Gene Editing System and Its Applications

The CRISPR/Cas14a gene editing system targets the removal of single-stranded DNA of twin viruses, solving the problem of plants being susceptible to twin viruses, and achieving the effect of improving plant resistance and preventing virus evolution.

CN115873828BActive Publication Date: 2025-06-24PEKING UNIV INST OF ADVANCED AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111132044.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-26
Publication Date
2025-06-24
Estimated Expiration
2041-09-26

AI Technical Summary

Technical Problem

Plants are susceptible to single-stranded DNA viruses that are twin viruses, and the existing technology is difficult to effectively prevent and treat, resulting in virus evolution and escape.

Method used

The CRISPR/Cas14a gene editing system is used to target the single-stranded DNA of the virus through the Cas14a protein and guide RNA to avoid the evolution and escape caused by the double-stranded DNA.

Benefits of technology

It improves the resistance of plants to single-stranded DNA viruses, prevents virus evolution and escape, and enhances the safety of agricultural production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115873828B_ABST
    Figure CN115873828B_ABST
Patent Text Reader

Abstract

The present invention provides a gene editing system and its application. Among them, the gene editing system includes a Cas14a protein and a guide RNA, and this gene editing system can cleave single-stranded DNA, solving the problem in the prior art that plants are susceptible to single-stranded DNA viruses such as geminiviruses, and is applicable to the field of plant genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and more particularly, to a gene editing system and its application. Background Art

[0002] Plant viruses are an important type of plant disease, which not only seriously affect plant growth and yield, but most of them are highly contagious, causing catastrophic effects. Plant single-stranded DNA viruses represented by geminiviruses have an important impact on agricultural development, causing devastating damage to important food and cash crops such as maize, wheat, tomato, cotton, and cassava globally. They are also the earliest and most diverse plant viruses recorded in the world, with characteristics such as high incidence, great harm, difficult control, and high transmission efficiency (Rojas et al., 2018).

[0003] Geminiviruses are the only class of single-stranded DNA viruses with twin particle morphology in plants and are also the largest known single-stranded DNA virus family. More than 400 geminiviruses have been discovered so far. Their genome types can be divided into single-component and two-component, and the size of each DNA molecule is about 2.6 - 3.0 kb. Geminivirus replication occurs through a double-stranded replication intermediate. Single-stranded DNA first forms a double-stranded DNA intermediate under the action of DNA polymerase, and the double-stranded DNA intermediate undergoes rolling circle replication to form a nick in a conserved sequence TAATATT / AC in the intergenic region and initiate ssDNA synthesis. The transmission of geminiviruses requires insects such as whiteflies and leafhoppers as vectors, and most of them infect and parasitize the phloem tissues of plants. Currently, the main control measures for geminiviruses in the field are still prevention-based, and the main control methods are equipment prevention and control and cutting off the transmission vectors. However, due to the difficulty of control, the damage caused by geminiviruses on various crops is becoming increasingly serious, causing great damage to the safety of agricultural production in China. Therefore, it is particularly crucial to find more effective control measures (Rojas et al., 2018).

[0004] Compared with these measures, the use of resistant varieties has many advantages such as high efficiency, broad spectrum and low cost. At present, the breeding direction of resistant varieties mainly blocks the replication of geminiviruses or interferes with the expression of their pathogenic proteins. In recent years, gene editing technologies represented by TLAEN and CRISPR / Cas9 have been widely used in plant antiviral research. By specifically targeting the double-stranded DNA replication intermediates of geminiviruses, gene editing technologies can efficiently inhibit the replication of geminiviruses in plants and create geminivirus-resistant lines in tobacco, Arabidopsis and tomato (Ji et al., 2015; Zaidi et al., 2020). However, after gene editing technologies cut double-stranded DNA, the formed double-strand breaks will be randomly repaired in vivo, generating mutations such as base insertions, deletions and substitutions. The virus after this kind of mutation is no longer recognized by gene editing, thus leading to the evolution and escape of the virus and posing a new threat (Zaidi et al., 2020). Summary of the Invention

[0005] The main object of the present invention is to provide a gene editing system and its application to solve the problem that plants in the prior art are easily infected with single-stranded DNA viruses such as geminiviruses.

[0006] To achieve the above object, according to one aspect of the present invention, there is provided a gene editing system, which includes Cas14a protein and guide RNA; the guide RNA includes crRNA, tracrRNA and a target binding sequence; the crRNA and the target binding sequence are located on the same strand and the target binding sequence is located at the 3'-end of the crRNA; the crRNA and the tracrRNA have a secondary structure with partial base complementarity; the target binding sequence is a nucleic acid sequence with no more than two consecutive A bases at the 3'-end.

[0007] Furthermore, the Cas14a protein includes but is not limited to Cas14a1 protein; preferably, the Cas14a1 protein has the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the Cas14a1 protein is a gene codon-optimized according to plant codon preference; preferably, the Cas14a protein may include a protein tag, and the protein tag is located at the N-terminus and / or C-terminus of the Cas14a protein; preferably, the above protein tags include but are not limited to one or more of the following protein tags: Flag, His6, HA, Myc, GFP or YFP; preferably, the Cas14a protein may include a nuclear localization signal, and the nuclear localization signal is located at the N-terminus and / or C-terminus of the Cas14a protein or the Cas14a protein containing the protein tag; preferably, the tracrRNA has the nucleotide sequence shown in SEQ ID NO: 3; preferably, the crRNA has the nucleotide sequence shown in SEQ ID NO: 4.

[0008] Furthermore, the gene coding sequence of the target-binding sequence is denoted as the target sequence, and the RNA sequence transcribed from the target sequence is the target-binding sequence, wherein the target sequence is a nucleic acid sequence of 20 to 30 nt with no more than two consecutive A bases at the 3' end; preferably, the target sequence is selected from the nucleotide sequences shown in SEQ ID NO: 10 or SEQ ID NO: 13.

[0009] According to the second aspect of the present application, a recombinant vector is provided, which includes the nucleic acid sequence of the Cas14a protein in the above gene editing system and the nucleic acid sequence encoding the guide RNA.

[0010] Furthermore, the recombinant vector is one or more; preferably, when there is one recombinant vector, the nucleic acid sequence encoding the Cas14a protein in the gene editing system and the nucleic acid sequence encoding the guide RNA are ligated to the same recombinant vector; preferably, the gene encoding the Cas14a1 protein has the nucleotide sequence shown in SEQ ID NO: 9; preferably, the gene encoding the guide RNA includes the gene encoding tracrRNA, the gene encoding crRNA, and the gene encoding the target-binding sequence; preferably, the gene encoding tracrRNA has the nucleotide sequence shown in SEQ ID NO: 1; preferably, the gene encoding crRNA has the nucleotide sequence shown in SEQ ID NO: 2; preferably, the gene encoding the target-binding sequence is a nucleic acid sequence of 20 to 30 nt with no more than two consecutive A bases at the 3' end; preferably, the recombinant vector includes the nucleic acid sequence encoding a self-splicing enzyme; preferably, the self-splicing enzyme includes a hammerhead ribozyme or a hepatitis delta virus ribozyme; preferably, the nucleic acid sequences encoding the hammerhead ribozyme or the hepatitis delta virus ribozyme are independently disposed between the sequences of the gene encoding crRNA and the gene encoding tracrRNA for spacing the gene encoding crRNA and the gene encoding tracrRNA.

[0011] Furthermore, the gene encoding the guide RNA further includes a linker sequence, which is located between the nucleic acid sequences encoding the hammerhead ribozyme and the hepatitis delta virus ribozyme; preferably, the linker sequence has the nucleotide sequence shown in SEQ ID NO: 5; preferably, the gene editing system includes a promoter, which is located upstream or downstream of the gene encoding tracrRNA and / or the gene encoding crRNA; preferably, the promoter includes one or more of the following promoters: constitutive, enhanced, tissue-specific, and inducible; preferably, the promoter includes one or more of the following promoters: the tobacco mosaic virus 35S promoter, the Arabidopsis thaliana U6 promoter, or the Arabidopsis thaliana Actin1 promoter; preferably, the gene encoding the guide RNA has the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[0012] According to the third aspect of the present application, a kit is provided, which includes the above gene editing system or recombinant vector.

