Nucleic acid molecules, their applications, and a method for detecting genomic contamination in Trichomonas gallinae nucleic acid samples

Abstract

The present invention relates to a nucleic acid molecule containing at least one intron fragment, and the intron region is at least greater than 50 bp; the nucleotide sequence of the intron is as shown in SEQ ID: NO. 1. By observing whether there is an expected band in the separation result of the amplification product of the Trichomonas gallinae nucleic acid sample on an agarose gel electrophoresis, it is possible to visually determine whether the RNA of the sample is contaminated with genomic DNA, and it is also applicable to the detection of genomic DNA contamination in the Trichomonas gallinae cDNA sample. The detection of genomic contamination of the Trichomonas gallinae nucleic acid sample by the present invention has simple operation, high repeatability and strong specificity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular, to nucleic acid molecules and their applications, and a method for detecting genomic contamination in a nucleic acid sample of Trichomonas gallinae. Background Art

[0002] Trichomoniasis gallinae (also known as "pigeon sore") is also a highly prevalent wasting parasitic disease in pigeon farms, which is highly harmful to the production performance of meat pigeons and the survival rate of young pigeons. The most common characteristic change is the formation of rough button-like yellow deposits on the oral and pharyngeal mucosae; when moist, it is called wet ulcer; when it is caseous or scabby, it is called dry ulcer. When the umbilicus is infected, a subcutaneous mass is formed, showing caseous or ulcerative lesions; when it spreads to internal organs, it causes obvious yellow rough caseous lesions with distinct boundaries, resulting in necrosis of the parenchymal organ tissues. Diseased pigeons are hindered from feeding due to oral ulcers, which can cause a high mortality rate in young pigeons and growing pigeons. The pathogen of trichomoniasis gallinae is Trichomonas gallinae, belonging to the subphylum Mastigophora, class Zoomastigophorea, order Polymastigida, family Trichomonadidae, and genus Trichomonas. Laboratory diagnosis generally involves microscopic examination of smears of oral, esophageal, and crop secretions to detect the presence of the parasite, or scraping the mucus at the lesion site to make a smear, and staining and microscopic examination to see the typical parasite. The parasite of Trichomonas gallinae is oval or pear-shaped. At the front end of the parasite, there are 4 flagella extending from the kinetosome, enabling the parasite to move rapidly. There is a undulating membrane on one side of the parasite, which starts at the front end of the parasite and ends slightly behind the parasite. There is an oval nucleus in the front part of the parasite. Opposite to the undulating membrane on the front part of the parasite, there is a cytostome on one side. There is a slender axostyle in the center of the parasite, extending from the front to the back and beyond the posterior margin of the parasite. The parasite multiplies by fission by making a spiral movement in the body fluid, and it can multiply once in about 4 hours. At present, there is still little research on the pathogenic mechanism of this pathogen. The reason is that there is a lack of effective gene-level detection means.

[0003] Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments. It can be regarded as a special DNA replication outside the organism. The biggest feature of PCR is that it can greatly increase trace amounts of DNA. Reverse transcription refers to the process of synthesizing complementary cDNA using RNA as a template. Reverse transcription PCR is a technique that combines reverse transcription of RNA and polymerase chain reaction (PCR) of cDNA. Therefore, reverse transcription is called RT-PCR or reverse transcription PCR. The experimental principle of reverse transcription PCR is to extract total RNA from tissues or cells, use reverse transcriptase to reverse transcribe it into cDNA with RNA as a template, and then perform PCR amplification with the cDNA strand as a template to obtain a large number of copies. The emergence of reverse transcription PCR has increased the sensitivity of RNA detection by several orders of magnitude, making it possible to analyze some extremely trace RNA samples. Reverse transcription PCR has a wide range of applications, such as analyzing gene transcripts, detecting the content of RNA viruses in cells, synthesizing cDNA probes, directly cloning the cDNA sequence of specific genes, etc. Clinically, RT-PCR can be used for genetic disease diagnosis, cancer detection, and detecting RNA viruses in patient specimens, such as HAV, HCR, HIV, etc. In plants, RT-PCR is often used to study the effects of environmental stress on plant gene expression and the differences in gene expression in different parts of plants at specific environments or growth stages. Using RT-PCR to detect and analyze RNA transcripts has the following prominent advantages: theoretically, it can detect the transcripts of almost any gene; it can achieve the detection of extremely trace RNA samples (ng level); the sample tolerance is good, and crude biological samples without purification can also be used for detection.

