A kasp molecular marker related to radish resistance to clubroot and application thereof
By using SNP markers and KASP technology developed on chromosome 2 of radish, the problem of lack of effective molecular markers in the breeding of radish varieties resistant to clubroot was solved, achieving efficient resistance screening and improving breeding efficiency.
Patent Information
- Application Number
- CN202211009697.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-23
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2042-08-23
AI Technical Summary
The lack of effective molecular markers in existing technologies for screening and identifying radish resistance to clubroot disease leads to low efficiency in breeding radish varieties resistant to clubroot disease.
A SNP molecular marker located at 21,832,653 bases on chromosome 2 of radish was developed and converted into a KASP marker. Competitive allele-specific PCR was performed using the IntelliQube genotyping platform to achieve molecular marker-assisted screening for resistance to clubroot disease in radish.
By rapidly detecting the resistance genotype of radishes, the screening efficiency of clubroot resistant plants was significantly improved, the breeding cycle was shortened, and the breeding cost was reduced.
Smart Images

Figure CN115873974B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to molecular markers for clubroot disease in radishes, and belongs to the field of biological detection. Background Technology
[0002] Clubroot is a devastating soil-borne plant disease worldwide, causing severe yield losses of 20% to 90%. It primarily affects cruciferous crops such as radish, rapeseed, cabbage, and kale. The pathogen of clubroot is *Plasmodiophora brassicae*.
[0003] Radish (Raphanus sativus L., 2n=18), belonging to the genus Raphanus in the Brassicaceae family, is an important traditional vegetable in my country and is widely cultivated around the world. In recent years, the incidence of clubroot disease in radishes has gradually increased in Hubei, Henan, Yunnan, Sichuan, and Northeast China, with some areas even experiencing outbreaks that have rendered land uncultivable, leading to abandonment or conversion to other crops.
[0004] The occurrence of clubroot in radishes is influenced by various environmental factors. It can occur at field temperatures of 10–30℃, soil relative humidity of 60%–98%, and pH of 5.4–6.5. In the early stages of the disease, there are no obvious symptoms on the above-ground parts of the radish. Tumors of varying shapes and sizes form on the main root or lateral roots, appearing sporadically or in clusters. As the tumors gradually enlarge or increase in number, they affect the plant's absorption of nutrients, leading to slow plant growth and wilting and chlorosis of the leaves. In the later stages of infection, symptoms such as cracking, holes, collapse, and deformities appear on the main root. The tumors can also be infected by other fungi, causing the roots to rot and become foul-smelling.
[0005] Currently, the main methods for preventing clubroot disease include agricultural measures, biological control, and chemical control. Breeding disease-resistant varieties is the most economical and effective strategy for controlling clubroot disease in radishes. However, there is limited research both domestically and internationally on identifying clubroot resistance in radishes, and the lack of molecular markers with practical application value limits their use in molecular breeding.
[0006] Using molecular markers closely linked to clubroot resistance genes, plant resistance can be screened and identified at the seedling stage, improving the efficiency of identifying resistant materials and effectively shortening the breeding time for clubroot-resistant varieties. Therefore, developing clubroot-resistant linked molecular markers for radishes has significant application value for the breeding of clubroot-resistant radish varieties.
[0007] There are few reports on the genetic mechanisms and molecular markers of clubroot resistance in radishes. Although scholars at home and abroad have identified QTL loci for clubroot resistance in radishes from different germplasms, the genetic distance is large or the resistance is controlled by a number of loci, which makes it difficult to quickly and effectively apply the developed molecular markers to breeding practices. Summary of the Invention
[0008] The present invention develops a molecular marker closely linked to the trait within the QTL interval for clubroot resistance in radish and verifies the reliability of the marker. By detecting the molecular marker, the resistance of radish to clubroot can be predicted, providing a molecular marker-assisted selection technology for the identification and screening of radish resistance to clubroot.