[0013] According to the fourth aspect of the present application, a host cell is provided, which is transformed with the above recombinant vector; preferably, the host cell includes but is not limited to Escherichia coli or Agrobacterium tumefaciens; preferably, Escherichia coli includes but is not limited to XL1 - blue; preferably, Agrobacterium tumefaciens includes but is not limited to GV3101.

[0014] According to the fifth aspect of the present application, a method for enhancing the resistance of plants to single - stranded DNA viruses is provided, and the method includes: increasing the targeting of the guide RNA and / or the activity or content of the Cas14a protein in the above gene editing system, or recombinant vector, or kit, or host cell, so that the resistance of the plant to single - stranded DNA viruses is enhanced or reduced; preferably, the single - stranded DNA virus includes geminivirus.

[0015] According to the sixth aspect of the present application, an application of the above gene editing system, or recombinant vector, or kit, or host cell in enhancing the resistance of plants to single - stranded DNA viruses or cultivating transgenic plants with enhanced resistance to single - stranded DNA viruses is provided; preferably, the single - stranded DNA virus includes geminivirus.

[0016] Applying the technical solution of the present invention, a gene editing system and its application are provided, which target and excise the single - stranded DNA of the virus, avoid the virus evolution and escape caused by excising the double - stranded DNA of the virus, and improve the resistance of plants to single - stranded DNA viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The specification drawings forming a part of this application are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings:

[0018] Figure 1 A schematic diagram showing the inhibition of geminivirus by Cas14a1 is shown;

[0019] Figure 2 A schematic diagram of the pZ - Cas14a1 vector according to Example 1 of the present invention is shown;

[0020] Figure 3 A schematic diagram of the transcription of the guide RNA gene according to Example 2 of the present invention is shown;

[0021] Figure 4 A schematic diagram showing the relative expression levels of Cas14a1 in the control and transgenic lines according to Example 3 of the present invention is shown;

[0022] Figure 5Shows the phenotypes after BSCTV infection of the control and Cas14a1 transgenic plants in Example 4 of the present invention;

[0023] Figure 6 Shows the BSCTV accumulation in the shoot tips of the control and Cas14a1 transgenic plants after BSCTV infection in Example 4 of the present invention;

[0024] Figure 7 Shows the detection of the targeting effect of Cas14a1 on BSCTV by the tobacco injection system in Example 5 of the present invention;

[0025] Figure 8 Shows the SNP ratio generated by the Cas14a1 vector containing the target sequence and the empty vector control in the BSCTV genome target region in Example 5 of the present invention;

[0026] Figure 9 Shows the Indel ratio generated by the Cas14a1 vector containing the target sequence and the empty vector control in the BSCTV genome target region in Example 5 of the present invention. Detailed implementation manners

[0027] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0028] Term explanations:

[0029] Target site: In a gene editing system, the guide RNA binds to a DNA sequence on the target gene, and this DNA sequence on the target gene is the target site.

[0030] Target site binding sequence: Refers to the RNA sequence in a gene editing system that is used to specifically bind to a DNA sequence on the target gene, that is, a segment of the guide RNA that can specifically bind to the target site, and it is complementary to the single-stranded DNA sequence of the target site.

[0031] Target sequence: Specifically refers to the gene coding sequence of the target site binding sequence in this application.

[0032] Self-splicing enzyme: It is a nucleic acid enzyme that catalyzes the simultaneous cleavage and ligation reactions of its own RNA molecule under certain conditions.

[0033] Protein tag: Refers to a polypeptide or protein that is fused and expressed together with the target protein, and its uses generally include (1) facilitating the purification of the target protein, (2) increasing the soluble expression and stability of the target protein, (3) being used for the detection and in vivo tracing of the target protein, etc.

[0034] Nuclear localization signal (NLS): A signal peptide that can be located in any part of the polypeptide sequence, generally containing 4 - 8 amino acids and having no specificity. Its function is to help nucleophilic proteins enter the nucleus.

[0035] As mentioned in the background art, plant single-stranded DNA viruses represented by geminiviruses are prone to cause devastating harm to food and cash crops, with characteristics such as high incidence, great harm, difficult prevention and control, and high transmission efficiency. At present, the breeding direction of resistant varieties mainly blocks the replication of geminiviruses (BSCTV) or interferes with the expression of their pathogenic proteins. In recent years, gene editing technologies represented by TLAEN and CRISPR / Cas9 have been widely used in plant antiviral research. By specifically targeting the double-stranded DNA replication intermediate of geminiviruses, gene editing technologies can efficiently inhibit the replication of geminiviruses in plants. However, after gene editing technologies cut double-stranded DNA, the resulting double-strand breaks will be randomly repaired in vivo, generating mutations such as base insertions, deletions, and substitutions. The virus after this kind of mutation is no longer recognized by the gene editing system, thus leading to the evolution and escape of the virus, posing a new threat.

[0036] Therefore, in this application, the inventors studied and analyzed the existing editing systems and found that based on the characteristic of the CRISPR / Cas14a system targeting single-stranded DNA, the geminivirus genome can be cut at the invasion stage of geminiviruses, rather than the double-stranded DNA stage of the replication intermediate. When inhibiting the virus, it will not cause the evolution of the virus, improving its sustainability and ecological safety (as shown in the schematic diagram Figure 1 ). Therefore, a series of protection schemes of this application are proposed.

[0037] In the first embodiment of the present invention, a gene editing system is provided. The gene editing system includes a Cas14a protein and a guide RNA; the guide RNA includes a crRNA, a tracrRNA, and a target-binding sequence; the crRNA and the target-binding sequence are located on the same strand and the target-binding sequence is located at the 3'-end of the crRNA; the crRNA and the tracrRNA have a secondary structure with partial base complementary pairing; the target-binding sequence is a nucleic acid sequence with no more than two consecutive A bases at the 3'-end.

[0038] The guide RNA further includes a target-binding sequence, which is located downstream of the crRNA and forms a continuous RNA fragment with the crRNA for specific binding to the target gene. It can, together with the secondary structure formed by the crRNA and the tracrRNA with partial base complementary pairing, jointly guide the Cas14a protein to specifically cut the target gene.

[0039] In mammalian cells, the Cas14a protein can target single-stranded DNA without the need for a PAM sequence (the PAM sequence is a DNA sequence on the DNA to be cleaved that guides the binding of the Cas protein and enables the Cas protein to exert its cleavage activity). In addition, studies have found that the Cas14a protein can target and cleave double-stranded DNA when recognizing a PAM rich in T bases at the 5' end. Therefore, in order to exert the function of the Cas14a protein to target and cleave single-stranded DNA and avoid the Cas14a protein targeting double-stranded DNA, in this application, a gene without a T-rich base at the 5' end is selected as the target gene, that is, the target-binding sequence can be a nucleic acid with no more than two consecutive A bases at the 3' end.

[0040] In the above gene editing system, the Cas14a protein includes but is not limited to the Cas14a1 protein; preferably, the Cas14a1 protein has the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the Cas14a1 protein is a gene codon-optimized according to plant codon preference; preferably, the Cas14a protein may include a protein tag, and the protein tag is located at the N-terminus and / or C-terminus of the Cas14a protein; preferably, the above protein tag includes one or more of the following protein tags: Flag, His6, HA, Myc, GFP or YFP; preferably, the Cas14a protein may include a nuclear localization signal, and the nuclear localization signal is located at the N-terminus and / or C-terminus of the Cas14a protein or the Cas14a protein containing the protein tag; preferably, the tracrRNA has the nucleotide sequence shown in SEQ ID NO: 3; preferably, the crRNA has the nucleotide sequence shown in SEQ ID NO: 4.