[0004] However, the residual genomic DNA in RNA samples not only affects the quantification of RNA concentration but also inhibits the amplification efficiency of fluorescence quantification. Therefore, the contamination of genomic DNA has a great impact on the accuracy of fluorescence quantification. Currently, there are no RNA extraction and cDNA preparation kits on the market that are specifically developed for Trichomonas. When researchers perform RNA extraction or cDNA preparation according to the kit operation instructions, although the DNase digestion step is completely carried out according to the kit requirements, it is impossible to estimate whether the DNA has been completely cleared. Currently, protists still pay little attention to this contamination problem, especially Trichomonas. Currently, there are no relevant detection technologies, and Trichomonas gallinae lacks effective reference genome and transcriptome sequences, making it even more difficult to design relevant detection technologies to avoid the genomic contamination problem of Trichomonas gallinae RNA or cDNA samples. Summary of the Invention

[0005] Based on this, in order to solve the above problems, it is necessary to provide a reference gene suitable for defining Trichomonas gallinae DNA and RNA, and design relevant primers according to the differences between cDNA and genomic fragments, and establish a method for detecting genomic contamination in nucleic acid samples of Trichomonas gallinae.

[0006] The first object of the present invention is to provide a nucleic acid molecule, which is characterized in that it contains at least one intron fragment, and the intron region is at least greater than 50 bp; the nucleotide sequence of the intron is as shown in SEQ ID: NO.1.

[0007] The second object of the present invention is to provide the application of a reagent for detecting the nucleic acid molecule in the preparation of a nucleic acid detection product for Trichomonas gallinae.

[0008] In one embodiment, the reagent includes a pair of PCR primers for amplifying the nucleic acid molecule.

[0009] In one embodiment, the sequences of the pair of PCR primers are as shown in SEQ ID: NO.2 and SEQ ID: NO.3.

[0010] The third object of the present invention is to provide a nucleic acid detection kit for Trichomonas gallinae, including the defined reagent.

[0011] In one embodiment, the detection kit further includes one or more of sample nucleic acid extraction reagents and amplification reagents.

[0012] In one embodiment, the amplification reagent includes one or more of amplification buffer, dNTPs, DNA polymerase, and Mg 2+ and the like.

[0013] The fourth object of the present invention is to provide a method for detecting genomic contamination in a nucleic acid sample of Trichomonas gallinae, including the following steps:

[0014] Provide a nucleic acid sample of Trichomonas gallinae to be tested;

[0015] Using the extracted nucleic acid sample as a template, add the pair of PCR primers for PCR amplification reaction to prepare a PCR amplification reaction product;

[0016] Detect the PCR amplification reaction product, and determine whether there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested according to the obtained detection result.

[0017] The nucleic acid sample is selected from one or more of Trichomonas gallinae DNA samples, Trichomonas gallinae RNA samples, and Trichomonas gallinae cDNA samples.

[0018] In one embodiment, the method for detecting the PCR amplification reaction product is gel electrophoresis.

[0019] Optionally, determining whether there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested according to the obtained detection result includes:

[0020] If a Trichomonas gallinae DNA band is detected in the sample, it is determined that there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested;

[0021] If no Trichomonas gallinae DNA band is detected in the sample, it is determined that there is no genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested.

