Pullulanase mutant with improved stability and construction method thereof

Abstract

The present invention discloses a pullulanase mutant with improved stability and a method for constructing the same, belonging to the fields of genetic engineering and enzyme engineering. Based on the pullulanase derived from Bacillus naganoensis with high enzyme activity, two single-point mutants D147F and G690M with improved thermal stability and a combined mutant D147F / G690M were screened. Moreover, while the thermal stability of the mutants is significantly improved, the enzyme activity is not affected. These mutants in the present invention are more suitable for industrial production than natural pullulanase and have great application prospects and industrial value.

Description

Technical Field

[0001] The present invention relates to a pullulanase mutant with improved stability and a method for constructing the same, belonging to the technical fields of genetic engineering and enzyme engineering. Background Art

[0002] Isomaltooligosaccharides (IMOs) are a class of functional oligosaccharides composed of 2 - 10 glucose units linked by α-1,6-glycosidic bonds, including main functional components such as isomaltose, panose, and isomaltotriose. IMOs can promote the proliferation of probiotics such as Bifidobacterium and Lactobacillus in the human intestine, regulate the intestinal flora; have low calorie values, promote gastrointestinal peristalsis, improve constipation and lipid metabolism, and prevent dental caries. Therefore, IMOs are widely used as probiotics, food additives, and feed ingredients.

[0003] Pullulanase (EC 3.2.1.41) is one of the starch debranching enzymes, which can specifically hydrolyze the α-1,6-glycosidic bonds at the starch branch points, release amylose, and is beneficial to the starch saccharification by glucoamylase and glucose production, thus significantly improving the starch saccharification efficiency and the conversion rate of starch to glucose. It is an important and indispensable auxiliary enzyme in the starch sugar industry. Since the 1980s, foreign scholars have successively discovered and analyzed pullulanases from various sources. However, so far, in the starch sugar industry, only type I pullulanase shows good effects when compounded or combined with glucoamylase. Among them, pullulanase (PulA) from Bacillus naganoensis has high catalytic activity and has practical industrial application value.

[0004] Currently, IMOs are generally produced by an enzymatic conversion method, which is catalyzed from starch using α-amylase, β-amylase, pullulanase, and glucosidase. Its typical production process usually includes three steps: the first is liquefaction, in which starch is liquefied by thermostable α-amylase to produce oligosaccharides and dextrins; the second is saccharification, and the oligosaccharides and dextrins are saccharified by saccharifying enzymes such as β-amylase and pullulanase; the third is transglycosylation, and α-glucosidase (EC 3.2.1.20) can catalyze the release of glucose from the non-reducing end of the substrate and transfer the glucose residue to the 6-OH group of the non-reducing glucose unit to produce IMOs.

[0005] Most studies only improve the thermal stability of enzymes through immobilized enzymes or cell surface display, but their thermal stability is still not satisfactory in industrial applications. Therefore, the research on molecular modification of pullulanase to improve its thermal stability will be the research focus of the present invention. Summary of the Invention

[0006] To solve the problem of the low thermal stability of pullulanase at present, the present invention provides a pullulanase mutant, which is obtained by mutating the 147th and / or 690th amino acids of pullulanase with the amino acid sequence shown in SEQ ID NO.1.

[0007] In one embodiment, the mutant is obtained by mutating the aspartic acid at the 147th position of pullulanase with the amino acid sequence shown in SEQ ID NO.1 into phenylalanine, and is named: D147F, and its amino acid sequence is shown in SEQ ID NO.2.

[0008] In one embodiment, the mutant is obtained by mutating the glycine at the 690th position of pullulanase with the amino acid sequence shown in SEQ ID NO.1 into methionine, and is named: G690M, and its amino acid sequence is shown in SEQ ID NO.3.

[0009] In one embodiment, the mutant is obtained by mutating the aspartic acid at the 147th position of pullulanase with the amino acid sequence shown in SEQ ID NO.1 into phenylalanine, and mutating the glycine at the 690th position into methionine, and is named:

[0010] D147F / G690M, and its amino acid sequence is shown in SEQ ID NO.4.