[0041] Compared with the CRISPR / Cas9 system that targets double-stranded DNA and has been widely used in recent years, the CRISPR / Cas14a provided in this application targets single-stranded DNA, so it can cleave the geminivirus genome at the invasion stage of geminiviruses (i.e., the single-stranded DNA stage), rather than the double-stranded DNA stage of the replication intermediate. Cas14a1 is the Cas14a protein with the highest reported activity at present, and codon optimization for plants can be carried out according to its amino acid sequence. According to the water solubility of the protein or the requirements for subsequent purification, localization, etc., a variety of different protein tags can be selected. The replication of the virus is completed in the nucleus of the host cell. Therefore, by adding a nuclear localization signal to the Cas14a protein, the Cas14a protein can be targeted to the nucleus to cleave single-stranded DNA at the stage of virus replication and generation of single-stranded DNA, thereby improving the cleavage efficiency.

[0042] In the above gene editing system, the gene coding sequence of the above target binding sequence is denoted as the target sequence, and the RNA sequence transcribed from the target sequence is the target binding sequence. Among them, the target sequence is a nucleic acid sequence of 20-30 nt with no more than two consecutive A bases at the 3' end; preferably, the target sequence is selected from the nucleotide sequences shown in SEQ ID NO: 10 or SEQ ID NO: 13. The present invention uses the target sequence to transcribe the target binding sequence, which is complementary paired and specifically bound to the target gene. According to factors such as annealing temperature and targeting, the target sequence can be flexibly selected, and the length of the target sequence can be 20-30 nt. The nucleic acid sequence of 20-30 nt with no more than two consecutive A bases at the 3' end can prevent the Cas14a protein from cleaving double-stranded DNA.

[0043] In the second embodiment of the present invention, a recombinant vector is provided, which includes a nucleic acid sequence encoding the Cas14a protein in the above gene editing system and a nucleic acid sequence encoding the guide RNA.

[0044] In the above recombinant vector, the recombinant vector can be one or more; preferably, when there is one recombinant vector, the nucleic acid sequence encoding the Cas14a protein in the gene editing system and the nucleic acid sequence encoding the guide RNA are ligated to the same recombinant vector; preferably, the gene encoding the Cas14a1 protein has the nucleotide sequence shown in SEQ ID NO: 9; preferably, the gene encoding the guide RNA includes the gene encoding tracrRNA, the gene encoding crRNA, and the gene encoding the target binding sequence; preferably, the gene encoding tracrRNA has the nucleotide sequence shown in SEQ ID NO: 1 (ttcactgataaagtggagaaccgcttcaccaaaagctgtcccttaggggattagaacttgagtgaaggtgggctgcttgcatcagcctaatgtc gagaagtgctttcttcggaaagtaaccctcgaaacaaattcatttttcctctccaattctgca, SEQ ID NO: 1); preferably, the gene encoding crRNA has the nucleotide sequence shown in SEQ ID NO: 2 (tgcagaacccgaatagacgaatgaaggaatgcaac, SEQ ID NO: 2); preferably, the gene encoding the target binding sequence is a nucleic acid sequence of 20-30 nt with no more than two consecutive A bases at the 3' end; preferably, the recombinant vector includes a nucleic acid sequence encoding a self-splicing enzyme; preferably, the self-splicing enzyme includes a hammerhead ribozyme (HH) or a hepatitis delta virus ribozyme (HDV); preferably, the nucleic acid sequences encoding the hammerhead ribozyme or the hepatitis delta virus ribozyme are each independently arranged between the sequences of the gene encoding crRNA and the gene encoding tracrRNA to separate the crRNA gene and the tracrRNA gene.

[0045] The recombinant vector(s) can be one or more. Using the gene encoding the guide RNA on the recombinant vector, including but not limited to the gene encoding tracrRNA, the gene encoding crRNA, and the gene encoding the target-binding sequence, tracrRNA and crRNA with a target-binding sequence at the 3'-end are transcribed. If the genes encoding tracrRNA and crRNA are on the same strand and transcribed simultaneously, the problem of low activity caused by separate transcription can be overcome. The gene encoding the target-binding sequence can be a nucleic acid sequence of 20 - 30 nt with no more than two consecutive A bases at the 3'-end, preventing the Cas14a protein from integrating into the double-stranded DNA genome and causing harmful cleavage. To further facilitate the correct expression of each element involved in the above gene editing system in the recombinant vector to form a Cas14a protein splicing complex through self-cleavage and assembly and exert a cleavage function on the target gene, in a preferred embodiment, the recombinant vector further includes a gene encoding a self-splicing enzyme. The self-splicing enzyme is an RNA enzyme, and using its self-cleavage activity, it cleaves the guide RNA in the above gene editing system, enabling tracrRNA and crRNA to form secondary structures and specifically bind to exert their activity.

[0046] In the above recombinant vector, the gene encoding the guide RNA further includes a linker sequence, which is located between the nucleic acid sequences encoding the hammerhead ribozyme and the hepatitis delta virus ribozyme; preferably, the linker sequence has the nucleotide sequence shown in SEQ ID NO: 5 (gagggaggcgtagtccggcacgtcatatggata, SEQ ID NO: 5); preferably, the gene editing system includes a promoter, which is located upstream or downstream of the gene encoding tracrRNA and / or the gene encoding crRNA; preferably, the promoter includes one or more of the following promoters: constitutive, enhanced, tissue-specific, and inducible; preferably, the promoter includes one or more of the following promoters: the tobacco mosaic virus 35S promoter, the Arabidopsis thaliana U6 promoter, or the Arabidopsis thaliana Actin1 promoter; preferably, the gene encoding the guide RNA has the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. Using an appropriate promoter can regulate the transcription of the guide RNA. By optimizing the promoter, the protein expression level can be changed, thereby affecting the resistance of plants to single-stranded DNA viruses. The above linker sequence can separate two active fragments, such as separating crRNA and tracrRNA, preventing the weakening or disappearance of activity caused by steric hindrance and other reasons when different active fragments are directly connected.

[0047] In the third embodiment of the present invention, a kit is provided, which contains the above gene editing system or recombinant vector. Using this kit can enhance the resistance of host cells or plants to single-stranded DNA viruses.

[0048] In the fourth embodiment of the present invention, a host cell is provided, which is transformed with the above recombinant vector; preferably, the host cell includes Escherichia coli or Agrobacterium tumefaciens; preferably, Escherichia coli includes XL1-blue; preferably, Agrobacterium tumefaciens includes GV3101. The above host cell has the functions of preserving, replicating the above recombinant vector or transforming the recombinant vector into a host or other functions.

[0049] In the fifth embodiment of the present invention, a method for enhancing the resistance of plants to single-stranded DNA viruses is provided, and the method includes: increasing the targeting of the guide RNA, or the activity or content of the Cas14a protein in the above gene editing system, or recombinant vector, or kit, or host cell, so that the resistance of plants to single-stranded DNA viruses is enhanced; preferably, the single-stranded DNA virus includes but is not limited to geminivirus. By changing the target binding sequence in the guide RNA or the sequences of crRNA and tracrRNA, the targeting and cleavage efficiency of crRNA, tracrRNA and Cas protein can be changed; by mutating the Cas14a protein, the activity of the Cas14a protein and the cleavage efficiency of single-stranded DNA can be changed; at the same time, prevent the Cas14a protein from cleaving the double-stranded DNA of the host and prevent unnecessary and harmful mutations to the host cell.

[0050] In the sixth embodiment of the present invention, an application of the above gene editing system, or recombinant vector, or kit, or host cell in enhancing the resistance of plants to single-stranded DNA viruses or cultivating transgenic plants with enhanced resistance to single-stranded DNA viruses is provided; preferably, the single-stranded DNA virus includes but is not limited to geminivirus. It can solve the problem that plants in the prior art are easily infected with single-stranded DNA viruses such as geminiviruses.

[0051] The beneficial effects of the present application will be further explained in detail below with specific examples.

[0052] Example 1: Construction of CRISPR / Cas14a1 vector

[0053] According to the amino acid sequence (SEQ ID NO: 8) of Cas14a1 with the highest activity in the article (Harrington et al., 2018), its plant codons were optimized (SEQ ID NO: 9).