[0009] In a first aspect, this invention provides an SNP molecular marker located at nucleotide 21,832,653 on chromosome 2 of radish. The SNP marker is a G-to-A conversion. The sequence information of 100 bases upstream and downstream of this marker (GCGTGATGGACTCTGCTCGGTCAGCGAGCTTCCACCAGAGGAGTAACGT[G / A]AACAAGATGCAGAGAGGAGAGAGAGGTTCGGTTTCATCACTGAGCACGAC) is extracted. Using primer design software, this marker is converted into a KASP marker. The polymorphism of the marker is then verified by performing SNP genotyping based on competitive allele-specific PCR (KSAP technology) using the high-throughput IntelliQube genotyping platform. This enables molecular marker-assisted screening for resistance to clubroot disease in radish.
[0010] A second aspect of the present invention provides a specific primer set for detecting SNPs, wherein the primer set is a KASP primer transformed with SNP markers, and the primer sequence is as follows:
[0011] Forward primer 1, F-1: CCTCTCCTCTCTGCATCTTGTTT
[0012] Forward primer 2, F-2: CCTCTCCTCTCTGCATCTTGTTC
[0013] Reverse primer, R:TGCTCGGTCAGCGAGCTTCCAC.
[0014] The third aspect of this invention is to provide a method for detecting SNPs. The method uses the primers described in the second aspect, with the extracted plant genome as a template, and performs a competitive allele-specific PCR (KASP) reaction using the high-throughput IntelliQube genotyping platform. The KASP reaction system is as follows: the reaction system is prepared according to the IntelliQube platform manual from LGC, specifically including a KASP primer mixture, a KASP master mixture, and a DNA template. The KASP primer mixture contains two allele-specific forward primers and one shared reverse primer; the KASP master mixture contains FAM-labeled oligosequences from the F-1 tail, HEX-labeled oligosequences from the F-2 tail, FAM dye, HEX dye, and a quencher; the DNA template is radish genomic DNA.
[0015] In one specific embodiment, the...
[0016] KASP test procedure: The following steps can be simplified
[0017] 1. Aliquot the DNA samples into 96-well PCR plates. Prepare the DNA samples to a uniform and suitable concentration (5-10 ng / μl) and add them to the 96-well PCR plates. Add two negative controls (NTCs) to each PCR plate.
[0018] 2. Prepare the KASP genotyping mixture. Using a 384-well array tape, the mixture should contain: 0.8 μL wet DNA, 0.8 μL 2x KASPMaster mix + Assay, for a total reaction volume of 1.6 μL.
[0019] 3. Add the KASP genotyping mixture to the array tape membrane containing the DNA template. Using the IntelliQube SNP gene detection platform, program the process and sequentially place the 384-well array tape, DNA sample plate, and KASP genotyping mixture into the machine. Operate the machine to automatically dispense the DNA sample diluent and KASP genotyping mixture into the 384-well array tape and seal the membrane.
[0020] 4. Perform PCR cycling. PCR can be performed in the IntelliQube machine in SNP genotyping inline mode (single membrane) or in the Hydrocycler machine in SNP genotyping outline mode (multiple membranes) for water bath PCR. The program settings are as follows: 1. Pre-denaturation: 94℃, 15 min, 1 cycle; 2. Denaturation: 94℃, 20 sec; Annealing / Extension: 61-55℃, 60 sec (-0.6℃ / cycle); Step 2: 10 cycles; 3. Denaturation: 94℃, 20 sec; Annealing / Extension: 55℃, 60 sec; Step 3: 26 cycles.
[0021] 5. Fluorescence data reading and analysis. After the PCR reaction, fluorescence data were read and analyzed using an IntelliQube instrument. Fluorescence excitation FAM: 485 nm, emission: 520 nm; HEX excitation: 535 nm, emission: 556 nm; ROX excitation: 575 nm, emission: 610 nm.
[0022] 6. Add cycles. If the fluorescence signal is low and the clusters are scattered, fluorescence readings can be performed after adding cycles. The conditions for adding cycles are as follows: denaturation: 94℃, 20 sec; annealing / extension: 57℃, 60 sec, 3 cycles.