[0011] The present invention also provides a method for preparing any one of the above-mentioned mutants, including the following steps:

[0012] (1) Using the nucleotide sequence shown in SEQ ID NO.5 as a template, designing site-directed mutagenesis primers, performing PCR amplification to obtain a gene containing the mutation site, and ligating the gene with a vector to construct a recombinant expression vector;

[0013] (2) Transforming the recombinant expression vector constructed in step (1) into a host cell.

[0014] The present invention also provides a gene encoding the mutant.

[0015] In one embodiment, the gene contains the nucleotide sequences shown in SEQ ID NO.6-8.

[0016] The present invention also provides a recombinant vector carrying the gene.

[0017] In one embodiment of the present invention, the recombinant vector uses the pET-28a(+) vector as an expression vector.

[0018] The present invention also provides a recombinant microbial cell carrying the gene or containing the recombinant vector.

[0019] In one embodiment, the recombinant microbial cell uses Escherichia coli as the expression host.

[0020] The present invention also provides a genetically engineered bacterium that uses Escherichia coli as the host and expresses the pullulanase mutant.

[0021] In one embodiment, the genetically engineered bacterium uses Escherichia coli BL21(DE3) as the expression host.

[0022] In one embodiment, the genetically engineered bacterium uses the pET-28a(+) vector as the expression host.

[0023] The present invention provides a method for improving the thermal stability of pullulanase, which is to mutate the amino acids at positions D147 and / or 690 of the pullulanase with the amino acid sequence shown in SEQ ID NO.1.

[0024] The present invention also provides the application of the above-mentioned pullulanase mutant, or the gene encoding the above-mentioned mutant, or the above-mentioned recombinant vector, or the above-mentioned recombinant cell in the production of isomaltooligosaccharides by converting starch.

[0025] Beneficial effects:

[0026] (1) Based on natural pullulanase, the present invention rationally designs and combines site-directed mutagenesis biotechnology to modify the molecular structure of pullulanase, analyzes the influence of the mutated residues on the thermal stability of the enzyme, and finally obtains two single-point mutant strains D147F and G690M with improved stability.

[0027] (2) The half-life of the pullulanase mutant D147F provided by the present invention reaches 3.7 h at 55 °C. Compared with the natural pullulanase (half-life of 2.5 h), the half-life is 1.48 times that of the natural pullulanase; the half-life of the pullulanase mutant G690M reaches 5.1 h at 55 °C, which is 2.04 times the half-life of the natural pullulanase; the half-life of D147F / G690M reaches 6 h at 55 °C, which is 2.4 times the half-life of the natural pullulanase.

[0028] (3) While the thermal stability of the pullulanase mutant provided by the present invention is significantly improved, the activity of the enzyme does not decrease significantly. Among them, after the mutant D147F is heat-treated at 55 °C for 2 h with the enzyme catalytic activity remaining basically unchanged, the mutant D147F, G690M, and the combined mutant D147F / G690M retain 80.5%, 83.2%, and 91.2% of the relative enzyme activity respectively, while the control group retains 55.7% of the relative enzyme activity.

[0029] (4) The pullulanase mutant obtained in the present invention is more suitable for the application of catalyzing starch hydrolysis than the wild type, which is more conducive to the flexibility of the production process. Description of the Drawings

[0030] Figure 1 SDS-PAGE analysis of the pure enzyme solutions of wild-type pullulanase and pullulanase mutants; wherein: M, protein maker; 1, pure enzyme solution of wild-type pulA; 2-8 are respectively: pure enzyme solutions containing S17E, D147F, P207W, G670R, G690M, T696F, D147F / G690M.

[0031] Figure 2 Residual activities of wild-type pullulanase and its mutants after incubation at 55 °C and pH 5.0 for 2 h.

[0032] Figure 3 Half-life of wild-type pullulanase and pullulanase mutants D147F, G690M, D147F / G690M at 55 °C.

[0033] Figure 4 Effect of pH on the enzyme activities of wild-type pullulanase and pullulanase mutants D147F, G690M, D147F / G690M.

[0034] Figure 5 Effect of temperature on the enzyme activities of wild-type pullulanase and pullulanase mutants D147F, G690M, D147F / G690M. Detailed Embodiments

[0035] The pET-28a(+) vector involved in the following examples was purchased from Invitrogen.

