably a mammalian cell, more preferably a Chinese hamster ovary (CHO) cell. In a specific embodiment, the cell line expresses at least one glycoprotein comprising one or more terminal mannose residues. In a specific embodiment, the glycoprotein is an enzyme, such as beta-glucocerebrosidase.

[0007] Another aspect of the application includes a method for producing a recombinant glycoprotein, the method comprising:

[0008] (1) culturing the genetically modified cell line, and

[0009] (2) recovering the glycoprotein.

[0010] Another aspect of the application includes a method for producing a recombinant glycoprotein having N-glycans with terminal mannose, the recombinant glycoprotein having one or more terminal mannose residues, the method comprising:

[0011] (1) introducing a gene encoding the recombinant glycoprotein into a cell line;

[0012] (2) mutating the mannosyl (a-l,3-)-glycoprotein beta-l,2-N-acetylglucosaminyltransferase 1 (MGAT1) gene in the cell line obtained in step (1); and

[0013] (3) expressing the recombinant glycoprotein;

[0014] The MGAT1 gene is mutated by CRISPR, wherein the sgRNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 4, or the sgRNA comprises or consists of a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the nucleic acid sequence of SEQ ID NO: 4.

[0015] In one embodiment, RCA is used to select a cell line. In one embodiment, the glycoprotein is an enzyme, such as β-glucocerebrosidase. In one embodiment, the method further comprises the step of selecting a mutant cell line in a batch refeeding assay. In one embodiment, the batch refeeding assay comprises the step of refreshing the production medium daily. In one embodiment, the recombinant glycoprotein comprises N-glycans comprising one or more terminal mannose residues and optionally 1 to 3 fucose residues that do not block the terminal mannose residues, preferably 1 to 9 terminal mannose residues, more preferably 3 to 6 terminal mannose residues, wherein the N-glycans are selected from the group consisting of Man3, Man4, Man4+1F, Man5, Man5+1F, and Man6. In one embodiment, the proportion of mannose-terminated N-glycans attached to the recombinant glycoprotein is greater than 80%, 85%, 86%, 87%, 88%, or 89%. In one embodiment, the enzyme activity is greater than 0.5 U / mL. In one embodiment, the cell is an animal cell, preferably a mammalian cell, more preferably a Chinese hamster ovary (CHO) cell.

[0016] Another aspect of the present invention includes a recombinant glycoprotein, such as β-glucocerebrosidase, produced by the cell lines or methods of the present invention. Another aspect of the present invention includes a method for treating a disease associated with β-glucocerebrosidase deficiency (such as Gaucher disease), comprising administering a recombinant glycoprotein, such as β-glucocerebrosidase, disclosed herein to a subject in need thereof. Yet another aspect of the present invention is a cell, clone, or cell line generated by the method.

[0017] Another aspect of the application is a pharmaceutical formulation comprising a pharmaceutically effective amount of a recombinant enzyme, a buffer, an osmotic regulator, and a surfactant. In a specific embodiment, the enzyme is β-glucocerebrosidase at a concentration of 50-150 U / ml. In a specific embodiment, the buffer is citrate buffer at a concentration of 2-10 g / mL. In a specific embodiment, the osmotic regulator is sucrose at a concentration of 40-120 g / L. In a specific embodiment, the surfactant is polysorbate 80 at a concentration of 0.1-1 g / L. In a specific embodiment, the formulation has a pH of 5-7.

[0018] The foregoing is a summary and thus contains, by necessity, simplifications and generalizations. Consequently, the summary is intended to be illustrative only and is not intended to be in any way limiting. Other aspects, features, and advantages of the methods, compositions and / or devices and / or other subject matter described herein will become apparent in the course of the teachings detailed below. The summary is provided to introduce a selection of concepts that are further described in the DETAILED DESCRIPTION section below. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to operate as an aid in determining the scope of the claimed subject matter. Additionally, all references, patents and published patent applications cited in this application are each hereby incorporated by reference in their entirety. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is a plasmid containing Cas9 and sgRNA5.

[0020] Figure 2 is a glycan profile of a monoclonal that has been mutated for the MGAT1 gene.

[0021] Figure 3 is a glycan profile of a control pool with wild type MGAT1. DETAILED DESCRIPTION

[0022] The application can take form in many different arrangements of components and in various different combinations, and its specific embodiments are discussed with the intent to detail as an example of the principles of the application. It is understood that this application is not limited to the embodiments described but is intended to encompass any and all alterations, omissions, additions, and equivalents that occur to one skilled in the art upon a reading and understanding of this disclosure. Further, to those skilled in the art, this application as described is susceptible to embodiments in which certain features, elements, components, and / or functions not explicitly described or shown in this disclosure are desirable and / or essential. Addition, combinations, subcombinations, and alternatives are within the scope of the disclosed application.

[0023] DEFINITIONS

[0024] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the same meaning as those generally understood by those of ordinary skill in the art. In addition, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. More specifically, when used in this specification and claims, the singular forms "a', "an" and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a protein" includes plural proteins; reference to "a cell" includes mixtures of cells and their analogs. In this application, "or" means "and / or" unless otherwise indicated. In addition, the use of the term "comprising" and other tenses such as "comprises" and "comprised" are not intended to be limiting. In addition, the ranges provided in the specification and claims include both endpoints and all points between those endpoints.

[0025] As used herein, "gene" refers to a DNA region encoding a gene product (including exons and introns), as well as all DNA regions that regulate the production of that gene product, regardless of whether such regulatory sequences are adjacent to the coding and / or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences (such as ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, boundary elements, replication origins, matrix binding sites, and locus control regions.

[0026] In the context of the present invention, MGAT1, also known as N-acetylglucosaminyltransferase I (GlcAc-T I or GnT I) or N-glycosyl-oligosaccharide-glycoprotein N-acetylglucosaminyltransferase I, catalyzes the transfer of N-acetylglucosamine (GlcNAc) to the mannooligosaccharide core (i.e., the Man5GlcNAc2(Man5) moiety) of growing N-glycans. Dysfunction of MGAT1 can affect the properties of N-glycans, resulting in glycoproteins, such as β-glucocerebrosidase, having N-glycans with terminal mannose residues. In the context of the present invention, MGAT1 and GnT I are used interchangeably.