[0022] Compared with the traditional technology, the beneficial effects of the present invention are:

[0023] The present invention can not only visually judge whether there is genomic contamination in the RNA of the sample according to whether there is a genomic nucleic acid band in the separation result of the amplification product by agarose gel electrophoresis, but also is applicable to the detection of genomic contamination in the cDNA sample of Trichomonas gallinae. The detection of genomic DNA contamination in the nucleic acid sample of Trichomonas gallinae by the present invention has simple operation, high repeatability and strong specificity. Description of the Drawings

[0024] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 It is the amplification result of the intron-containing DNA fragment and the corresponding mRNA fragment of the CAMK gene of Trichomonas gallinae in Example 1 of the present invention; among them, lane M is DL500; lane 1 is the cDNA amplification product without DNase treatment; lane 2 is the genomic DNA amplification product of the CAMK gene of Trichomonas gallinae; lane 3 is the cDNA amplification product of the CAMK gene of Trichomonas gallinae;

[0026] Figure 2 It is the sequence alignment result of the intron-containing DNA fragment and the corresponding mRNA fragment of the CAMK gene of Trichomonas gallinae in Example 1 of the present invention; among them, the subscript arrow horizontal line area is the expected matching area of the detection primer;

[0027] Figure 3 It is the genomic DNA contamination detection result in Example 2 of the present invention with the DNAase digestion step; among them, lane M is DL500; lanes 1-8 are the RNA samples extracted from different isolates through the kit with the DNAase digestion step, and then the reverse transcription and genomic DNA contamination detection results;

[0028] Figure 4 This is the detection result of genomic DNA contamination without the DNAase digestion step in Example 2 of the present invention. Among them, lane M is DL500; lanes 1-8 are RNA samples extracted from different isolates using the kit without the DNAase digestion step, and then the detection results of reverse transcription and genomic DNA contamination. Detailed implementation manners

[0029] Reference will now be provided in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the present invention. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0030] Accordingly, it is intended that the present invention cover such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features, and aspects of the present invention are disclosed in or are apparent from the following detailed description. Those of ordinary skill in the art should understand that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of the present invention.

[0031] Term explanation

[0032] "Primer" refers to an oligonucleotide, whether it exists naturally in a purified restriction digest or is synthetically produced, which can act as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand (e.g., in the presence of nucleotides and an inducer such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded for maximum efficiency of amplification, but optionally can also be double-stranded. If it is double-stranded, the primer is first treated to separate its strands before being used to prepare the extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of an extension product in the presence of an inducer. The exact length of the primer will depend on many factors, including temperature, primer source, and method of use. For example, in some embodiments, the primer ranges from 10 to 100 or more nucleotides (e.g., 10 to 300, 15 to 250, 15 to 200, 15 to 150, 15 to 100, 15 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50 nucleotides, etc.).

[0033] "Intron", also known as intervening sequence, refers to the non-coding segments within a gene or mRNA molecule. It is the interspersed sequence in eukaryotic cell DNA. These sequences are transcribed in precursor RNA and removed through splicing, ultimately not existing in the mature RNA molecule. The alternating arrangement of introns and exons constitutes split genes. Introns in precursor RNA are often referred to as "intervening sequences". In post-transcriptional processing, it has more mutations than exons. Intron is a special DNA sequence.

[0034] "Reverse transcription", also known as RT, is the process of synthesizing DNA using RNA as a template through reverse transcriptase, which is a special way of DNA biosynthesis. The function of reverse transcriptase is to use dNTP as a substrate, RNA as a template, and tRNA (mainly tryptophan tRNA) as a primer to synthesize a single-stranded DNA complementary to the RNA template in the 5’→3’ direction. This single-stranded DNA is called complementary DNA (cDNA), which forms an RNA-DNA hybrid with the RNA template. Subsequently, under the action of reverse transcriptase, the RNA strand is hydrolyzed, and then the second DNA strand is synthesized using cDNA as a template. Thus, the process of RNA-directed DNA synthesis is completed.

[0035] "Reverse transcription PCR" is a technique that combines the reverse transcription of RNA and the polymerase chain reaction (PCR) of cDNA. Therefore, reverse transcription is called RT-PCR or reverse transcriptase PCR. The experimental principle of reverse transcription PCR is to extract total RNA from tissues or cells, use reverse transcriptase to reverse transcribe it into cDNA with RNA as a template, and then perform PCR amplification with the cDNA strand as a template to obtain a large number of copies. The emergence of reverse transcription PCR has increased the sensitivity of RNA detection by several orders of magnitude, making it possible to analyze some extremely trace RNA samples.

[0036] In the present invention, the terms "optionally", "optional", and "option" mean having or not having, that is, either one selected from two alternative options of "having" or "not having". If the term "option" appears multiple times in a technical solution, without special instructions and without contradictions or mutual restrictions, each "option" is independent.