[0036] The culture media involved in the following examples are as follows:

[0037] (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0038] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0039] The detection methods involved in the following examples are as follows:

[0040] The enzyme activity of pullulanase was determined by the DNS method. In the experimental group, 200 μL of 2% (w / v) pullulan polysaccharide solution was mixed with 200 μL of enzyme solution and reacted at 55 °C for 20 min, and then immediately placed in an ice-water bath for 5 min to terminate the reaction. The control group was incubated at 55 °C for 20 min and then supplemented with 200 μL of 2% (w / v) pullulan polysaccharide solution. After cooling, 600 μL of DNS reagent was added to both the experimental group and the control group, and boiled in a boiling water bath for 5 min. After cooling in an ice-water bath, the corresponding absorbance was measured at 540 nm.

[0041] Enzyme activity definition: Under the reaction conditions of 55 °C and pH 5.0, when 1 mL of enzyme solution reacts to produce glucose equivalent to 1 μmol per 1 min, it is defined as 1 enzyme activity unit.

[0042] Specific enzyme activity: It is defined as the enzyme activity U / ml per unit protein.

[0043] Example 1: Construction of recombinant plasmids containing pullulanase mutants

[0044] (1) Construction of recombinant plasmids containing wild-type pullulanase

[0045] The wild-type pullulanase gene pulA with the nucleotide sequence shown in SEQ ID NO.1 was chemically synthesized, digested with NdeⅠ and MluⅠ enzymes and ligated with the pET-28a(+) vector to prepare the recombinant vector pET-28a(+)-pulA.

[0046] (2) Obtaining recombinant vectors containing mutants:

[0047] Using the whole plasmid PCR technique, the recombinant vector pET-28a(+)-pulA prepared in step (1) was used as a template for site-directed mutagenesis to obtain recombinant plasmids pET-28a(+)-S17E, pET-28a(+)-D147F, pET-28a(+)-P207W, pET-28a(+)-G670R, pET-28a(+)-G690M, pET-28a(+)-T696F, pET-28a(+)-D147F / G690M containing mutant genes.

[0048] The designed primer sequences are as follows:

[0049] S17E-F: GTTCTGGCCCCGAAGGAACTGGGCTTTGAC;

[0050] S17E-R: GTCAAAGCCCAGTTCCTTCGGGGCCAGAAC;

[0051] D147F-F: GTGCATCCGCACTTATTTGAGATCCGCTGTG;

[0052] D147F-R: ACACAGCGGATCTCAAATAAGTGCGGATGC;

[0053] P207W-F: AAGCTGGCACCTTGGAGTCTGCCGCTGCCG;

[0054] P207W-R: CGGCAGCGGCAGACTCCAAGGTGCCAGCTT;

[0055] G670R-F: GACGGTCAGCGCCGTGGTACAACACCGTTTG;

[0056] G670R-R: ACGGTGTTGTACCACGGCGCTGACCGTCAC;

[0057] G690M-F: CGGTCAGCGCTGCATGACAACACCGTTTGGC;

[0058] G690M-R: GCCAAACGGTGTTGTCATGCAGCGCTGACCG;

[0059] T696F-F: GCGCTGCGGTACATTTCCGTTTGGCCAAG;

[0060] T696F-R: CTTGGCCAAACGGAAATGTACCGCAGCGC.

[0061] Among them, the PCR amplification program is set as follows: First, pre-denature at 95°C for 5 min; then enter 30 cycles; denature at 95°C for 30 s, anneal at 72°C for 30 s, extend at 58°C for 3.5 min, and hold at 4°C. The PCR products are detected by 0.8% agarose gel electrophoresis.

[0062] The final amplified fragment was treated with Dpn I enzyme in a 37 °C water bath for 1 h to remove the template. Then, the PCR mixture was chemically transformed into E. coli JM109 competent cells. The transformation solution was spread on an LB solid medium containing kanamycin (50 μg / mL). The plasmid was extracted and sequenced, and the sequencing work was completed by Genewiz Suzhou. The plasmids verified to be correct were named pET-28a(+)-pulA, pET-28a(+)-S17E, pET-28a(+)-D147F, pET-28a(+)-P207W, pET-28a(+)-G670R, pET-28a(+)-G690M, pET-28a(+)-T696F, and pET-28a(+)-D147F / G690M, respectively.