[0027] As used herein, the term "monoclones" refers to a group of cells produced from a single ancestral cell by repeated cell replication. In the more specific context of the present invention, monoclones expressing a recombinant glycoprotein (e.g., β-glucocerebrosidase) can be generated by cloning a single cell derived from a pool of cells expressing a recombinant glycoprotein (e.g., β-glucocerebrosidase).

[0028] The term "mutation" or "mutating" or "mutated" as used herein refers to an insertion or deletion mutation. In the more specific context of the present application, an insertion mutation means the insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more base pairs in a gene encoding a protein of interest or a regulatory nucleic acid sequence (e.g., a promoter or enhancer) operably linked to a gene encoding a protein. In a specific embodiment, the mannosyl (alpha-1,3-) recombinant glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 (MGAT1) gene in a cell line is mutated by an insertion mutation. A deletion mutation means the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more base pairs in a gene encoding a protein of interest or a regulatory nucleic acid sequence (e.g., a promoter or enhancer) operably linked to a gene encoding a protein. Those skilled in the art will appreciate that a knock out includes the introduction of a deletion, substitution or insertion mutation into a gene encoding a protein of interest or a regulatory nucleic acid sequence (e.g., a promoter or enhancer) operably linked to a gene encoding a protein, wherein the mutation reduces the level of expression or results in a loss of function, e.g., protein inactivation.

[0029] The term "cell pool" as used herein refers to a mixed population of cells. In the more specific context of the present application, a cell pool expressing a recombinant glycoprotein (e.g., beta-glucocerebrosidase) can be generated by transfecting a gene encoding the recombinant glycoprotein (e.g., beta-glucocerebrosidase) into a host cell.

[0030] The term "recombination" refers to the process of exchange of genetic information between two polynucleotides. In the present application, "homologous recombination" refers to the particular modality of such exchange that occurs, for example, during the repair of a double-strand break in a cell. This process requires that the two polynucleotides have sequence similarity, utilizes a "donor" or "exchange" molecule to template repair of a "target" molecule (i.e., the molecule that has undergone the double-strand break), and is variously referred to as "non-crossover gene conversion" or "short tract gene conversion" because it results in the transfer of genetic information from the donor to the target. Without being bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA formed between the broken target and the donor, and / or "synthesis-dependent strand annealing" in which the donor is used to resynthesize genetic information that will become part of the target, and / or related processes. Such particular homologous recombination often results in the sequence of the target molecule being altered such that part or all of the sequence of the donor polynucleotide is integrated into the target polynucleotide.

[0031] The term "sequence identity" as used herein refers to the extent that sequence is identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I, U) or identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys, and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. In the present application, the percentage of sequence identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0032] The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of the active ingredient to be effective, and which contains no additional components which are unacceptably toxic to the subject to which the formulation is administered.

[0033] The term "stable", as used in the context of a pharmaceutical formulation, refers to a protein that retains its physical stability and / or chemical stability and / or biological activity upon storage. Stability can be determined at a selected temperature and for a selected time period. Preferably, the formulation is stable at room temperature (about 25°C) or at 40°C for at least 3 months and / or at about 2-8°C for at least 1 year.

[0034] The term "buffer" refers to a buffered solution that resists changes in pH through the action of its acid-base conjugate components. The pH range of the buffer in the present application is about 4-8; preferably, about 4.5-7; most preferably, the pH range is about 5.0-6.5. Examples of buffers that control the pH in this range include acetate buffers, succinate buffers, gluconate buffers, histidine buffers, citrate buffers, and other organic acid buffers.

[0035] The term "osmotic adjusting agent" refers to an agent that is added to a formulation to achieve a desired osmotic pressure level. Osmotic pressure can be expressed as the concentration of osmotically active particles dissolved in 1 kg of solution. Examples of osmotic adjusting agents include sugars and / or sugar alcohols.

[0036] The term "surfactant" refers to an agent that has surface activity. Examples of surfactants used in the present application include polysorbates and poloxamers.

[0037] The term "reconstitute" refers to the dissolution of a lyophilized protein preparation in a diluent such that the protein is dispersed therein. The reconstituted preparation is suitable for administration.

[0038] In general, the nomenclature used in connection with, and the techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present application are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Still further, the headings provided herein are for organizational purposes only and are not meant to be used in connection with the interpretation of the subject matter described herein.

[0039] Cell lines

[0040] One aspect of the present application includes a cell line deficient in mannosyl (alpha-1,3-)-recombinant glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 (MGAT1), wherein the cell line comprises an insertion of less than 600 bp in the coding region of a chromosomal sequence encoding MGAT1.

[0041] In one embodiment, the MGAT1 deficient cell line comprises an insertion of about 1-599 bp in the chromosomal sequence encoding MGAT1. In another embodiment, the MGAT1 deficient cell line comprises an insertion of about 1-50 bp, about 50-100 bp, about 100-200 bp, about 200-300 bp, about 300-400 bp, or less than about 600 bp in the coding region of MGAT1. In exemplary embodiments, the MGAT1 deficient cell line comprises an insertion of about 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 10 bp, 25 bp, or 50 bp in the chromosomal sequence encoding MGAT1, which results in loss of function of MGAT1. Insertion of about 1-599 bp in the chromosomal sequence encoding MGAT1 results in loss or inactivation of MGAT1 expression. The MGAT1 coding sequence is subject to a frameshift, which prevents production of a protein product. The chromosomal sequence encoding MGAT1 can be mutated using targeted endonuclease-mediated genome editing techniques described below.