[0023] KASP typing results:
[0024] First, the primers and methods described above can detect the presence of major QTL sites related to clubroot resistance in radishes, and simultaneously detect the polymorphism type of the marker. The marker type is consistent with the corresponding plant resistance phenotype, and the resistance of radishes to clubroot can be predicted by the marker type.
[0025] The beneficial effects of this invention are as follows: This invention discovers a major QTL locus associated with clubroot resistance on chromosome 2 of radish through QTL-seq technology and genetic mapping, and further develops molecular markers closely linked to the locus. By extracting DNA from seeds or seedling leaves of radish materials with unknown resistance, and combining it with the KASP primers of this invention to conduct KASP molecular marker typing experiments, the typing results of the markers can predict the resistance of radish to clubroot without the need for manual identification, which can significantly improve breeding efficiency and save breeding costs. Attached Figure Description
[0026] Figure 1 The QTL-seq mapping of radish resistance to clubroot disease showed a clear peak region on chromosome 2, and the major QTL loci could be identified with a 99% confidence interval.
[0027] Figure 2KASP genotyping results of 196 plants were analyzed using molecular markers: blue represents a single base type (TT), red represents a base type (CC), purple represents a heterozygous type (TC), and gray represents the blank control. Radishes with the TT base type were susceptible to disease, while those with CC and TC base types were resistant. For materials with unknown resistance, the resistance of plants after KASP genotyping was consistent with that of plants with the same marker type. Detailed Implementation
[0028] The specific implementation methods and technical solutions of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be noted that those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. In particular, it should be pointed out that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.
[0029] The present invention will be described through specific embodiments, but the present invention is not limited thereto.
[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the reagents, biological materials, etc. used in the following examples are commercially available.
[0031] Example 1: Obtaining the Sample Gene Bank
[0032] The F1 generation was obtained by crossing water radish 'LLYH' and cherry radish 'HD'. The F1 generation was then self-crossed to obtain an F2 segregating population of 131 plants, which was used as the research object.
[0033] For F2 individual plants, the physiological race 4 of *Plasmodiophora* collected from Xinye, Henan Province was used as the inoculum. The seedling injection method was used for identification. Based on the inoculation results, 40 susceptible individual plants were selected from the F2 generation population and mixed into a disease pool. The DNA of the extreme individual plants and the parents was extracted using the modified CTAB method.
[0034] Example 2: SNP Acquisition
[0035] Illumina HiSeq™ PE150 was used to sequence two parents and a disease pool. The sequencing depth of the parents was 10×, and the sequencing depth of the pool was 40×.
[0036] The SNP-index was calculated using QTL-seq with pooled sequencing of extreme traits. After 1000 permutation tests, a 95% confidence level was selected as the screening threshold, and major QTL loci associated with clubroot resistance were detected on chromosome 2 of radish.
[0037] The physical location of this locus is in the 10.2–14.5 Mb region of chromosome 2, which contains 3340 identified SNP loci. Nine polymorphic SNP loci were selected from this region, and 50 bp of the upstream and downstream base sequences were extracted. KASP-labeled primers were designed according to primer design principles.
[0038] The sequence information of the KASP primer developed based on SNP site information at position 21,832,653 on chromosome 2 is as follows:
[0039] Forward primer 1, F-1: CCTCTCCTCTCTGCATCTTGTTT
[0040] Forward primer 2, F-2: CCTCTCCTCTCTGCATCTTGTTC
[0041] Reverse primer, R: TGCTCGGTCAGCGAGCTTCCAC
[0042] The SNP genotyping test based on KSAP technology was conducted on the parents and F2 generation single plants with different resistance using the IntelliQube platform of LGC. The specific KASP test procedure was carried out in accordance with the instructions.