[0054] SEQ ID NO: 8:

[0055] GIHGVPAAAKNTITKTLKLRIVRPYNSAEVEKIVADEKNNREKIALEKNKDKVKEACSKHLKVAAYCTTQVERNACLFCKARKLDDKFYQKLRGQFPDAVFWQEISEIFRQLQKQAAEIYNQSLIELYYEIFIKGKGIANASSVEHYLSDVCYTRAAELFKNAAIASGLRSKIKSNFRLKELKNMKSGLPTTKSDNFPIPLVKQKGGQYTGFEISNHNSDFIIKIPFGRWQVKKEIDKYRPWEKFDFEQVQKSPKPISLLLSTQRRKRNKGWSKDEGTEAEIKKVMNGDYQTSYIEVKRGSKICEKSAWMLNLSIDVPKIDKGVDPSIIGGIDVGVKSPLVCAINNAFSRYSISDNDLFHFNKKMFARRRILLKKNRHKRAGHGAKNKLKPITILTEKSERFRKKLIERWACEIADFFIKNKVGTVQMENLESMKRKEDSYFNIRLRGFWPYAEMQNKIEFKLKQYGIEIRKVAPNNTSKTCSKCGHLNNYFNFEYRKKNKFPHFKCEKCNFKENADYNAALNISNPKLKSTKEEP。

[0056] SEQ ID NO: 9:

[0057]

[0058] Cas14a1 is expressed using the tobacco mosaic virus 35S promoter and contains a FLAG tag and an NLS nuclear localization signal.

[0059] For the transcription of the crRNA (ugcagaacccgaauagacgaaugaaggaaugcaac, SEQ ID NO: 4) and tracrRNA (uucacugauaaaguggagaaccgcuucaccaaaagcugucccuuaggggauuagaacuugagugaaggugggcugcuugcauc agccuaaugucgagaagugcuuucuucggaaaguaacccucgaaacaaauucauuuuuccucuccaauucugca, SEQ ID NO: 3) of Cas14a1, the Arabidopsis thaliana U6 promoter is used in combination with the self-cleavage activities of the hammerhead ribozyme (HH) and the hepatitis delta virus ribozyme (HDV) for cleavage.

[0060] After synthesizing the Cas14a1 expression sequence, it was digested with XbaI and SacI, and the recovered fragment was ligated to the pKSE401 vector digested with XbaI and SacI. After synthesizing the U6-crRNA-tracrRNA sequence, it was digested with HindIII alone and ligated to the above vector digested with HindIII alone to obtain the pZ-Cas14a1 vector ( Figure 2 )

[0061] Example 2: Selection of Targets of Gemini Virus BSCTV

[0062] In mammalian cells, Cas14a1 can target single-stranded DNA without the need for a PAM sequence. In addition, it has been found that Cas14a1 can target and cleave double-stranded DNA in Escherichia coli when the 5' end is rich in T bases as the PAM (Karvelis et al., 2020). To avoid Cas14a1 targeting double-stranded DNA, in this example, target genes without a T-rich sequence at the 5' end were selected. The target sequence length of Cas14a1 is 20 - 30 nt, and a 25-nt target sequence was selected in this study. Since Cas14a1 targets the single-stranded DNA genome of BSCTV, target sequences complementary to the single-stranded genome were selected.

[0063] The selected target sequences and primers are shown in the following table:

[0064] Table 1:

[0065]

[0066] Anneal the above forward primer and reverse primer, and then ligate them to the pZ-Cas14a1 vector digested with BsaI using T4 DNA ligase.

[0067] Among them, the single-stranded primers are annealed and synthesized into a double-stranded target sequence fragment, and the specific method is as follows:

[0068] 1. First, dilute the above single-stranded forward primer and reverse primer to 10 μmol / L;

[0069] 2. Prepare a 20 μL system according to forward primer: 2 μL; reverse primer: 2 μL; H2O: 16 μL;

[0070] 3. Control the temperature of the PCR instrument: 95°C for 2 min; decrease to 25°C at a rate of 0.1°C / s; cool down to 4°C for 5 min;

[0071] 4. Store the obtained fragment at -20°C.

[0072] Among them, the construction method of the pZ-Cas14a1-T1 / T2 vector includes the following steps:

[0073] 1. Digest the pZ-Cas14a1 plasmid with BsaI, then purify and recover the DNA fragment, and store it frozen at -20°C;

[0074] 2. Ligate the digested pZ-Cas14a1 vector and the double-stranded target sequence fragment using T4 DNA ligase;

[0075] 3. Transform the ligation product into Escherichia coli XL1-blue, screen with kanamycin, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target sequence is inserted into the vector; the identification primers are the M13F universal primer (tgtaaaacgacggccagt, SEQ ID NO: 16) and the R primer of the target sequence (ggccgacctccgcgtgcagatcttccatc (SEQ ID NO: 12) or ggccgcagtggaattgtttgctggtactt (SEQ ID NO: 15));

[0076] 4. Extract the plasmid and perform sequencing verification using the primer U6 (acaatcttcaaaagtcccac, SEQ ID NO: 17). Obtain the pZ-Cas14a1-Target vector with the target sequence T1 / T2, and this vector has a gene that can encode guide RNA (SEQ ID NO: 6 or 7, Figure 3 )

[0077] SEQ ID NO: 6:

[0078]

[0079] SEQ ID NO: 7

[0080]

[0081] Example 3: Selection of Transgenic Lines

[0082] 1. Two pZ-Cas14a1-Target vectors and the empty vector pZ-Cas14a1 were respectively transformed into Agrobacterium tumefaciens GV3101 by electroporation;

[0083] 2. Incubate at 28 °C for 90 min; Screen with kanamycin and rifampicin resistance, select monoclonal colonies for colony PCR identification, and the identification primers are the same as those for the aforementioned transformation of Escherichia coli; Store the strains at -80 °C;

[0084] 3. Infect and transform Nicotiana benthamiana with Agrobacterium tumefaciens, and this transformation was completed by Beijing Geneovo Biotechnology Co., Ltd.;

[0085] 4. More than 40 T0 lines positive for kanamycin resistance screening were obtained for each plasmid;

[0086] 5. Plant the T0 lines in the greenhouse and harvest the seeds;

[0087] 6. Sow the T1 generation seeds on 1 / 2 MS medium containing 50 mg / L kanamycin, select the lines with a ratio of resistant seedlings to non-resistant plants of about 3:1, and randomly select 6 seedlings and store them at -80 °C;

[0088] 7. Crush the frozen samples under liquid nitrogen and extract RNA using the ComWin Biotech RNA extraction kit (ComWin Biotech RNA extraction kit);

[0089] 8. Reverse transcribe the RNA into cDNA using the Tiangen cDNA synthesis kit (TIANScript cDNA First Strand Synthesis Kit);

[0090] 9. Use the SuperReal PreMix Plus (SYBR Green) from Tiangen Biochemical Technology to perform fluorescence quantitative PCR to detect the expression level of Cas14a1( Figure 4 );

[0091] 10. The primers used are:

[0092] Table 2:

[0093] Primer Name Sequence qRT-Cas14-R1 caattcagcagcccttgtgt(SEQ ID NO: 18) qRT-Cas14-F1 tgctgttttctggcaggagat(SEQ ID NO: 19) qRT-ACT-R1 ggattccggcagcttccatt(SEQ ID NO: 20) qRT-ACT-F1 cctgaggtccttttccaacca(SEQ ID NO: 21)

[0094] 11. Select the single-copy transgenic lines with a relatively high expression level of Cas14a1 and a separation ratio of resistant to non-resistant plants of about 3:1 on the kanamycin resistance screening plate.