[0042] In one embodiment, the MGAT1-deficient cell line comprises a deletion of approximately 1-1300bp in the chromosomal sequence encoding MGAT1. In another embodiment, the MGAT1-deficient cell line comprises a deletion of approximately 1-50bp, approximately 50-100bp, approximately 100-200bp, approximately 200-300bp, approximately 300-400bp, approximately 400-600bp, or greater than approximately 600bp in the coding region of MGAT1. In an exemplary embodiment, the MGAT1-deficient cell line comprises a deletion of approximately 1bp, 2bp, 3bp, 4bp, 5bp, 10bp, 25bp, or 50bp in the chromosomal sequence encoding MGAT1, resulting in loss of MGAT1 function. Deletions of approximately 1-599bp in the chromosomal sequence encoding MGAT1 result in loss of MGAT1 expression or inactivation. The MGAT1 coding sequence undergoes a frameshift within the reading frame, thereby preventing production of the protein product. The chromosomal sequence encoding MGAT1 can be mutated using targeted endonuclease-mediated genome editing techniques described below.

[0043] In some embodiments, the cells that can be used to produce recombinant glycoproteins are, in principle, all cells known to those skilled in the art that are capable of expressing recombinant glycoproteins. The cells can be animal cells, particularly mammalian cells. Examples of mammalian cells include CHO (Chinese Hamster Ovary) cells, preferably CHO-K1 cells, hybridomas, BHK (Baby Hamster Kidney) cells, myeloma cells, human cells (such as HEK-293 cells, human lymphoblastoid cells, E1 immortalized HER cells), and mouse cells (such as NSO cells). In one embodiment, the cells are animal cells, preferably mammalian cells, more preferably Chinese Hamster Ovary (CHO) cells. In an exemplary embodiment, the cell line is a type widely used for producing recombinant proteins (such as glycoproteins, etc.). In an exemplary embodiment, the cell line is a CHO cell line. A large number of CHO cell lines are available from ATCC. Suitable CHO cell lines include, but are not limited to, CHO-K1 cells and their derivatives.

[0044] In one embodiment, the cell line expresses at least one glycoprotein comprising one or more terminal mannose residues. In one embodiment, the glycoprotein is β-glucocerebrosidase.

[0045] Targeted endonuclease-mediated genome editing technology

[0046] In one embodiment, the chromosomal sequence encoding MGAT1 is modified using a targeted endonuclease-mediated genome editing technique, such as, for example, clustered regularly interspaced short palindromic repeats (CRISPR), zinc finger nuclease (ZFN), or transcription activator-like effector nuclease (TALEN).

[0047] The CRISPR system, which forms an adaptive immune system in bacteria, has been modified for genome engineering. The engineered CRISPR system contains two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas endonuclease). The gRNA is a short synthetic RNA consisting of a scaffold sequence required for binding to Cas and a user-defined ~20 nucleotides spacer sequence that defines the target of the genome to be modified. In the present invention, gRNA and sgRNA can be used interchangeably with each other. Thus, the genome target of the Cas protein can be changed simply by changing the target sequence that appears in the gRNA.

[0048] A knockout (e.g., mutant) cell or animal can be generated using CRISPR by co-expressing an endonuclease similar to Cas9 or Cpfl and a gRNA specific for the gene to be targeted. The genome target can be any ~20 nucleotides DNA sequence as long as it meets two conditions: (1) the sequence is unique with respect to the rest of the genome; and (2) the target is next to a protospacer adjacent motif (PAM). The PAM sequence is necessary for target binding, but the exact sequence depends on which Cas protein is used. A commonly used Cas protein is S. pyogenes Cas9 (SpCas9). Once expressed, the Cas9 protein and gRNA form a ribonucleoprotein complex through the interaction between the gRNA scaffold and a surface-exposed positively charged groove on Cas9. Cas9 undergoes a conformational change upon gRNA binding that converts the molecule from an inactive, non-DNA binding conformation to an active DNA binding conformation. Importantly, the spacer of the gRNA is still free to interact with the target DNA.

[0049] Cas9 cuts a given locus only when the gRNA spacer sequence shares sufficient homology with the target DNA. Once the Cas9-gRNA complex binds to the putative DNA target, the seed sequence (8-10 bases at the 3' end of the gRNA targeting sequence) begins to anneal to the target DNA. If the seed sequence and the target DNA sequence are paired, the gRNA continues to anneal to the target DNA in the 3' to 5' direction. The zipper-like annealing mechanism of Cas9 can explain why mismatches between target sequences in the 3' seed sequence completely stop target cutting, while mismatches toward the 5' end away from the PAM often still allow target cutting.

[0050] The Cas9 nuclease has two functional endonuclease domains: RuvC and HNH. Upon target binding, Cas9 undergoes a second conformational change, positioning the nuclease domains to cleave the opposite strand of the target DNA. The end result of Cas9-mediated DNA cleavage is the formation of a double-strand break (DSB) within the target DNA (approximately 3-4 nucleotides upstream of the PAM sequence).

[0051] The resulting DSB is then repaired via one of two general repair pathways: (1) the efficient but error-prone nonhomologous end joining (NHEJ) pathway; and (2) the less efficient but more reliable homology-directed repair (HDR) pathway. The NHEJ repair pathway is the most active repair mechanism, frequently resulting in small nucleotide insertions or deletions (indels) at the DSB site. The stochastic nature of NHEJ-mediated DSB repair has important practical implications, as a population of cells expressing Cas9 and gRNA will harbor a wide variety of mutations. In many cases, NHEJ induces small indels in the target DNA, resulting in amino acid deletions, insertions, or frameshift mutations, leading to premature stop codons within the open reading frame (ORF) of the target gene. The ideal end result is a loss-of-function mutation within the target gene.

[0052] In a specific embodiment, the knockout mutation of the MGAT1 gene by CRISPR-based means can be carried out by any feasible protocol, for example but not limited to the teachings in Yang 2014 (Yang, et al., CRISPR / Cas9-Directed Genome Editing of Cultured Cells. Current Protocols in Molecular Biology, 2014, 107(1): 31.1.1-31.1.17). In a more specific embodiment, the MGAT1 gene is mutated by CRISPR-based means wherein the sgRNA comprises or consists of SEQ ID NO: 4, or comprises or consists of a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4.