[0037] In the present invention, the terms "preferably", "better", "more preferably", and "as appropriate" are only used to describe the embodiments or examples with better effects. It should be understood that they do not constitute a limitation to the protection scope of the present invention.

[0038] In the present invention, the terms "further", "even further", "especially", etc. are used to describe the purpose, indicating differences in content, but should not be understood as a limitation to the protection scope of the present invention.

[0039] In the present invention, in relation to "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only for descriptive purposes and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumerative description and should be understood not to constitute a closed limitation on quantity.

[0040] In the present invention, among the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, as well as an open technical solution containing the listed features.

[0041] The first object of the present invention is to provide a nucleic acid molecule, which is characterized in that it contains at least one intron fragment, and the intron region is at least greater than 50 bp; the nucleotide sequence of the intron is as shown in SEQ ID: NO. 1.

[0042] The second object of the present invention is to provide the use of a reagent for detecting the nucleic acid molecule in the preparation of a nucleic acid detection product for Trichomonas gallinae.

[0043] Optionally, the reagent includes a pair of PCR primers for amplifying the nucleic acid molecule.

[0044] Optionally, the sequences of the pair of PCR primers are as shown in SEQ ID: NO. 2 and SEQ ID: NO. 3.

[0045] The third object of the present invention is to provide a nucleic acid detection kit for Trichomonas gallinae, which includes the defined reagent.

[0046] Optionally, the detection kit further includes one or more of a sample nucleic acid extraction reagent and an amplification reagent.

[0047] Optionally, the amplification reagent includes one or more of an amplification buffer, dNTPs, a DNA polymerase, and Mg 2+ among others.

[0048] Optionally, the kit further includes a reverse transcriptase and a reverse transcription primer, so as to facilitate the extraction of RNA from the sample to be tested and perform reverse transcription to obtain cDNA.

[0049] Optionally, the DNA polymerase is a hot-start Taq enzyme.

[0050] Optionally, the dNTPs include dATP, dGTP, dTTP, dCTP, and dUTP.

[0051] Optionally, the kit includes 2×Taq PCR Master Mix, the PCR primer pair, and ultrapure water. Among them, the 2×Taq PCR Master Mix is purchased from TAKARA, the PCR primer pair is 10 μmol / L respectively, and the ultrapure water is reverse osmosis water with a resistivity below 18.30 MΩ·CM.

[0052] The fourth object of the present invention is to provide a method for detecting genomic contamination in a Trichomonas gallinae nucleic acid sample, comprising the following steps:

[0053] Provide a Trichomonas gallinae nucleic acid sample to be tested;

[0054] Using the extracted nucleic acid sample as a template, add the PCR primer pair for PCR amplification reaction to prepare a PCR amplification reaction product;

[0055] Detect the PCR amplification reaction product, and determine whether the Trichomonas gallinae nucleic acid sample to be tested has genomic contamination according to the obtained detection result.

[0056] Optionally, the nucleic acid sample is selected from one or more of Trichomonas gallinae DNA samples, Trichomonas gallinae RNA samples, and Trichomonas gallinae cDNA samples. Optionally, the conditions for the PCR amplification reaction are pre-denaturation at 94 °C for 3 min to 5 min; denaturation at 94 °C for 25 s to 35 s, annealing at 52 °C for 25 s to 35 s, extension at 72 °C for 15 s to 25 s, for 34 to 36 cycles; extension at 72 °C for 4 min to 6 min.

[0057] The conditions for the PCR amplification reaction can be specifically determined and adjusted according to the buffer salt ion concentration, the length and nucleotide composition of the denatured nucleic acid, the reaction characteristics, and the nucleic acid length, etc. For example, in a preferred specific example, the following procedure can be followed: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, extension at 72 °C for 20 s, for 35 cycles; extension at 72 °C for 5 min.

[0058] Optionally, the system of the PCR amplification reaction includes a template, the PCR primer pair, and 2×Taq PCR MasterMix.