[0043] Analysis of the KASP genotyping results using this molecular marker revealed three genotypes among the 196 F2 plants: 43 plants were TT type, all susceptible to the disease, with the genotype identical to the susceptible parent "LLYH"; 51 plants were CC type, all resistant to the disease, with the genotype identical to the resistant parent "HD"; and 43 plants were TC heterozygous type, exhibiting resistance. The analysis showed that individuals of the CC and TC genotypes were all resistant, while those of the TT genotype were susceptible.
[0044] Example 3: SNP Compliance Verification
[0045] Using the method described in Example 2, 87 F2 plants were divided into three genotypes. 20 plants were TT type, all susceptible to the disease, with the genotype identical to the susceptible parent "LLYH"; 24 plants were CC type, all resistant to the disease, with the genotype identical to the resistant parent "HD"; and 102 plants were TC heterozygous, exhibiting disease resistance. Analysis showed that individuals of the CC and TC genotypes were all resistant, while those of the TT genotype were susceptible.
[0046] Therefore, by comparing the phenotype of plant disease resistance and the results of the KASP typing test, it was demonstrated that the SNP marker at nucleotide 21,832,653 on chromosome 2 is closely linked to the trait of clubroot resistance in radish, and can be used to detect differences in clubroot resistance in radish (e.g., Figure 2 (As shown).
[0047] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A primer set for specifically detecting molecular markers of clubroot resistance in radishes, characterized in that, The primer set described above is used in the KASP reaction, and the sequence of the primer set is as follows: Forward primer 1, F-1: CTCTCTCCTCTCTGCATCTTGTTT (SEQ ID NO:2); Forward primer 2, F-2: CTCTCTCCTCTCTGCATCTTGTTC (SEQ ID NO:3); Reverse primer, R: TGCTCGGTCAGCGAGCTTCCAC (SEQ ID NO:4); The nucleic acid sequence of the molecular marker is shown in SEQ ID NO:
1.
2. A method for specifically detecting molecular markers of clubroot resistance in radish, wherein the method comprises amplifying the radish genome using the primer set described in claim 1 and the KASP method.
3. The method according to claim 2, characterized in that, The KASP method specifically involves using the extracted plant genome as a template and performing a KASP reaction using the high-throughput IntelliQube genotyping platform. The KASP reaction system comprises a KASP primer mixture, a KASP master mixture, and a DNA template.
4. The method according to claim 3, wherein the KASP primer mixture comprises two allele-specific forward primers and one common reverse primer; the KASP master mixture comprises an oligosequence labeled with FAM at the F-1 tail, an oligosequence labeled with HEX at the F-2 tail, FAM dye, HEX dye, and a quencher; and the DNA template is radish genomic DNA.
5. The method according to claim 3 or 4, wherein the specific operation of KASP is as follows: 1) Aliquot the DNA samples into 96-well PCR plates; 2) Prepare the KASP genotyping mixture; 3) Add the KASP genotyping mixture to the array tape membrane containing the DNA template; 4) Perform PCR cycling reaction; 5) Fluorescence data reading and analysis.
6. The method according to claim 5, characterized in that, If the fluorescence signal of the data is low and the clusters are scattered, repeat the cycle and then read the fluorescence.
7. A method for assisting radish breeding, wherein the method involves detecting the radish genome using the primer set described in claim 1 or the method described in any one of claims 2-6, detecting the molecular marker described in claim 1, wherein when the SNP genotype is CC or TC, it is a disease-resistant phenotype, and when it is TT, it is a disease-susceptible phenotype.
8. A method for detecting whether a radish has a clubroot resistant phenotype, wherein the method comprises detecting the radish genome using the primer set described in claim 1 or the method described in any one of claims 2-6, detecting the molecular marker described in claim 1, wherein when the SNP genotype is CC or TC, it is a disease-resistant phenotype, and when it is TT, it is a disease-susceptible phenotype.
Citation Information
Patent Citations
SSR molecular marker in linkage with radish clubroot-resisting QTL and applications of SSR molecular marker
CN109280716A
InDel molecular marker for identifying clubroot resistance of radish as well as development method and application thereof
CN113186329A