[0095] Example 4: Infection and Identification of Viruses

[0096] 1. Select single-copy transgenic lines with a relatively high expression level of Cas14a1, sow them on 1 / 2 MS medium containing 50 mg / L kanamycin. After 10 days, transplant the resistant seedlings into nutrient soil, continue to grow in a humidity box for about 15 days, and then place them under normal growth conditions to continue growing for about 10 days;

[0097] 2. Preparation of Agrobacterium tumefaciens carrying BSCTV. The pCAMBIA1300-BSCTV plasmid containing 1.7 copies of the BSCTV genome was transformed into Agrobacterium tumefaciens EHA105 by electroporation. This plasmid has been used and stored in our laboratory before. Select Agrobacterium monoclonal colonies with positive PCR results and inoculate them into LB medium containing kanamycin and rifampicin. After culturing at 28 °C for 16 hours, inoculate them into a new LB medium containing kanamycin and rifampicin at a ratio of 1:500 and culture at 28 °C for about 12 hours. Centrifuge to collect Agrobacterium and resuspend it with 10 mM MgCl2. Adjust the resuspended solution to an OD 600 of 0.2;

[0098] 3. Use a 1 mL syringe to inject the resuspended solution of Agrobacterium tumefaciens carrying BSCTV into the fourth or fifth true leaf of pZ-Cas14a1 transgenic tobacco to form an infection ring with a diameter of about 2 cm;

[0099] 4. Continue to culture for about 14 days. Obvious BSCTV infection symptoms can already be observed in wild-type control and empty vector control plants, including slow or stagnant plant growth, severe dwarfing, chlorosis and yellowing of new leaves, smaller size, and upward curling of the edges. Some transgenic plants containing the target binding sequence show no infection symptoms at all, and the infection symptoms of some are significantly weakened compared to the control ( Figure 5 );

[0100] 5. Take the shoot tip leaves of the above plants and store them at -80 °C;

[0101] 6. Use liquid nitrogen to grind and break the samples, add CTAB method to extract the DNA of the samples, and adjust the concentration of the DNA to 50 ng / μL;

[0102] 7. Use SuperReal PreMix Plus (SYBR Green) from Tiangen Biochemical Technology to perform fluorescence quantitative PCR to detect the accumulation amount of BSCTV;

[0103] 8. The primers used are as follows:

[0104] Table 3:

[0105] Primer Name Sequence qBSCTV-F cagggattttcgcacagaggaac(SEQ ID NO: 22) qBSCTV-R gattcggtaccaagtccacggg(SEQ ID NO: 23) qNbPPR-F ctcggccaagaagatcaaccatac(SEQ ID NO: 24) qNbPPR-R ggtgctttatgtggttgtagttatgc(SEQ ID NO: 25)

[0106] 9. The accumulation amount of BSCTV in the shoot tips of the above plants is as Figure 6 shown.

[0107] Example 5: Identification of Virus Mutation

[0108] 1. According to the experimental protocol in the reference (Ji, X., et al. Nature Plants 1, 15144 (2015)), tobacco transient injection was performed to examine the targeting and mutagenesis effects of Cas14a1 on BSCTV. The pZ-Cas14a1 control vector and the experimental vector containing the target sequence T1 or T2 were respectively transferred into Agrobacterium tumefaciens EHA105, and monoclonal colonies with correct PCR results were selected;

[0109] 2. The correct monoclonal colonies were inoculated into LB medium containing kanamycin and rifampicin, cultured at 28 °C for 16 hours, and then inoculated into a new LB medium containing kanamycin and rifampicin at a ratio of 1:500 and cultured at 28 °C for about 12 hours. The Agrobacterium tumefaciens was collected by centrifugation and resuspended with 10 mM MgCl2. The resuspended solution was adjusted to an OD 600 of 1.5. At the same time, the above Agrobacterium tumefaciens containing BSCTV was cultured and its concentration was adjusted to OD 600 = 0.2;

[0110] 3. Select wild-type Nicotiana benthamiana plants that have grown healthily for about 1 month for tobacco transient injection expression experiments. The Agrobacterium tumefaciens containing BSCTV was injected into the tip of the leaf, and the Agrobacterium tumefaciens containing Cas14a1 was injected into the petiole end of the leaf. At the same time, the left side of the leaf was the experimental group, injected with the Agrobacterium tumefaciens containing the Cas14a1 with the target sequence, and the right side was the control, the empty vector Agrobacterium tumefaciens of Cas14a1 without the target sequence. Make good marks. The BSCTV virus will replicate in the tobacco and move to the site where the Agrobacterium tumefaciens expressing Cas14a1 is injected, as Figure 7 described;

[0111] 4. Five days after injection and infection, the tobacco leaves at the site where Cas14a1 was injected were cut off (as marked by the dotted line in Figure 7 ) and stored at -80 °C;

[0112] 5. The samples were crushed using liquid nitrogen, and CTAB method was used to extract the DNA of the samples. The concentration of the DNA was adjusted to 50 ng / μL;

[0113] 6. The following primers were synthesized for the first round of PCR, and PCR amplification was performed using Toyobo's KOD FX Neo:

[0114] Table 4:

[0115] Primer Name Series BSCTV-1st-F taaccagtctggtagacagaccatcatttataag(SEQ ID NO: 26) BSCTV-1st-R aagtaattgggatctacgtcatcaatgacgttata(SEQ ID NO: 27)

[0116] 7. Synthesize the following primers and use the product of the first-round PCR as a template for the second-round PCR. Among them, F1 / R1 of T1 is a pair of primers for amplifying the BSCTV sequence near the T1 target sequence, and F2 / R2 is for amplifying the second plant. F1 / R1, F2 / R2, and F3 / R3 are used to amplify the post-infection plant samples with the added target sequence (experimental groups 1, 2, and 3 respectively); F4 / R4, F5 / R5, and F6 / R6 are used to amplify the post-infection plant samples of the empty vector control without the added target sequence (control groups 4, 5, and 6 respectively);

[0117] Table 5:

[0118]

[0119]

[0120] 8. After gel extraction of the PCR amplification products, second-generation sequencing was performed using the Illumina high-throughput sequencing platform NovaSeq 6000 at Novogene Co., Ltd.

[0121] 9. By analyzing the number of single nucleotide polymorphisms (SNPs, referring to DNA sequence polymorphisms caused by single nucleotide variations at the genomic level) in the data ( Figure 8 , Figure 9 ), it was found that compared with control groups 4, 5, and 6, the number of SNPs in experimental groups 1, 2, and 3 did not increase significantly, and no insertion-deletion markers (Indels, referring to the differences in the whole genome between the two parents) were generated in both the experimental groups and the control groups. This indicates that these generated SNPs are likely to be random mutations produced by the KOD FX Neo polymerase during the PCR process. This experiment shows that targeting the BSCTV genome by Cas14a1 does not lead to the mutation and evolution of BSCTV.

[0122] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: By using the CRISPR / Cas14a system to target and excise the single-stranded DNA of single-stranded DNA viruses, it avoids the virus evolution and escape caused by excising the double-stranded DNA of the virus, and improves the resistance of plants to single-stranded DNA viruses.