[0059] Furthermore, the system of the PCR amplification reaction includes 50 ng to 200 ng of template, 2 μL of each of the PCR primer pairs, 25 μL of 2×Taq PCR Master Mix, and ultrapure water is added to make the volume up to 50 μL.

[0060] Optionally, the method for detecting the PCR amplification reaction product is gel electrophoresis.

[0061] Optionally, determining whether the nucleic acid sample of Trichomonas gallinae to be tested has genomic contamination according to the obtained detection results includes:

[0062] If a DNA band of Trichomonas gallinae is detected in the sample, it is determined that the nucleic acid sample of Trichomonas gallinae to be tested has genomic contamination;

[0063] If a DNA band of Trichomonas gallinae is not detected in the sample, it is determined that the nucleic acid sample of Trichomonas gallinae to be tested does not have genomic contamination.

[0064] The following is further described in conjunction with specific embodiments. For the raw materials involved in the following specific embodiments, unless otherwise specified, they can all be obtained commercially. For the instruments used, unless otherwise specified, they can all be obtained commercially. For the processes involved, unless otherwise specified, they are all conventional selections of those skilled in the art.

[0065] The following are specific embodiments.

[0066] Example 1

[0067] Calcium / Calmodulin-dependent protein kinases (CAMK) is a serine / threonine-specific protein kinase that is regulated by the calcium / calmodulin complex. Calcium / Calmodulin-dependent protein kinases are related to a variety of life activities. At present, the CAMK gene of Trichomonas gallinae has not been publicly reported, which has hindered the progress of gene-level detection of this pathogen and the research on its pathogenic mechanism.

[0068] Obtaining and sequencing of DNA fragment and cDNA fragment of CAMK gene of Trichomonas gallinae

[0069] 1. Preparation of template

[0070] 1.1 Preparation of Trichomonas gallinae sample

[0071] Select 1 Trichomonas gallinae isolate, take (1 - 5)×10 6 Trichomonas gallinae were centrifuged at 8000g for 2 minutes, the culture medium was removed, 800 μL of PBS was added and rinsed 3 times, and the supernatant was removed by centrifugation to prepare a Trichomonas gallinae sample. The Trichomonas gallinae sample was equally divided into 3 parts.

[0072] 1.2 Extracting Trichomonas gallinae RNA and reverse transcribing to prepare Trichomonas gallinae cDNA

[0073] Take 2 parts of the Trichomonas gallinae sample in step (1), and refer to the operation of Omega E.Z.N.A SE Total RNA plus kitI (R6836-01) kit to obtain a Trichomonas gallinae RNA sample, which is stored at -40 °C for later use.

[0074] The Trichomonas gallinae RNA sample was equally divided into two parts. Take one part of the Trichomonas gallinae RNA sample 1, and refer to the instruction manual of the TAKARA PrimeScriptTM 1st Strand cDNA Synthesis Kit (6110A) reverse transcription kit to prepare the Trichomonas gallinae cDNA sample 1, and store it at -40 °C for later use. For the other part of the Trichomonas gallinae RNA sample 2, operate according to the instruction manual of the TAKARA PrimeScriptTM 1st Strand cDNA Synthesis Kit (6110A), but skip the DNase I enzyme digestion step to prepare the Trichomonas gallinae cDNA sample 2, and store it at -40 °C for later use.

[0075] 1.3 Extraction of total DNA of Trichomonas gallinae

[0076] Take one part of the Trichomonas gallinae sample in step (1), refer to the operation of the QIAamp DNA Stool Mini Kit (51504) kit to extract the total DNA sample of Trichomonas gallinae, and store it at -40 °C for later use.

[0077] 2. PCR amplification reaction

[0078] Use the calcium / calmodulin-dependent protein kinases (CAMK) of Trichomonas gallinae as the detection target. This detection target contains at least one intron fragment, and the intron region is at least greater than 50 bp. The detection target region (see Figure 2 ), and the intron region is SEQ ID: NO.1: GTATGTATTATTTTATTTACGGACTGGAGTGATTATTTTTGCTCCAGTTCGTG ATTTTTTGGTTTATTACTAACACACAG. Design primers TgaIden-F: SEQ ID: NO.2 and TgaIden-R: SEQ ID: NO.3 according to the intron region of the detection target.