[0063] Example 2: Construction of recombinant Escherichia coli producing pullulanase mutants

[0064] The recombinant plasmids pET-28a(+)-pulA, pET-28a(+)-S17E, pET-28a(+)-D147F, pET-28a(+)-P207W, pET-28a(+)-G670R, pET-28a(+)-G690M, pET-28a(+)-T696F, and pET-28a(+)-D147F / G690M obtained in Example 1 were respectively transformed into E. coli BL21 competent cells, and the genetically engineered bacteria E. coli BL21 / pET-28a(+)-pulA, E. coli BL21 / pET-28a(+)-S17E, E. coli BL21 / pET-28a(+)-D147F, E. coli BL21 / pET-28a(+)-P207W, E. coli BL21 / pET-28a(+)-G670R, E. coli BL21 / pET-28a(+)-G690M, E. coli BL21 / pET-28a(+)-T696F, and E. coli BL21 / pET-28a(+)-D147F / G690M were respectively prepared.

[0065] Example 3: Expression of pullulanase mutants

[0066] The genetically engineered bacteria constructed in Example 2 were respectively inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate and cultured overnight at 37 °C and 200 rpm to prepare seed solutions.

[0067] The prepared seed liquid was transferred to 100 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate at an inoculation amount of 2% (v / v), and cultured continuously at 30 °C for 20 h to obtain a fermentation broth. The prepared fermentation broth was centrifuged at 8000×g and 4 °C for 5 min to obtain cell pellets, and after washing the cells 3 times, they were resuspended in 10 mL of sodium hydrogen phosphate - sodium dihydrogen phosphate buffer (pH 7.0).

[0068] The resuspended cells were treated with an ultrasonic disruptor in an ice bath for 30 min and then centrifuged for 30 min (8000×g, 4 °C), and the supernatant was removed to obtain a crude enzyme solution;

[0069] The supernatant was filtered through a 0.22-μm filter and then further loaded onto a 1 mL Ni affinity column, which was pre-equilibrated with 50 mM washing buffer (20 mM Tris and 500 mM NaCl, pH 7.4), and then the unbound proteins and pullulanase were eluted with an elution buffer (20 mM Tris, 500 mM NaCl and 500 mM imidazole, pH 7.4) using a linear gradient; pure enzyme solutions of wild-type pullulanase, mutant S17E, mutant D147F, mutant P207W, mutant G670R, mutant G690M, mutant T696F, and mutant D147F / G690M were respectively prepared;

[0070] The above pure enzyme solutions were respectively analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The results are as Figure 1 shown. The results showed that there was an obvious band at 63 kDa, proving the expression of pullulanase.

[0071] To test the effect of single-point mutations on thermal stability, a thermal stability experiment was carried out on the prepared pure enzyme. After incubating the pure enzyme prepared in step (2) in a 55 °C water bath for 2 h, 1 mL was taken, and the residual enzyme activity of the remaining enzyme was measured according to the method for measuring pullulanase enzyme activity. The enzyme activity of the pure enzyme solution without high-temperature treatment was used as a blank control to obtain the percentage of residual enzyme activity, and the results of the enzyme activity changes of the relevant wild-type protein and mutants are Figure 2 shown.

[0072] The results showed that mutants D147F and G690M and the combined mutant D147F / G690M retained 80.5%, 83.2% and 91.2% of the relative enzyme activity respectively, while the control group only retained 15.7% of the relative enzyme activity; the relative enzyme activities of other mutants were all below 15%.

[0073] The specific enzyme activities of wild-type pullulanase, mutant D147F, mutant G690M, and combined mutant D147F / G690M were detected respectively, and the results are shown in Table 1:

[0074] Table 1 Specific enzyme activities of different pullulanases

[0075]

[0076] Example 4: Enzymatic properties of pullulanase mutants

[0077] 1. Thermal stability

[0078] The pure enzyme solutions of wild-type pullulanase, mutant D147F, mutant G690M, and mutant D147F / G690M prepared in Example 3 were taken respectively and placed in a 55 °C constant temperature water bath. Samples were taken every once in a while, and the residual enzyme activity was measured according to the pullulanase activity measurement method. Their thermal stabilities were compared, and the half-life results of wild-type pullulanase and its mutants are shown in Table 2 and Figure 3 as follows. The half-life of mutant D147F / G690M at 55 °C can reach 6.0 h, which is 2.4 times that of native pullulanase.

