KASP primer pairs, kits, methods and applications for detecting combinations of snps associated with soy protein content
By using a three-SNP locus combined typing method and KASP primer pairs, the problem of rapid and low-cost detection of soybean protein content was solved, enabling efficient screening of high-protein varieties and enhancing the market competitiveness of soybean breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING DABEINONG TECHNOLOGY GROUP CO LTD
- Filing Date
- 2025-12-17
- Publication Date
- 2026-04-17
AI Technical Summary
There is a lack of rapid and low-cost methods for detecting soybean protein content in the current technology. Traditional methods are time-consuming and inefficient, and the stability of single-gene unit detection is insufficient, making it difficult to effectively screen high-protein varieties.
A three-SNP locus combined genotyping method was adopted, and specific KASP primer pairs were designed. By detecting SNP1 (Chr11:4903434), SNP2 (Chr10:47558915), and SNP3 (Chr10:47559046) loci, combined with FAM/HEX fluorescent labeling, rapid and accurate genotyping analysis was achieved, and a grouping standard for high-protein and low-protein SNP combinations was established.
It enables rapid and stable detection of soybean protein content, shortens the breeding cycle, improves screening efficiency, reduces costs, is suitable for large-scale sample testing, and supports soybean molecular breeding and variety improvement.
Smart Images

Figure CN121344250B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding and genetic improvement technology, specifically relating to KASP primer pairs, kits, methods, and applications for detecting SNP combinations related to soybean protein content. Background Technology
[0002] Soybeans are an important oilseed and protein crop, and seed protein content is a crucial agronomic trait affecting nutritional quality and commercial value. Traditional protein content detection relies on chemical analysis methods (such as Kjeldahl nitrogen determination and near-infrared spectroscopy), which have drawbacks such as being time-consuming, costly, and inefficient.
[0003] With the development of soybean genome sequencing and molecular marker technology, molecular markers based on polymorphic sites have become important tools for elucidating complex traits and assisting in breeding selection. Among them, KASP markers are widely used in crop molecular breeding research due to their high sensitivity, high throughput, ease of operation, and low cost. However, there are currently limited reports on stable KASP markers for soybean protein content, and a practical tool that can be directly applied to variety breeding and resource screening is lacking.
[0004] Therefore, there is an urgent need to develop primers for KASP molecular markers that are significantly correlated with soybean protein content, for rapid molecular detection and assisted selection of high-protein soybean varieties.
[0005] Although the KASP technology itself is mature, the soybean protein content trait is a complex trait controlled by multiple genes. In the past, single-gene unit point detection could only partially screen for dominant genotypes, and its stability was insufficient.
[0006] Therefore, developing a KASP detection method that can accurately, rapidly, and cost-effectively identify specific superior SNP combinations in soybeans by targeting multiple sites is of vital importance for accelerating the process of soybean molecular breeding. Summary of the Invention
[0007] The purpose of this invention is to provide a method for detecting SNP combinations related to soybean protein content, and to establish a grouping standard for high-protein and low-protein SNP combinations through a three-SNP joint genotyping method. Another purpose of this invention is to provide KASP primer pairs for detecting SNP combinations related to soybean protein content and their applications, and to establish a grouping standard for high-protein and low-protein SNP combinations through a three-SNP joint genotyping method that detects specific SNP sites.
[0008] To achieve the above objectives, the present invention adopts the following technical solution:
[0009] The application of a set of reagents for detecting SNP combinations associated with soybean protein content in breeding. These SNP combinations include SNP1 at position 4903434 on chromosome Chr11, SNP2 at position 47558915 on chromosome Chr10, and SNP3 at position 47559046 on chromosome Chr10. The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, where S at position 23 bp represents G or C; the nucleotide sequence of SNP2 is shown in SEQ ID NO.2, where S at position 27 bp represents G or C; and the nucleotide sequence of SNP3 is shown in SEQ ID NO.3, where R at position 21 bp represents G or A. Samples carrying the genotypes CC-GG-GG or CC-CC-AA for SNP1-SNP2-SNP3, respectively, had significantly higher soybean protein content than samples carrying the GG-GG-GG genotype, and also higher than samples carrying the GG-CC-AA genotype.
[0010] A set of KASP primer pairs for detecting SNP combinations related to soybean protein content includes three sets of primer pairs for detecting SNP1, SNP2, and SNP3. Specifically, the primer pair for detecting SNP1 includes forward primers 1 and 2 as shown in SEQ ID NO. 4-5 and a universal reverse primer as shown in SEQ ID NO. 6; the primer pair for detecting SNP2 includes forward primers 1 and 2 as shown in SEQ ID NO. 7-8 and a universal reverse primer as shown in SEQ ID NO. 9; and the primer pair for detecting SNP3 includes forward primers 1 and 2 as shown in SEQ ID NO. 10-11 and a universal reverse primer as shown in SEQ ID NO. 6. Further, the 5' ends of forward primers 1 and 2 are labeled with FAM and HEX groups, respectively, to distinguish different genotypes.