[0079] The specific PCR reaction system is shown in Table 1. The template is 100 ng, 2 μL of TgaIden-F, 2 μL of TgaIden-R, 25 μL of 2×Taq PCR Master Mix, and finally make up the volume to 50 μL with ultrapure water.

[0080] Table 1

[0081] Reagent Dosage 2X Taq PCR Master Mix 25 μL TgaIden-F 2 μL TgaIden-R 2 μL Template 100 ng <![CDATA[H 2 O]]> Make up the volume to 50 μL.

[0082] The PCR reaction procedure is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 20 s, for 35 cycles; extension at 72°C for 5 min. After PCR, 6 μL of the product was taken and subjected to electrophoresis analysis using 3% agarose gel and DL500 as a marker, and then observed and photographed. Electrophoresis analysis was performed using 3% agarose gel and DL500 as a marker. The electrophoretic band difference visible to the naked eye was 50 bp. Therefore, the screening criterion for the intron region was defined as greater than 50 bp.

[0083] Using TgaIden-F / TgaIden-R, the PCR amplification reaction was carried out with the cDNA sample 1 of Trichomonas gallinae, the cDNA sample 2 of Trichomonas gallinae, and the DNA sample of Trichomonas gallinae as the PCR amplification templates respectively. The results are shown in Figure 1 . Among them, lane M is DL500; lane 1 is the cDNA amplification product without DNase treatment; lane 2 is the genomic DNA amplification product of the CAMK gene of Trichomonas gallinae; lane 3 is the cDNA amplification product of the CAMK gene of Trichomonas gallinae. A characteristic band of about 248 bp can be seen in the PCR product of the cDNA sample 1 after treatment with DNAase enzyme, a characteristic band of about 168 bp can be seen in the PCR product of the DNA sample, and two characteristic bands of about 248 bp and about 168 bp can be seen in the PCR product of the cDNA sample 2 without DNAase enzyme treatment. The cDNA sample 2 without DNAase enzyme treatment has genomic contamination.

[0084] The PCR products of the cDNA sample 1 and the DNA sample after treatment with DNAase enzyme were subjected to nucleic acid sequencing, and the sequencing results were compared. The results are shown in Figure 2 . Among them, TgaCAMK_DNA is the sequencing result of the amplification product using DNA as a template; TgaCAMK_cDNA is the sequencing result of the amplification product using the cDNA of Trichomonas gallinae as a template. Among them, TgaCAMK_DNA has an intron region of about 80 bp.

[0085] Example 2

[0086] Detection of cDNA genomic contamination in Trichomonas gallinae samples

[0087] Eight isolates of Trichomonas gallinae were selected, and two batches were prepared for each isolate. The Trichomonas gallinae sample batches 1 and 2 were prepared according to the preparation steps of the Trichomonas gallinae samples described in 1.1 of Example 1. For the eight Trichomonas gallinae samples in Trichomonas gallinae sample batch 1, the RNA samples of Trichomonas gallinae batch 1 were obtained according to the operation of the Omega E.Z.N.A SE Total RNA plus kit I (R6836-01) kit and stored at -40 °C for later use. Taking the RNA samples in Trichomonas gallinae batch 1, the cDNA samples of Trichomonas gallinae batch 1 were prepared by using the TAKARA PrimeScript TM 1st Strand cDNA Synthesis Kit (6110A) reverse transcription kit.

[0088] For the eight Trichomonas gallinae samples in Trichomonas gallinae sample batch 2, they were also operated according to the Omega E.Z.N.A SE Total RNA plus kit I (R6836-01) kit. However, during the RNA extraction process, the DNase I enzyme digestion treatment step was skipped. Taking the RNA samples of Trichomonas gallinae batch 2, the cDNA samples of Trichomonas gallinae batch 2 were prepared according to the instructions of the TAKARA PrimeScript TM 1st Strand cDNA Synthesis Kit (6110A).