[0053] Method for producing a recombinant glycoprotein, a cell, a clone, or a cell line

[0054] Another aspect of the present application includes a method for producing a recombinant glycoprotein having a terminal mannose N-glycan having one or more terminal mannose residues, the method comprising:

[0055] (1) introducing a gene encoding the recombinant glycoprotein into a cell line;

[0056] (2) mutating a mannosyl (alpha-1, 3-)-recombinant glycoprotein beta-1, 2-N- acetylglucosaminyltransferase 1 (MGAT1) gene in the cell line obtained in step (1); and

[0057] (3) expressing the recombinant glycoprotein;

[0058] wherein the MGAT1 gene is mutated by CRISPR, wherein the sgRNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 4, or the sgRNA comprises or consists of a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 4.

[0059] Another aspect of the present application includes a method for generating a cell, a clone, or a cell line producing a recombinant glycoprotein having a terminal mannose N-glycan, the method comprising:

[0060] (1) introducing a gene encoding the recombinant glycoprotein into a cell line;

[0061] (2) mutating a mannosyl (a-1,3-) -recombinant glycoprotein β-1,2-N-acetylglucosaminyltransferase 1 (MGAT1) gene in the cell line obtained in step (1); and

[0062] wherein the MGAT1 gene is mutated by CRISPR, and wherein the sgRNA comprises or consists of the nucleic acid sequence of SEQ ID NO: 4, or the sgRNA comprises or consists of a nucleic acid sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleic acid sequence of SEQ ID NO: 4.

[0063] The plasmid that can be used in the present application can be any commercially available plasmid for the intended purpose. Those skilled in the art will easily know which plasmid is suitable for which purpose and will understand that the difference in the plasmid used will not substantially change the technical effects of the method / product of the present application.

[0064] In one embodiment, the plasmid for introducing a gene into a cell (e.g., a CHO cell) can be artificially prepared by integrating elements such as an origin of replication (ori), a promoter, a multiple cloning site for a gene of interest, and one or more selection marker-encoding genes into a single circular sequence. A non-limiting example of a commonly used plasmid for introducing a gene into a cell (e.g., a CHO cell) can be pMX241 (Addgene Cat. No. 23017) or the like.

[0065] In one embodiment, the plasmid for introducing a gene into a cell (e.g., a CHO cell) can be artificially prepared by integrating elements such as an origin of replication (ori), a promoter, a multiple cloning site for a gene of interest, and one or more selection marker-encoding genes into a single circular sequence. A non-limiting example of a commonly used plasmid for introducing a gene into a cell (e.g., a CHO cell) can be pMX241 (Addgene Cat. No. 23017) or the like.

[0066] In the present application, the selection marker can be any commercially available in the art. For example, the selection marker includes, but is not limited to, neomycin, puromycin, hygromycin, g418, blasticidin, and the like.

[0067] In one embodiment, RCA is used to select the cell line. In one embodiment, the transfected cells are cultured with Ricinus communis agglutinin-I (RCA-I). The cell line lacking MGAT1 can be further enriched by culturing with Ricinus communis agglutinin-I (RCA-I). RCA-I is a cytotoxic agglutinin that does not bind to terminal mannose residues, and thus can be used to select for cells that lack MGAT1 activity, as such cells produce glycoproteins with terminal mannose residues.

[0068] In one embodiment, the cell is an animal cell, particularly a mammalian cell, and more preferably a Chinese hamster ovary (CHO) cell. In exemplary embodiments, the cell line is of the type that is widely used for production of recombinant proteins, such as glycoproteins. In exemplary embodiments, the cell line is a CHO cell line. A number of CHO cell lines are available from the ATCC. Suitable CHO cell lines include, but are not limited to, CHO-K1 cells and derivatives thereof.

[0069] Recombinant glycoprotein

[0070] Another aspect of the present application includes a recombinant glycoprotein (e.g., beta-glucocerebrosidase) produced by the method according to the present application, which has N-glycans with terminal mannose.

[0071] In one embodiment, the recombinant glycoprotein is an enzyme, such as beta- glucocerebrosidase. In one embodiment, the recombinant glycoprotein has N-glycans comprising one or more than one terminal mannose residue. In some embodiments, the recombinant glycoprotein has N-glycans comprising 2 to 9 terminal mannose residues (also referred to as Man2 to Man9), such as 3 to 6 terminal mannose residues (also referred to as Man3 to Man6), and optionally 1 to 3 fucose residues (also referred to as 1F to 3F) that do not block the terminal mannose residues (such as 1 fucose residue (also referred to as 1F). Exemplary N-glycans in the present application are selected from the group consisting of Man3, Man4, Man4+1F, Man5, Man5+1F, Man6, and the like. In one embodiment, the proportion of N-glycans with terminal mannose linked to the recombinant glycoprotein is higher than 80%, 85%, 86%, 87%, 88%, or 89%.

[0072] Enzyme activity was measured using p-nitrophenyl-b-D-glucopyranoside (Sigma- N7006) as a substrate. The released product was 4-nitrophenol (Sigma-35836-1G), which was detected by measuring the absorbance at 405m using a microplate reader (MOLECULAR DEVICE, i3X). A reference standard curve was also measured to quantify the concentration of 4-nitrophenol. Enzyme activity was defined as the amount of enzyme that catalyzes the release of 1 nanomole of 4-nitrophenol from per milliliter of p-nitrophenyl-b-D-glucopyranoside per hour at 37°C. In a specific embodiment, the enzyme activity of the β-glucocerebrosidase produced by the cell line according to the present application is greater than about 0.2 U / mL, about 0.3 U / m, about 0.4 U / mL, about 0.5 U / mL, about 0.6 U / mL.