[0079] Table 2 Half-lives of different pullulanases

[0080]

[0081] 2. Optimal pH

[0082] The pure enzyme solutions of wild-type pullulanase, mutant D147F, mutant G690M, and mutant D147F / G690M prepared in Example 3 were placed respectively in 50 mM buffers containing acetic acid / sodium acetate (pH 3.5 - 5.0), citric acid / sodium phosphate (pH 5.5 - 7.0) with different pH values. Taking the initial enzyme activity before incubation as 100%, the enzyme activity was measured. The results are as Figure 4 shown. The optimal pH of the mutant is 5.0, which is similar to that of the wild type.

[0083] 3. Optimal temperature

[0084] The pure enzyme solutions of wild-type pullulanase, mutant D147F, mutant G690M, and mutant D147F / G690M prepared in Example 3 were placed respectively in 50 mM buffer containing acetic acid / sodium acetate (pH 5.0). The reaction temperature was set at 40 - 70 °C. Taking the initial enzyme activity before incubation as 100%, the enzyme activity was measured. The results are as Figure 5 shown. The optimal temperature of the mutant is 55 °C, which is similar to that of the wild type.

[0085] 4. Kinetic parameters of pullulanase

[0086] Using pullulan as the substrate, the kinetic parameters of the pure enzyme solution of the wild-type pullulanase, the pure enzyme solution of the mutant D147F, the pure enzyme solution of the mutant G690M, and the pure enzyme solution of the mutant D147F / G690M prepared in 3 were measured under standard assay conditions. Among them, the pullulan substrate concentrations were 0.25, 0.5, 1, 2, 4, 6, 8, 10, 12, 14, and 16 mg / mL, respectively; the enzyme protein with a final concentration of 10 μg / mL was added, and the reaction was carried out at 45 °C for 10 min. After the reaction, GraphPad Prism 8.0 was used to perform regression analysis on the experimental data to determine the Vmax and Km values. The results are shown in Table 3. Compared with the wild type, the catalytic performance of the mutants changed little.

[0087] Table 3 Kinetic parameters of different pullulanases

[0088]

[0089] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A pullulanase mutant, characterized in that, The mutant is (a), (b), or (c): (a) mutating the aspartic acid at position 147 of pullulanase having the amino acid sequence shown in SEQ ID NO.1 to phenylalanine; (b) mutating the glycine at position 690 of pullulanase having the amino acid sequence shown in SEQ ID NO.1 to methionine; (c) mutating the aspartic acid at position 147 of pullulanase having the amino acid sequence shown in SEQ ID NO.1 to phenylalanine and mutating the glycine at position 690 to methionine.

2. A gene encoding the pullulanase mutant according to claim 1.

3. A recombinant vector carrying the gene according to claim 2.

4. The recombinant vector according to claim 3, wherein Using pET-28a(+) as the expression vector.

5. A recombinant microbial cell carrying the gene according to claim 2, or containing the recombinant vector according to claim 3 or 4.

6. A recombinant Escherichia coli, characterized in that, Using pET-28a(+) as the expression vector to express the pullulanase mutant according to claim 1.

7. The recombinant Escherichia coli according to claim 6, characterized in that, Using Escherichia coli BL21(DE3) as the expression host.

8. A method for improving the thermal stability of pullulanase, characterized in that, Mutating the aspartic acid at position 147 of pullulanase having the amino acid sequence shown in SEQ ID NO.1 to phenylalanine, and / or mutating the glycine at position 690 to methionine.

9. Use of the mutant according to claim 1, or the gene according to claim 2, or the recombinant vector according to claim 3 or 4, or the recombinant microbial cell according to claim 5, or the recombinant Escherichia coli according to claim 6 or 7 in the production of isomaltooligosaccharides by hydrolyzing starch.

Images