[0089] 2. PCR amplification reaction

[0090] Using the calcium / calmodulin-dependent protein kinases (CAMK) of Trichomonas gallinae as the detection target, the detection target contains at least one intron fragment, the intron region is at least greater than 50 bp, and the detection target region (see Figure 2 ). The intron sequence is SEQ ID: NO.1: GTATGTATTATTTTATTTACGGACTGGAGTGATTATTTTTGCTCCAGTTCGTG ATTTTTTGGTTTATTACTAACACACAG. Primers TgaIden-F: SEQ ID: NO.2 and TgaIden-R: SEQ ID: NO.3 were designed according to the intron region of the detection target.

[0091] The above PCR amplification reactions are all based on the PCR reaction system and reaction conditions designed in the present invention. Among them, the specific PCR reaction system is shown in Table 2 below. The template is 100 ng, 2 μL of TgaIden-F, 2 μL of TgaIden-R, 25 μL of 2×Taq PCR Master Mix, and finally made up to a volume of 50 μL with ultrapure water.

[0092] Table 2

[0093] Reagent Dosage 2X Taq PCR Master Mix 25 μL TgaIden-F 2 μL TgaIden-R 2 μL Template 100 ng <![CDATA[H 2 O]]> Make up the volume to 50 μL

[0094] The PCR reaction program is as follows: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, extension at 72 °C for 20 s, for 35 cycles; extension at 72 °C for 5 min. After PCR is completed, 6 μL of the product is taken and electrophoresed using 3% agarose gel and DL500 as a marker, and then observed and photographed. Using 3% agarose gel and DL500 as a marker for electrophoresis analysis, the electrophoretic band difference visible to the naked eye is 50 bp. Therefore, the screening criterion for the intron region is defined as greater than 50 bp.

[0095] The results are shown in Figure 3 and Figure 4 as shown. Figure 3 For the corresponding detection results with DNAase operation, there is one nucleic acid band, which is the cDNA characteristic band of 168 bp, indicating that there is no DNA characteristic band in the PCR product of the sample of batch 1; Figure 4 For the corresponding operation results without DNAase operation, there are two nucleic acid bands, indicating that the PCR product of the sample of batch 2 includes the cDNA characteristic band of 168 bp and the DNA characteristic band of 248 bp. If the electrophoresis result shows a band of 168 bp in size, then the nucleic acid only has RNA. If the electrophoresis result shows a band of 248 bp in size, the nucleic acid only has DNA. If the electrophoresis result shows two bands, with sizes of 168 bp and 248 bp respectively, then the nucleic acid has both RNA and DNA, and there is genomic contamination.

[0096] By using the CAMK gene of the present invention, the primer molecules corresponding to the CAMK gene, and the method for detecting genomic contamination in Trichomonas gallinae nucleic acid samples, only by observing whether there is a genomic DNA band in the agarose gel electrophoresis separation result of the amplification product of the Trichomonas gallinae nucleic acid sample, it is possible to visually judge whether there is genomic DNA contamination in the RNA of the sample, and it is also applicable to the detection of genomic DNA contamination in Trichomonas gallinae cDNA samples. The detection of genomic DNA contamination in Trichomonas gallinae nucleic acid samples of the present invention is simple to operate, has high repeatability, and strong specificity.

[0097] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.

[0098] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A method for detecting genomic contamination in a nucleic acid sample of Trichomonas gallinae, characterized in that, it comprises the following steps: providing a nucleic acid sample of Trichomonas gallinae to be tested; using the extracted nucleic acid sample as a template, adding a pair of PCR primers for PCR amplification reaction to prepare a PCR amplification reaction product; detecting the PCR amplification reaction product, and determining whether there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested according to the obtained detection result; the sequences of the pair of PCR primers are shown as SEQ ID: NO. 2 and SEQ ID: NO. 3; the genomic contamination is DNA contamination; determining whether there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested according to the obtained detection result, including: if Trichomonas gallinae DNA bands are detected in the sample, determining that there is genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested; if Trichomonas gallinae DNA bands are not detected in the sample, determining that there is no genomic contamination in the nucleic acid sample of Trichomonas gallinae to be tested.

2. The method according to claim 1, characterized in that, the nucleic acid sample is selected from one or both of a Trichomonas gallinae RNA sample and a Trichomonas gallinae cDNA sample.

3. The method according to claim 1 or 2, characterized in that, the method for detecting the PCR amplification reaction product is gel electrophoresis.

Images