[0073] The recombinant glycoprotein is purified and has a purity of greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%. The purity can be detected by Caliper-SDS and SEC-HPLC assays, respectively.

[0074] Therapeutic methods

[0075] Another aspect of the present application includes a method for treating a β- glucocerebrosidase deficiency-related disease (such as Gaucher's disease), the method comprising administering to a subject in need thereof a recombinant glycoprotein having N-glycans with terminal mannose according to the present application, such as β-glucocerebrosidase, or use of a recombinant glycoprotein having N-glycans with terminal mannose according to the present application, such as β-glucocerebrosidase, in the manufacture of a composition for treating a β-glucocerebrosidase deficiency-related disease (such as Gaucher's disease).

[0076] Technical effects of the present application

[0077] The technical effects that can be achieved by the method / product according to the present application can be summarized as follows.

[0078] First, by mutating the MGAT1 gene in cells (such as CHO cells) expressing a recombinant glycoprotein (such as β-glucocerebrosidase), the present application has high purity, high quality, and high enzyme activity.

[0079] Second, the present application develops a new plasmid including a specific sgRNA (for example, sgRNA_5 listed in SEQ ID NO: 4) with higher mutation efficiency.

[0080] Third, in the present application, in the step of producing a cell line lacking MGAT1, the cell line lacking MGAT1 can be further enriched by using Ricinus communis agglutinin-I (RCA-I) culture.

[0081] Fourth, in the present invention, the gene encoding the recombinant glycoprotein is introduced into the cell before mutating the MGAT1 gene in the cell, which is advantageous in that it is more time-, cost- and labor-efficient to produce the recombinant glycoprotein having N-glycans with terminal mannose than the method in the prior art because the product quality attribute (PQA) and productivity requirements for the cloning body screening with respect to the expressed recombinant glycoprotein are clearly defined. In contrast, it would be much more difficult to screen the best host cell having the mutated MGAT1 gene and then introduce the gene encoding the recombinant glycoprotein into the mutated host cell because there are no such clearly defined criteria for the PQA and productivity for screening the best host cell. It takes less time to screen a better clone than to screen a host cell. In addition, in the method according to the present invention, the mutation and cloning are performed in the same step.

[0082] Pharmaceutical formulation

[0083] Another aspect of the present invention includes a pharmaceutical formulation of β-glucocerebrosidase. The formulation includes a pharmaceutically effective amount of β-glucocerebrosidase, a buffering agent, an osmotic adjusting agent, and a surfactant. In a specific embodiment, the β-glucocerebrosidase is present in an amount of 50-150 U / ml, 75-125 U / ml, 80-120 U / ml, 90-110 U / ml, or 100 U / ml. In a specific embodiment, the buffering agent is citrate buffer present in an amount of 2-10 g / mL, 3-9 g / mL, 4-8 g / mL, 5-7 g / mL, or 5-6 g / mL. In a specific embodiment, the osmotic adjusting agent is sucrose present in an amount of 40-120 g / L, 50-110 g / L, 60-100 g / L, 70-90 g / L, or 80 g / L. In a specific embodiment, the surfactant is polysorbate 80 present in an amount of 0.1-1 g / L, 0.1-0.9 g / L, 0.1-0.8 g / L, 0.1-0.7 g / L, 0.1-0.6 g / L, 0.1-0.5 g / L, 0.1-0.4 g / L, 0.1-0.3 g / L, or 0.2 g / L. In a specific embodiment, the formulation has a pH of 5-7.

[0084] The pharmaceutical formulation described in the present invention provides a stable formulation of β-glucocerebrosidase that has a longer shelf life and is more stable. The formulation remains stable for at least 12 weeks at 2-8°C, or at least 12 weeks at room temperature (about 25°C), or at least 4 weeks at 40°C. The formulation retains its physical and / or chemical and / or biological activity under different storage conditions.

[0085] Summary of Sequence Listing

[0086] Attached hereto is a Sequence Listing comprising the following listing of nucleic acid and amino acid sequences.

[0087] SEQ ID NO: 1 is the amino acid sequence of human β-glucocerebrosidase (NP 000148.2) ( https: / / www.ncbi.nlm.nih.gov / protein / NP_000148.2 https: / / www.ncbi.nlm.nih.gov / nuccore / NM_000157.3 ).

[0088] SEQ ID NO: 2 is the nucleic acid sequence of human β-glucocerebrosidase (NM_000157.3) ( Figure 1 Figure 1 ).

[0089] SEQ ID NO: 3 is the genomic nucleic acid sequence of the MGAT1 gene in CHO-K1 cells.

[0090] SEQ ID NO: 4 is the nucleic acid sequence of sgRNA_5.

[0091] abbreviation

[0092] Cas: CRISPR-associated

[0093] CEX: Cation Exchange

[0094] CHO cells: Chinese hamster ovary cells

[0095] CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats

[0096] DSB: double strand break

[0097] FACS: Fluorescence activated cell sorting

[0098] GnT I: N-acetyl-glucosaminyltransferase I

[0099] gRNA: guide RNA

[0100] HDR: homology-directed repair

[0101] HILIC: Hydrophilic Interaction Liquid Chromatography

[0102] LDC: limiting dilution cloning

[0103] MGAT1: Mannosyl (α-1,3-)-recombinant glycoprotein β-1,2-N-acetylglucosaminyltransferase

[0104] NHEJ: non-homologous end joining

[0105] ORF: open reading frame

[0106] ori: origin of replication

[0107] PAM: protospacer adjacent motif

[0108] PCR: polymerase chain reaction

[0109] Qp: unit productivity

[0110] RT: Response acquisition time

[0111] sgRNA: single-stranded guide RNA

[0112] SpCas9: Streptococcus pyogenes Cas9

[0113] TALEN: transcription activator-like effector nuclease

[0114] UPLC: Ultra-Performance Liquid Chromatography

[0115] VCD: variable cell density

[0116] VIA: Survival Rate

[0117] ZFN: Zinc Finger Nuclease

[0118] 2-AB: 2-aminobenzamide

[0119] Example

[0120] The present invention as a whole will be more easily understood by referring to the following examples, which are provided for illustrative purposes only and are not intended to limit the present invention. These examples are not intended to indicate that all experiments have been performed or that only these experiments have been performed.