[0123] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> Peking University Institute of Modern Agriculture <120> Gene Editing System and Its Application <130> PN160749 <160> 51 <170> SIPOSequenceListing 1.0 <210> 1 <211> 157 <212> DNA <213> Candidatus Woesearchaeota archaeon <400> 1 ttcactgata aagtggagaa ccgcttcacc aaaagctgtc ccttagggga ttagaacttg 60 agtgaaggtg ggctgcttgc atcagcctaa tgtcgagaag tgctttcttc ggaaagtaac 120 cctcgaaaca aattcatttt tcctctccaa ttctgca 157 <210> 2 <211> 35 <212> DNA <213> Candidatus Woesearchaeota archaeon <400> 2 tgcagaaccc gaatagacga atgaaggaat gcaac 35 <210> 3 <211> 157 <212> RNA <213> Candidatus Woesearchaeota archaeon <400> 3 uucacugaua aaguggagaa ccgcuucacc aaaagcuguc ccuuagggga uuagaacuug 60 agugaaggug ggcugcuugc aucagccuaa ugucgagaag ugcuuucuuc ggaaaguaac 120 ccucgaaaca aauucauuuu uccucuccaa uucugca 157 <210> 4 <211> 35 <212> RNA <213> Candidatus Woesearchaeota archaeon <400> 4 ugcagaaccc gaauagacga augaaggaau gcaac 35 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(33) <223> Linker sequence <400> 5 gagggaggcg tagtccggca cgtcatatgg ata 33 <210> 6 <211> 1056 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (7)..(431) <223> AtU6 promoter <220> <221> misc_feature <222> (432)..(588) <223> tracrRNA-encoding gene <220> <221> misc_feature <222> (589)..(656) <223> HDV gene <220> <221> misc_feature <222> (657)..(689) <223> Linker sequence <220> <221> misc_feature <222> (690)..(731) <223> HH gene <220> <221> misc_feature <222> (732)..(766) <223> crRNA-encoding gene <220> <221> misc_feature <222> (767)..(792) <223> Target sequence 1 <220> <221> misc_feature <222> (793)..(860) <223> HDV gene <220> <221> misc_feature <222> (861)..(1051) <223> U6-26t terminator <400> 6 aagcttcgac ttgccttccg cacaatacat catttcttct tagctttttt tcttcttctt 60 cgttcataca gttttttttt gtttatcagc ttacattttc ttgaaccgta gctttcgttt 120 tcttcttttt aactttccat tcggagtttt tgtatcttgt ttcatagttt gtcccaggat 180 tagaatgatt aggcatcgaa ccttcaagaa tttgattgaa taaaacatct tcattcttaa 240 gatatgaaga taatcttcaa aaggcccctg ggaatctgaa agaagagaag caggcccatt 300 tatatgggaa agaacaatag tatttcttat ataggcccat ttaagttgaa aacaatcttc 360 aaaagtccca catcgcttag ataagaaaac gaagctgagt ttatatacag ctagagtcga 420 agtagtgatt gttcactgat aaagtggaga accgcttcac caaaagctgt cccttagggg 480 attagaactt gagtgaaggt gggctgcttg catcagccta atgtcgagaa gtgctttctt 540 cggaaagtaa ccctcgaaac aaattcattt ttcctctcca attctgcagg ccggcatggt 600 cccagcctcc tcgctggcgc cggctgggca acatgcttcg gcatggcgaa tgggacgagg 660 gaggcgtagt ccggcacgtc atatggatac tgcactgatg agtccgtgag gacgaaacga 720 gtaagctcgt ctgcagaacc cgaatagacg aatgaaggaa tgcaacgatg gaagatctgc 780 acgcggaggt cggccggcat ggtcccagcc tcctcgctgg cgccggctgg gcaacatgct 840 tcggcatggc gaatgggact ttttttgcaa aattttccag atcgatttct tcttcctctg 900 ttcttcggcg ttcaatttct ggggttttct cttcgttttc tgtaactgaa acctaaaatt 960 tgacctaaaa aaaatctcaa ataatatgat tcagtggttt tgtacttttc agttagttga 1020 gttttgcagt tccgatgaga taaaccaata aagctt 1056 <210> 7 <211> 1056 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (7)..(431) <223> AtU6 promoter <220> <221> misc_feature <222> (432)..(588) <223> tracrRNA-encoding gene <220> <221> misc_feature <222> (589)..(656) <223> HDV gene <220> <221> misc_feature <222> (657)..(689) <223> Linker sequence <220> <221> misc_feature <222> (690)..(731) <223> HH gene <220> <221> misc_feature <222> (732)..(766) <223> crRNA-encoding gene <220> <221> misc_feature <222> (767)..(792) <223> Target sequence <220> <221> misc_feature <222> (793)..(860) <223> HDV gene <220> <221> misc_feature <222> (861)..(1051) <223> U6-25t terminator <400> 7 aagcttcgac ttgccttccg cacaatacat catttcttct tagctttttt tcttcttctt 60 cgttcataca gttttttttt gtttatcagc ttacattttc ttgaaccgta gctttcgttt 120 tcttcttttt aactttccat tcggagtttt tgtatcttgt ttcatagttt gtcccaggat 180 tagaatgatt aggcatcgaa ccttcaagaa tttgattgaa taaaacatct tcattcttaa 240 gatatgaaga taatcttcaa aaggcccctg ggaatctgaa agaagagaag caggcccatt 300 tatatgggaa agaacaatag tatttcttat ataggcccat ttaagttgaa aacaatcttc 360 aaaagtccca catcgcttag ataagaaaac gaagctgagt ttatatacag ctagagtcga 420 agtagtgatt gttcactgat aaagtggaga accgcttcac caaaagctgt cccttagggg 480 attagaactt gagtgaaggt gggctgcttg catcagccta atgtcgagaa gtgctttctt 540 cggaaagtaa ccctcgaaac aaattcattt ttcctctcca attctgcagg ccggcatggt 600 cccagcctcc tcgctggcgc cggctgggca acatgcttcg gcatggcgaa tgggacgagg 660 gaggcgtagt ccggcacgtc atatggatac tgcactgatg agtccgtgag gacgaaacga 720 gtaagctcgt ctgcagaacc cgaatagacg aatgaaggaa tgcaacaagt accagcaaac 780 aattccactg cggccggcat ggtcccagcc tcctcgctgg cgccggctgg gcaacatgct 840 tcggcatggc gaatgggact ttttttgcaa aattttccag atcgatttct tcttcctctg 900 ttcttcggcg ttcaatttct ggggttttct cttcgttttc tgtaactgaa acctaaaatt 960 tgacctaaaa aaaatctcaa ataatatgat tcagtggttt tgtacttttc agttagttga 1020 gttttgcagt tccgatgaga taaaccaata aagctt 1056 <210> 8 <211> 536 <212> PRT <213> Candidatus Woesearchaeota archaeon <400> 8 Gly Ile His Gly Val Pro Ala Ala Ala Lys Asn Thr Ile Thr Lys Thr 1 5 10 15 Leu Lys Leu Arg Ile Val Arg Pro Tyr Asn Ser Ala Glu Val Glu Lys 20 25 30 Ile Val Ala Asp Glu Lys Asn Asn Arg Glu Lys Ile Ala Leu Glu Lys 35 40 45 Asn Lys Asp Lys Val Lys Glu Ala Cys Ser Lys His Leu Lys Val Ala 50 55 60 Ala Tyr Cys Thr Thr Gln Val Glu Arg Asn Ala Cys Leu Phe Cys Lys 65 70 75 80 Ala Arg Lys Leu Asp Asp Lys Phe Tyr Gln Lys Leu Arg Gly Gln Phe 85 90 95 Pro Asp Ala Val Phe Trp Gln Glu Ile Ser Glu Ile Phe Arg Gln Leu 100 105 110 Gln Lys Gln Ala Ala Glu Ile Tyr Asn Gln Ser Leu Ile Glu Leu Tyr 115 120 125 Tyr Glu Ile Phe Ile Lys Gly Lys Gly Ile Ala Asn Ala Ser Ser Val 130 135 140 Glu His Tyr Leu Ser Asp Val Cys Tyr Thr Arg Ala Ala Glu Leu Phe 145 150 155 160 Lys Asn Ala Ala Ile Ala Ser Gly Leu Arg Ser Lys Ile Lys Ser Asn 165 170 175 Phe Arg Leu Lys Glu Leu Lys Asn Met Lys Ser Gly Leu Pro Thr Thr 180 185 190 Lys Ser Asp Asn Phe Pro Ile Pro Leu Val Lys Gln Lys Gly Gly Gln 195 200 205 Tyr Thr Gly Phe Glu Ile Ser Asn His Asn Ser Asp Phe Ile Ile Lys 210 215 220 Ile Pro Phe Gly Arg Trp Gln Val Lys Lys Glu Ile Asp Lys Tyr Arg 225 230 235 240 Pro Trp Glu Lys Phe Asp Phe Glu Gln Val Gln Lys Ser Pro Lys Pro 245 250 255 Ile Ser Leu Leu Leu Ser Thr Gln Arg Arg Lys Arg Asn Lys Gly Trp 260 265 270 Ser Lys Asp Glu Gly Thr Glu Ala Glu Ile Lys Lys Val Met Asn Gly 275 280 285 Asp Tyr Gln Thr Ser Tyr Ile Glu Val Lys Arg Gly Ser Lys Ile Cys 290 295 300 Glu Lys Ser Ala Trp Met Leu Asn Leu Ser Ile Asp Val Pro Lys Ile 305 310 315 320 Asp Lys Gly Val Asp Pro Ser Ile Ile Gly Gly Ile Asp Val Gly Val 325 330 335 Lys Ser Pro Leu Val Cys Ala Ile Asn Asn Ala Phe Ser Arg Tyr Ser 340 345 350 Ile Ser Asp Asn Asp Leu Phe His Phe Asn Lys Lys Met Phe Ala Arg 355 360 365 Arg Arg Ile Leu Leu Lys Lys Asn Arg His Lys Arg Ala Gly His Gly 370 375 380 Ala Lys Asn Lys Leu Lys Pro Ile Thr Ile Leu Thr Glu Lys Ser Glu 385 390 395 400 Arg Phe Arg Lys Lys Leu Ile Glu Arg Trp Ala Cys Glu Ile Ala Asp 405 410 415 Phe Phe Ile Lys Asn Lys Val Gly Thr Val Gln Met Glu Asn Leu Glu 420 425 430 Ser Met Lys Arg Lys Glu Asp Ser Tyr Phe Asn Ile Arg Leu Arg Gly 435 440 445 Phe Trp Pro Tyr Ala Glu Met Gln Asn Lys Ile Glu Phe Lys Leu Lys 450 455 460 Gln Tyr Gly Ile Glu Ile Arg Lys Val Ala Pro Asn Asn Thr Ser Lys 465 470 475 480 Thr Cys Ser Lys Cys Gly His Leu Asn Asn Tyr Phe Asn Phe Glu Tyr 485 490 495 Arg Lys Lys Asn Lys Phe Pro His Phe Lys Cys Glu Lys Cys Asn Phe 500 505 510 Lys Glu Asn Ala Asp Tyr Asn Ala Ala Leu Asn Ile Ser Asn Pro Lys 515 520 525 Leu Lys Ser Thr Lys Glu Glu Pro 530 535 <210> 9 <211> 1608 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(1608) <223> Codon-optimized Cas14a1 gene for Nicotiana benthamiana <400> 9 ggcatccacg gggtgccagc tgctgccaaa aacaccatta ccaaaacact gaaactgcgt 60 attgtgcgtc cgtataatag cgcagaagtg gaaaaaattg ttgccgacga aaaaaacaac 120 cgcgaaaaaa tcgcactgga aaagaacaaa gacaaagtga aagaagcctg cagcaaacat 180 ctgaaagttg cagcatattg taccacacag gttgaacgta atgcatgcct gttttgtaaa 240 gcacgtaaac tggatgacaa attctaccaa aaactgcgtg gtcagtttcc ggatgcagtt 300 ttttggcaag aaatcagcga aatttttcgc cagctgcaga aacaggcagc agaaatctat 360 aatcagagcc tgatcgaact gtactacgag atttttatca aaggcaaagg tattgcaaat 420 gccagcagcg ttgaacatta tctgagtgat gtttgttata cccgtgcagc