[0011] A kit for detecting SNP combinations associated with soybean protein content, comprising the KASP primer pair as described above.
[0012] The kit described above also includes KASP Master Mix, PCR reaction buffer, negative control, and positive control. The nucleotide sequence of the positive control is shown in SEQ ID NO.13-18, and the negative control is nuclease-free water.
[0013] A method for detecting SNP combinations associated with soybean protein content, comprising the following steps:
[0014] S1. Extract genomic DNA from the soybean sample to be tested;
[0015] S2. Using the extracted DNA as a template, PCR amplification is performed using KASP primer pairs or the kit described above; wherein, the KASP primer pairs include the primer pair for detecting SNP1, which includes forward primers 1 and 2 as shown in SEQ ID NO. 4-5 and the universal reverse primer as shown in SEQ ID NO. 6; the primer pair for detecting SNP2 includes forward primers 1 and 2 as shown in SEQ ID NO. 7-8 and the universal reverse primer as shown in SEQ ID NO. 9; the primer pair for detecting SNP3 includes forward primers 1 and 2 as shown in SEQ ID NO. 10-11 and the universal reverse primer as shown in SEQ ID NO. 6.
[0016] S3. Perform fluorescence detection on the PCR amplification products and determine the genotype of the sample at SNP1-3 sites by analyzing the fluorescence signal intensity.
[0017] S4. Based on the genotype determined in step S3, determine the SNP combination type carried by the sample.
[0018] As described above, preferably, the PCR amplification program consists of: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, followed by annealing and extension at 61°C for 60 s, for 10 cycles with a decrease of 0.6°C per cycle; denaturation at 94°C for 20 s, followed by annealing and extension at 55°C for 60 s, for 35 cycles; and final extension at 72°C for 5 min.
[0019] The detection reagents, KASP primer pairs, and methods described above for detecting SNP combinations related to soybean protein content are applied in breeding. Furthermore, the breeding objective is to screen soybean samples with high protein content, obtaining soybean samples with genotypes corresponding to SNP1-SNP2-SNP3 as CC-GG-GG or CC-CC-AA, which are considered high-protein samples and can be used for breeding.
[0020] The application of the detection reagents, KASP primer pairs, and methods described above for detecting SNP combinations related to soybean protein content in screening soybeans with high protein content.
[0021] The beneficial effects of this invention are as follows:
[0022] This invention provides KASP primer pairs for detecting SNP combinations related to soybean protein content. By detecting KASP molecular markers at three linked SNP sites, the genotypes of differences in protein content in soybean germplasm can be rapidly and stably analyzed. KASP primers are designed for three linked SNP sites (the core of SNP combinations), rather than detecting a single SNP, avoiding misjudgments caused by recombination at a single site or interference from genetic background. SNP combinations, as multi-site recombination units, have a stronger correlation with soybean protein content.
[0023] This invention rapidly identifies SNP genotype combinations in soybean germplasm using KASP primers. It can be used to screen soybean samples with high protein content, allowing for the identification of individuals carrying high-protein SNP combinations at the seedling stage rather than maturity. This avoids the lengthy process of testing protein content from planting to maturity in traditional breeding. Compared to the approximately one-year cycle of traditional breeding, this invention can shorten the screening process to within three months. It can also be used in breeding to select high-protein soybean parents. This invention addresses the core problems of long cycles and low screening efficiency in soybean breeding, helping breeding companies quickly launch high-protein varieties and enhance their market competitiveness.
[0024] Compared with traditional detection methods, the detection method provided by this invention is fast, low-cost, and suitable for large-scale sample detection.
[0025] The detection method provided by this invention can be applied to soybean molecular marker-assisted breeding selection, variety improvement, and germplasm resource evaluation. Attached Figure Description
[0026] Figure 1 Scatter plot of SNP1 KASP cluster in Example 2;
[0027] Figure 2 Scatter plot of SNP2 KASP clusters in Example 2;
[0028] Figure 3 Scatter plot of SNP3 KASP clusters in Example 2;
[0029] Figure 4 Scatter plot of SNP1 KASP cluster in Example 4;
[0030] Figure 5 Scatter plot of SNP2 KASP clusters in Example 4;
[0031] Figure 6 Scatter plot of SNP3 KASP clusters in Example 4;
[0032] Figure 7 Box plots showing the phenotypic differences in protein content among soybean varieties carrying different SNP combinations. Detailed Implementation
[0033] This invention is based on the significant genetic association between three functional single nucleotide polymorphism (SNP) sites within the target gene region and protein content. By comparing and analyzing the target sequence, the allelic differences of each SNP are identified, and allelic-specific KASP primers (labeled with FAM / HEX tail sequences) and universal reverse primers are designed. During amplification, allelic-specific primers extend preferentially due to perfect 3′ base matching, while mismatched primers cannot amplify effectively, thus resulting in significant differences in amplification kinetics among different alleles.