[0121] Example 1

[0122] Generation of CHO cells stably expressing β-glucocerebrosidase

[0123] A plasmid containing the nucleic acid sequence set forth in SEQ ID NO: 2 (NM_000157.3, available at https: / / www.ncbi.nlm.nih.gov / nuccore / NM_000157.3), encoding β-glucocerebrosidase, which has been registered at GenBank with accession number NP_000148.2 (https: / / www.ncbi.nlm.nih.gov / protein / NP_000148.2, SEQ ID NO: 1), and two antibiotics were separately transfected into CHO-K1 cells cultured in BM001H medium, which is available from Thermo Fisher Scientific Inc., using commercially available lipofectamine.

[0124] Enzyme activity was measured using p-nitrophenyl-b-D-glucopyranoside (Sigma- N7006) as substrate. The released product was 4-nitrophenol (Sigma-35836-1G), which was detected by measuring the absorbance at 405 nm using a microplate reader (MOLECULAR DEVICE, i3X). A reference standard curve was also measured to quantify the concentration of 4-nitrophenol. Enzyme activity was defined as the amount of enzyme that catalyzes the release of 1 nanomole of 4-nitrophenol from per milliliter of p-nitrophenyl-b-D-glucopyranoside per hour at 37 °C.

[0125] Cell pools with higher enzyme activity and high survival rate in batch fed- batch culture were selected and used for cloning. The results are shown in Table 1.

[0126] Table 1: Batch fed-batch culture selection of stable cell pools

[0127]

[0128] Example II

[0129] Mutation of MGAT1 gene in cell pools stably expressing β-glucocerebrosidase

[0130] A plasmid containing Cas9 and gRNA targeting MGAT1 was constructed. The gRNA targeting MGAT1 was designed and then ligated into an internal vector containing Cas9 protein as shown in Figure 2 SEQ ID NO: 4 (sgRNA_5, TGACAATGGCAAGGAGCAGA) was selected for use.

[0131] The sgRNA_5 plasmid as shown in Figure 3 was transfected into cell pools prepared using the method of Example I by commercially available lipofection.

[0132] RCAI (Ricinus communis agglutinin) was also used for clone selection because it was found that Ricinus communis agglutinin has high toxicity to wild type CHO-K1 cells, and all mutants surviving from RCAI selection contain dysfunctional MGAT1. Once clones were recovered in 96-well plates, they were divided into two plates, one plate A was cultured in regular medium, while the other plate B was cultured in medium with RCA selection. Clones recovered from plate B with RCAI containing medium were selected and screened by enzyme activity detection. After enzyme activity screening, single clones with higher enzyme activity and confirmed monoclonality based on their single cell images were selected from plate A cultured in regular medium and expanded from plate A.

[0133] Single clones were sequentially expanded from 96-well plates to 24-well plates and then to centrifuge tubes. Clones that grew poorly during the expansion process were discarded. At the same time, all single clones were analyzed for MGAT1 mutations by sequencing, and clones with MGAT1 mutations were selected for batch refeed screening. At the time of inoculation, cell cultures were plated in centrifuge tubes at 5×10 5 The cells were diluted to a concentration of 10 cells / mL into fresh production medium for inoculation. Starting on day 3, the majority of the culture medium was refreshed daily with fresh production medium. When the VCD reached a plateau, a bleeding process was performed daily, in which the VCD was adjusted so that it remained at peak VCD for the next day. Glucose was also added to the culture according to consumption. Because the majority of the culture medium was frequently refreshed, cells could be cultured in an optimal state, allowing VIA to generally maintain better performance than traditional fed-batch processes. As a result, batch refeeding is more suitable for the production of fragile biologicals, such as fusion proteins that are currently susceptible to endogenous proteases or enzymes. The supernatants of the clones were analyzed for enzyme activity. The enzyme activity of the clones was also measured using p-nitrophenyl-bD-pyranoside (Sigma-N7006) as a substrate. The released product is 4-nitrophenol (Sigma-35836-1G), which is detected by measuring the absorbance at 405 nm using a microplate reader (MOLECULAR DEVICE, i3X). A reference standard curve is also measured to quantify the concentration of 4-nitrophenol. Enzyme activity is defined as the amount of enzyme required to catalyze the release of 1 nanomole of 4-nitrophenol per milliliter of p-nitrophenyl-bD-pyranoside per hour at 37°C. A clone prepared according to the method of Chinese patent application CN108588127A was used as a control.

[0134] The optimal clones with high β-glucocerebrosidase activity and Qp were selected and their supernatants were purified by cation exchange chromatography and hydrophobic interaction chromatography. The purified enzymes were analyzed by SEC, Caliper-SDS, and N-glycans.

[0135] Final clones were selected based on enzyme activity, Qp, cell culture performance, monoclonality, low copy number, and product quality including SEC, mannose levels, and Caliper-SDS (non-reducing). Final clones demonstrated a single nucleic acid insertion into a functional region of the native MGAT1 sequence, resulting in abnormal gene function (Table 2).

[0136] Table 2: Sequencing results of final clones

[0137]

[0138]

[0139] The final clones demonstrated higher enzyme activity and better productivity than the control clones (Table 3). The average enzyme activity of the final clones was 0.54 U / mL, while the average enzyme activity of the control clones was 0.26 U / mL. The average Qp of the final clones was 0.020 U / mL / cell / day, which was higher than that of the control clones.

[0140] Table 3: Final clone performance in fed-batch screening

[0141]

[0142] The unreduced and reduced purities of β-glucocerebrosidase produced by the final clone were detected by Caliper-SDS analysis. Caliper LC90 CE-SDS gel technology, PerkinElmer (Caliper) designed a chip-based automated fluorescence detection method that can analyze proteins in minutes with a sensitivity similar to standard SDS-PAGE. The data showed that the purity of unreduced β-glucocerebrosidase was 87.7%, while that of the control clone was 70.6% (Table 4).