agaactgttt 480 aaaaacgcag caattgcaag cggtctgcgt agcaaaatca aaagcaattt tcgtctgaaa 540 gaactgaaaa acatgaaaag tggtctgccg accaccaaaa gcgataattt tccgattccg 600 ctggttaaac agaaaggtgg tcagtatacc ggttttgaaa ttagcaatca taatagcgac 660 ttcatcatca agattccgtt tggtcgttgg caggtcaaaa aagagattga taaatatcgt 720 ccgtgggaga aatttgactt tgaacaggtt cagaaaagcc cgaaaccgat tagcctgctg 780 ctgagcaccc agcgtcgtaa acgtaataaa ggttggagca aagatgaagg caccgaagcc 840 gaaatcaaaa aagttatgaa tggcgattat cagaccagct acattgaagt taaacgtggc 900 agcaaaatct gtgaaaaaag cgcatggatg ctgaatctga gcattgatgt tccgaaaatt 960 gataaaggtg tggatccgag cattattggt ggtattgatg ttggtgttaa atcaccgctg 1020 gtttgcgcaa ttaacaatgc atttagccgt tatagcatca gcgataacga cctgtttcac 1080 ttcaacaaga aaatgtttgc acgtcgtcgt atcctgctga aaaaaaaccg tcataaacgt 1140 gcaggtcatg gtgcaaaaaa caaactgaaa ccgatcacca ttctgaccga aaaaagtgaa 1200 cgttttcgca aaaagctgat tgaacgttgg gcatgtgaaa tcgcggattt cttcattaaa 1260 aacaaagttg gcaccgtgca gatggaaaat ctggaaagca tgaaacgtaa agaggacagc 1320 tattttaaca ttcgcctgcg tggcttttgg ccgtatgcag aaatgcagaa caaaatcgaa 1380 ttcaaactga agcagtatgg catcgaaatt cgtaaagttg caccgaataa taccagcaaa 1440 acctgtagca aatgtggcca tctgaacaac tatttcaact tcgagtaccg caagaaaaac 1500 aaattcccgc actttaaatg cgaaaaatgc aacttcaaag aaaacgccga ttataatgca 1560 gccctgaata tttcaaaccc gaaactgaaa agcaccaaag aggaaccg 1608 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(25) <223> Target sequence T1 <400> 10 gacctccgcg tgcagatctt ccatc 25 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(29) <223> PCR amplification target sequence T1 F-end primer <400> 11 caacgatgga agatctgcac gcggaggtc 29 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(29) <223> PCR amplification target sequence T1 R-end primer <400> 12 ggccgacctc cgcgtgcaga tcttccatc 29 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(25) <223> Target sequence T2 <400> 13 gcagtggaat tgtttgctgg tactt 25 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(29) <223> PCR amplification target sequence T2 F-end primer <400> 14 caacaagtac cagcaaacaa ttccactgc 29 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(29) <223> PCR amplification target sequence T2 R-end primer <400> 15 ggccgcagtg gaattgtttg ctggtactt 29 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(18) <223> M13 F-end sequencing primer <400> 16 tgtaaaacga cggccagt 18 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(20) <223> U6 sequencing primer <400> 17 acaatcttca aaagtcccac 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(20) <223> Fluorescent quantitative PCR R-end primer <400> 18 caattcagca gcccttgtgt 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(21) <223> Fluorescent quantitative PCR F-end primer <400> 19 tgctgttttc tggcaggaga t 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(20) <223> Fluorescent quantitative PCR R-end primer <400> 20 ggattccggc agcttccatt 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(21) <223> Fluorescent quantitative PCR F-end primer <400> 21 cctgaggtcc ttttccaacc a 21 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(23) <223> Fluorescent quantitative PCR F-end primer <400> 22 cagggatttt cgcacagagg aac 23 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <221> allele <222> (1)..(22) <223> Fluorescent quantitative PCR R-end primer <400> 23 gattcggtac caagtccacg gg 22 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(24) <223> Fluorescent quantitative PCR F-end primer <400> 24 ctcggccaag aagatcaacc atac 24 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> Fluorescent quantitative PCR R-end primer <400> 25 ggtgctttat gtggttgtag ttatgc 26 <210> 26 <211> 34 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(34) <223> BSCTV sequence PCR amplification F-end primer <400> 26 taaccagtct ggtagacaga ccatcattta taag 34 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(35) <223> BSCTV sequence PCR amplification R-end primer <400> 27 aagtaattgg gatctacgtc atcaatgacg ttata 35 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F-end primer of BSCTV sequence near the target sequence of the first plant T1 <400> 28 tgaccaattc agggagctaa atccag 26 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the first plant T1 <400> 29 atgagcttct gggagtttct ccctta 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F primer of BSCTV sequence near the target sequence of the first plant T2 <400> 30 acagtggaga attacatgaa aatggg 26 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the first plant T2 <400> 31 attcctgacc tgaaattcac cccagt 26 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> F - primer for PCR amplification of BSCTV sequence near the T1 target sequence of the second plant <400> 32 atcacgattc agggagctaa atccag 26 <210> 33 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> R - primer for PCR amplification of BSCTV sequence near the T1 target sequence of the second plant <400> 33 cacgatttct gggagtttct ccctta 26 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> F - primer for PCR amplification of BSCTV sequence near the T2 target sequence of the second plant <400> 34 ttaggcgaga attacatgaa aatggg 26 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> R - primer for PCR amplification of BSCTV sequence near the T2 target sequence of the second plant <400> 35 cactcagacc tgaaattcac cccagt 26 <210> 36 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> Forward primer for PCR amplification of BSCTV sequence near the target sequence of the third plant T1 <400> 36 ggctacattc agggagctaa atccag 26 <210> 37 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> Reverse primer for PCR amplification of BSCTV sequence near the target sequence of the third plant T1 <400> 37 ccaacattct gggagtttct ccctta 26 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> Forward primer for PCR amplification of BSCTV sequence near the target sequence of the third plant T2 <400> 38 agtcaagaga attacatgaa aatggg 26 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer for BSCTV sequence near the target sequence of the third plant T2 <400> 39 cggaatgacc tgaaattcac cccagt 26 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F primer for BSCTV sequence near the target sequence of the fourth plant T1 <400> 40 gtagagattc agggagctaa atccag 26 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer for BSCTV sequence near the target sequence of the fourth plant T1 <400> 41 gcgctattct gggagtttct ccctta 26 <210> 42 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F primer for BSCTV sequence near the target sequence of the fourth plant T2 <400> 42 gtccgcgaga attacatgaa aatggg 26 <210> 43 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the fourth plant T2 <400> 43 taatcggacc tgaaattcac cccagt 26 <210> 44 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F primer of BSCTV sequence near the target sequence of the fifth plant T1 <400> 44 cgtacgattc agggagctaa atccag 26 <210> 45 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the fifth plant T1 <400> 45 tcccgattct gggagtttct ccctta 26 <210> 46 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> F - end primer for PCR amplification of BSCTV sequence near the target sequence of the fifth plant T2 <400> 46 gagtgggaga attacatgaa aatggg 26 <210> 47 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> R - end primer for PCR amplification of BSCTV sequence near the target sequence of the fifth plant T2 <400> 47 tcgaaggacc tgaaattcac cccagt 26 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> F - end primer for PCR amplification of BSCTV sequence near the target sequence of the sixth plant T1 <400> 48 caccggattc agggagctaa atccag 26 <210> 49 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the sixth plant T1 <400> 49 atcacgttct gggagtttct ccctta 26 <210> 50 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification F primer of BSCTV sequence near the target sequence of the sixth plant T2 <400> 50 cacgatgaga attacatgaa aatggg 26 <210> 51 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (1)..(26) <223> PCR amplification R primer of BSCTV sequence near the target sequence of the sixth plant T2 <400> 51 ttaggcgacc tgaaattcac cccagt 26

Claims

1. Use of a gene editing system, or a recombinant vector containing a nucleic acid sequence encoding the Cas14a protein in the gene editing system and a nucleic acid sequence encoding a guide RNA, or a kit containing the gene editing system or the recombinant vector, or a host cell transformed with the recombinant vector in enhancing the resistance of plants to single-stranded DNA viruses or cultivating transgenic plants with enhanced resistance to single-stranded DNA viruses; The single-stranded DNA virus is a geminivirus; the gene editing system includes a Cas14a protein and a guide RNA; The guide RNA includes a tracrRNA, a crRNA, and a target-binding sequence; The crRNA and the target-binding sequence are on the same strand and the target-binding sequence is at the 3'-end of the crRNA; the crRNA has a secondary structure with partial base complementarity to the tracrRNA; The gene coding sequence of the target-binding sequence is denoted as the target sequence; The target sequence is selected from the nucleotide sequences shown in SEQ ID NO: 10 or SEQ ID NO:

13.

2. The application according to claim 1, wherein The Cas14a protein includes a Cas14a1 protein.

3. The application according to claim 2, wherein The Cas14a1 protein is the amino acid sequence shown in SEQ ID NO:

8.

4. The application according to claim 2, wherein The gene encoding the Cas14a1 protein is a gene codon-optimized according to plant codon preferences.

5. The application according to claim 1, wherein The Cas14a protein further includes a protein tag, and the protein tag is located at the N-terminus and / or C-terminus of the Cas14a protein.

6. The application according to claim 5, wherein The protein tag includes one or more of the following protein tags: Flag, His6, HA, Myc, GFP, or YFP.

7. The application according to claim 1, characterized in that, The Cas14a protein further includes a nuclear localization signal, and the nuclear localization signal is located at the N-terminus and / or C-terminus of the Cas14a protein.

8. The application according to claim 1, wherein The tracrRNA is the nucleotide sequence shown in SEQ ID NO:

3.

9. The application according to claim 1, characterized in that, The crRNA is the nucleotide sequence shown in SEQ ID NO:

4.

10. The application according to claim 1, wherein The recombinant vector is one or more.

11. The application according to claim 10, characterized in that, When the recombinant vector is one, the nucleic acid sequence encoding the Cas14a protein in the gene editing system and the nucleic acid sequence encoding the guide RNA are ligated to the same recombinant vector.

12. The application according to claim 2, wherein The gene encoding the Cas14a1 protein is the nucleotide sequence shown in SEQ ID NO:

9.

13. The application according to claim 1, characterized in that, The gene encoding the tracrRNA is the nucleotide sequence shown in SEQ ID NO:

1.

14. The application according to claim 1, characterized in that, The gene encoding the crRNA is the nucleotide sequence shown in SEQ ID NO:

2.

15. The application according to claim 10, wherein The recombinant vector further includes a nucleic acid sequence encoding a self-splicing enzyme.

16. The application according to claim 15, wherein The self-splicing enzyme includes a hammerhead ribozyme or a hepatitis delta virus ribozyme.

17. The application according to claim 16, characterized in that, The nucleic acid sequence encoding the hammerhead ribozyme or the hepatitis delta virus ribozyme is independently disposed between the sequence encoding the crRNA gene and the sequence encoding the tracrRNA gene to separate the crRNA gene and the tracrRNA gene.

18. The application according to claim 17, wherein The gene encoding the guide RNA further includes a linker sequence, which is located between the nucleic acid sequences encoding the hammerhead ribozyme and the hepatitis delta virus ribozyme.

19. The application according to claim 18, characterized in that, The linker sequence is the nucleotide sequence shown in SEQ ID NO:

5.

20. The application according to claim 1, wherein The gene editing system further includes a promoter, which is located upstream or downstream of the gene encoding the tracrRNA and / or the gene encoding the crRNA.

21. The application according to claim 20, characterized in that, The promoter includes one or more of the following promoters: constitutive, enhanced, tissue-specific, and inducible.

22. The application according to claim 21, wherein The promoter includes one or more of the following promoters: the tobacco mosaic virus 35S promoter, the Arabidopsis thaliana U6 promoter, or the Arabidopsis thaliana Actin1 promoter.

23. The application according to claim 1, characterized in that, The gene encoding the guide RNA is the nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO:

7.

24. The application according to claim 1, wherein The kit includes the gene editing system or the recombinant vector.

25. The application according to claim 1, characterized in that, The host cell is transformed with the recombinant vector.

26. The application according to claim 25, wherein The host cell includes Escherichia coli or Agrobacterium tumefaciens.

27. The application according to claim 26, wherein The Escherichia coli includes XL1-blue.

28. The application according to claim 26, characterized in that, The Agrobacterium tumefaciens includes GV3101.

Citation Information

Patent Citations

  • Method for activating Cas14a enzyme supplementary cleavage effect by RNA

    CN111363763A