[0143] Table 4: Caliper-SDS results of final clones

[0144]

[0145] A specific SEC method was developed to analyze monomers and aggregates of the final clones. An Agilent Advance Bio SEC column ( 7.8 mm × 300 mm, 2.7 μm) and an isocratic elution gradient was used for separation. As shown in Table 5, the percentage of β-glucocerebrosidase monomer expressed by the final clone was higher than that of the control clone.

[0146] Table 5: SEC results of final clones

[0147]

[0148] The effects of MGAT1 gene mutations on N-linked glycosylation of β-glucocerebrosidase were determined. N-glycan profiling was performed by UPLC. N-oligosaccharides were released by fast peptide N-glycosidase F (PNGase F) and then labeled with 2-AB. HILIC-based UPLC was used to separate and quantify N-glycans. A cell pool with the wild-type MGAT1 gene was used as a control.

[0149] As shown in Table 6 and ​ As shown in Figure 2, 89.3% of all N-glycans linked to β-glucocerebrosidase expressed by the final clone were N-glycans with mannose at the end, namely N-linked Man3, Man4, Man4+1F, Man5, Man5+1F, Man6, etc. Compared with the control pool ( ​ ), the proportion of N-linked Man5 was significantly increased in the final clones, resulting in much higher Man levels. These data clearly indicate that mutation of the MAGT1 gene in CHO cells expressing β-glucocerebrosidase significantly increases the proportion of mannose-terminated N-glycans attached to recombinant β-glucocerebrosidase.

[0150] Table 6: Glycan results of the final clones

[0151]

[0152] Example III

[0153] Preparation

[0154] β-Glucocerebrosidase produced from the final clone of Example II was formulated in the manner shown in Table 7.

[0155] Table 7: Pharmaceutical preparations of β-glucocerebrosidase

[0156]

[0157] Materials used in this formulation included: 20 mM citrate buffer, 8% (w / v) sucrose, 0.02% (w / v) PS80, pH 6.0.

[0158] Prepare 1 kg of PS80 stock solution (10% w / w)

[0159] The ingredients were weighed as follows: 100 g PS80 and 900 g water. The weighed materials were placed in a container. The solution was mixed until all PS80 was visually dissolved.

[0160] Prepare 1 kg of formulation buffer

[0161] Weigh the following ingredients: 0.64 g citric acid monohydrate, 4.81 g trisodium citrate dihydrate, 77.52 g sucrose, 1.94 g 10% (w / w) PS80 stock solution, and 915.09 g water. Transfer all weighed excipients to a 1 L container. Add water to the container until the total weight reaches 1000 g. Mix the solution until all excipients are visually dissolved.

[0162] Dilute and mix 1L of DS

[0163] The formulation buffer will be added to the DS (e.g., enzyme specific activity of 44.5 U / mg and enzyme activity of 4.1 mg / mL) to complete the protein (100 U / mL) mix. 0.55 L of DS is poured into a container, then 0.45 L of formulation buffer is also placed into the same container. The diluted DS is then mixed evenly.

[0164] Example IV

[0165] Formulation Study

[0166] Table 8 presents the key performance study of the formulation. The study shows that the formulation is stable for at least 12 weeks at 2-8°C, or at least 12 weeks at room temperature (about 25°C), or at least 4 weeks at 40°C. The formulation can retain its physical and / or chemical and / or biological activity under different storage conditions.

[0167] Table 8A Appearance / Osmolality / pH / Moisture / Reconstitution Time of Formulation

[0168]

[0169] Table 8B Protein Concentration / Purity of Formulation

[0170]

[0171] Table 8C DLS / HIAC / Enzyme Activity of Formulation

[0172]

[0173] Appearance

[0174] Clean the outside of the glass vial, then place the neck of the glass vial close to the edge of the light barrier of the YB-2 light box, at a distance of 25 cm. Inspect the appearance of the sample, including color, clarity, and visible particles, against a black and white background at an illumination level of 2000-3750 lx.

[0175] Osmolality

[0176] Determine the osmolality of 20 μL of undiluted sample using the Advanced 2020. Calibrate the osmometer before and after the determination using a 290 mOsm reference solution.

[0177] Calibrate the pH meter before use with three different standard buffers (pH 4.01, 7.00 and 9.21). After that, determine the pH of each sample in a 50 μL loading volume.

[0178] Moisture

[0179] Water content was determined with a Mettler Toledo C30D Karl Fischer coulometer. The room temperature was about 15-30 °C, while the air humidity was below 50%. First the analyte was added and the instrument was equilibrated until the relative drift value was below 15 μg / min. Then the lyophilized powder was opened and weighed and added to the instrument until the instrument showed a water content reading. To avoid water uptake of the lyophilized powder from the air, the process from opening the powder to weighing the powder has to be done quickly.

[0180] Reconstitution time

[0181] The flip-off aluminum cap was removed from the glass vial and the ultrapure water was added to the vial from the vial wall with a sterile syringe to prevent direct impact on the lyophilized sample. The vial was gently rotated and left to stand after being completely wetted with ultrapure water. The time from the injection of ultrapure water to the complete dissolution of the lyophilized sample was recorded.

[0182] Protein concentration

[0183] After the sample was mixed homogenously, the protein concentration was determined using a NanoDrop 2000 spectrophotometer by UV280 reading. The extinction coefficient was 1.703 AU*mL*mg -1 *cm -1 All measurements were repeated twice with a sample volume of 2.5 μL each time and the mean value was taken.

[0184] CE-SDS (NR&R)

[0185] CE-SDS driven by a high-voltage direct current electric field is a capillary electrophoresis method that separates samples according to their molecular size. The medium is a continuous gel packed in a capillary that constitutes a molecular sieve in the capillary and serves as a separation channel. For CE-SDS, sample preparation prior to electrophoresis involves heat denaturation of the sample at a specified concentration in the presence of SDS, which masks the intrinsic charge of the sample and imparts a similar charge-to-size ratio to all species. Upon application of a constant electric field, the sample migrates towards the anode at different speeds based on its size.

[0186] CE-SDS-NR

[0187] The CE_NR method for WBP108 was performed under the following experimental conditions: 50 pg of sample was moved into dilution solution PB-CA to make a total volume of 25 pL, then 75 pL of 1% SDS sample buffer and 5 pL of alkylation reagent were added to make a final volume of 105 pL, and the solution was mixed thoroughly. The sample was incubated in a heating block at 60 °C for 10 minutes, then cooled at room temperature for at least 3 minutes. 90 pL of prepared sample was moved into the insert, and the insert was placed into the vial. The vial was capped, then placed into the sample vial holder for sample analysis with an injection time of 40 seconds.

[0188] CE-SDS-R

[0189] The CE_R method was performed under the following experimental conditions: 50 pg of sample was moved into dilution solution PB-CA to make a total volume of 25 pL, then 75 pL of 1% SDS sample buffer and 5 pL of reduction reagent were added to make a final volume of 105 pL, and the solution was mixed thoroughly. The sample was incubated in a heating block at 60 °C for 10 minutes, then cooled at room temperature for at least 3 minutes. 90 pL of prepared sample was moved into the insert, and the insert was placed into the vial. The vial was capped, then placed into the sample vial holder for sample analysis with an injection time of 40 seconds.

[0190] RP-HPLC

[0191] Reverse phase chromatography (RPC) refers to an elution chromatography method that separates and purifies solutes based on the difference in solute polarity (hydrophobicity) using a non-polar reverse phase medium as a stationary phase and an aqueous solution of a polar organic solvent as a mobile phase. The solutes are distributed on the surface of the stationary phase by hydrophobic interaction. However, the surface of the RPC stationary phase is completely covered with non-polar groups, showing strong hydrophobicity. Therefore, it is necessary to use a polar organic solvent (such as methanol, acetonitrile, etc.) or its aqueous solution for elution and separation.

[0192] The RP method was performed on an HPLC system and under the following experimental conditions: Waters BioResolve™ PRmAb Polyphenyl, 450A, 2.7um, 2.1mm*150mm, 1 / pk was used as the column; an aqueous solution containing 0.1% TFA and an ACN solution containing 0.1% TFA were used as the mobile phase; 280 nm was selected as the UV detector wavelength; the column temperature was set to 45 °C; the sample was kept at 5 °C; the isocratic flow rate was 0.3 mL / min; the injection amount was 10 pg, and the run time was 27 minutes.

[0193] SEC-HPLC

[0194] Size exclusion chromatography (SEC), also known as gel filtration, separates molecules based on their size (hydraulic radius) as they pass through an SEC resin encapsulated in a column. SEC resins consist of a porous matrix of spherical particles designed not to interact with the molecules to be separated. After being applied to the column, molecules larger than the pores cannot diffuse into the beads and are therefore eluted first. Molecules smaller than the pore size can penetrate the pores to varying degrees based on their size.

[0195] The SEC method was performed on an HPLC system under the following experimental conditions: Agilent AdvanceBio SEC ( The SEC method was used for all studies in this report, with the following exceptions noted below: a 7.8 mm x 300 mm column, 2.7 μm; a mobile phase of 55 mM sodium citrate and 200 mM L-arginine (pH 5.5 ± 0.1); a UV detector wavelength of 280 nm; a column temperature of 25°C; and a sample temperature of 5°C. The isocratic flow rate was 0.6 mL / min; the injection volume was 30 μg; and the run time was 40 minutes. This SEC method was used for all studies in this report, with the exceptions noted below.

[0196] DLS

[0197] When a laser beam passes through particles, it scatters due to the Brownian motion of the particles in solution. DLS can be used to measure the diffusion coefficient of the particles in solution and calculate the hydrodynamic radius of the particles. DLS analysis was performed on a Malvern ZEN 3600. 70 μL of sample was added to a disposable cuvette in a biosafety hood and tested at 25°C.

[0198] HIAC

[0199] Sub-visible particles were monitored using the HIAC system. Each sample was tested four times in a row (1 mL / round). The results of the first round were discarded and the mean of the remaining three rounds was recorded. Finally, the data were automatically calculated by the software and the results were presented as the average number of particles ≥10 μm and ≥25 μm per milliliter.

[0200] Enzyme activity

[0201] The diluted enzyme was mixed with 20 mM p-NPG at 37°C for 1 hour. The reaction was stopped by adding 1 M glycine. The absorbance at 405 nm was measured to generate a signal proportional to the enzyme activity in the sample. A standard curve for the enzyme reaction product, p-NP, was plotted and analyzed using SoftMax software using a linear regression model. The enzyme activity of the test sample was calculated by comparing the OD value of the test sample with the standard curve.

[0202] Those skilled in the art will further appreciate that the present invention may be implemented in other specific forms without departing from the spirit or core attributes of the present invention. Since the foregoing description of the present invention discloses only exemplary embodiments thereof, it should be understood that other variations are considered to be within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments described in detail in this specification. Instead, reference should be made to the claims which set forth the scope and content of the present invention.

Claims

1. A pharmaceutical preparation comprising a pharmaceutically effective amount of β-glucocerebrosidase, a buffer, an osmotic regulator, and a surfactant, characterized in that: The content of the β-glucocerebrosidase is 100 U / mL, the buffer is a citrate buffer with a content of 5-6 g / L, the osmotic regulator is sucrose with a content of 80 g / L, the surfactant is polysorbate 80 with a content of 0.2 g / L, and the pH of the pharmaceutical preparation is 5.5-6.

5.

2. Use of the pharmaceutical preparation according to claim 1 in the preparation of a medicament for treating Gaucher's disease.

Images