[0034] In the amplification reaction, the FRET fluorescent reporter system (FAM / HEX) in the system binds to two specific primer tail sequences to achieve allele determination based on fluorescence signals: when a sample carries a certain allele, the corresponding tailed primers gain dominant amplification and generate detectable fluorescence signals after binding with specific fluorescent probes.
[0035] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0036] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the embodiments are analytical grade or higher.
[0037] Example 1: SNP site selection and design and synthesis of KASP marker primers
[0038] GWAS Analysis: Soybean Population Selection and Phenotypic Identification: Using 1200 domestic and international natural population resources from Sanya Dabeinong Chuangzhong Gene Technology Co., Ltd., soybean leaves were collected during the peak season of 2024 for whole-genome resequencing. After harvest, the protein content of seeds was determined using the Xingchuang Zhongpu G1200 protein analyzer. Then, a genome-wide association analysis (GWAS) was performed on the genotype and protein content phenotype of soybean materials using a linear regression model with PLINK software. The association results showed that a region significantly associated with protein content existed at the Chr11 chromosome position. Twenty-six significant SNP loci were identified at Chr11, and a significantly associated (p=4.7355e-07) non-synonymous SNP locus was determined at position 4903434 on the soybean Chr11 chromosome. This locus was named SNP1. The specific sequences upstream and downstream of this locus are shown in SEQ ID NO.1, where S at position 23 bp represents G or C.
[0039] SEQ ID NO. 1: TTGGAAATGAACGCAAACTTGASTCCGAAAGAAAGGATAGGCTGGCAATG.
[0040] The SNP2 used in this invention is located at position 47558915 on chromosome Chr10. The specific sequences upstream and downstream of this site are shown in SEQ ID NO.2, where S at position 27bp represents G or C.
[0041] SEQ ID NO. 2: GGTAGAGAGGAGGGGCAGCAACAAGGSGAGGAGAGGCTGCAAGAG.
[0042] The SNP3 used in this invention is located at position 47559046 on chromosome Chr10. The specific sequences upstream and downstream of this site are shown in SEQ ID NO.3, where R at position 21 bp represents G or A. SEQ ID NO.3: ACCTTTCAACTTGAGAAGCCRCGACCCCATCTATTCCAACAAGCTTGGCA.
[0043] In this invention, the locus coordinates of SNP combinations are based on the NCBI soybean genome Glycine_max_v4.0. SNP1, located at position 4903434, contains both G and C bases; SNP2, located at position 47558915, also contains both G and C bases; and SNP3, located at position 47559046, contains both G and A bases. Different allele combinations at these three loci produce different genotypes. Therefore, it is necessary to simultaneously detect the specific allele types at all three loci to determine the type of SNP combination (3-locus combination) in the sample. Different SNP combinations typically exhibit different phenotypes. By identifying different SNP combinations, sample materials with different phenotypes can be screened.
[0044] Based on the KASP primer design principles, allele-specific primers and universal reverse primers were designed upstream and downstream of three SNPs using snpgene software. After BLAST validation to ensure primer specificity, the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific sequences are as follows:
[0045] The primer set includes: SNP1 forward primer 1 (SEQ ID NO.4): GAAGGTGACCAAGTTCATGCTTTGGAAATGAACGCAAACTTGAG;
[0046] SNP1 forward primer 2 (SEQ ID NO.5): GAAGGTCGGAGTCAACGGATTTTGGAAATGAACGCAAACTTGAC;
[0047] SNP1 universal reverse primer (SEQ ID NO.6): CATTGCCAGCCTATCCTTTCTT;
[0048] SNP2 forward FAM primer 1 (SEQ ID NO.7): GAAGGTGACCAAGTTCATGCTCTCTTGCAGCCTCTCCTCC;
[0049] SNP2 forward HEX primer 2 (SEQ ID NO.8): GAAGGTCGGAGTCAACGGATTCTCTTGCAGCCTCTCCTCG;
[0050] SNP2 universal reverse primer (SEQ ID NO.9): GGTAGAGAGGAGGGGCA;
[0051] SNP3 forward FAM primer 1 (SEQ ID NO.10): GAAGGTGACCAAGTTCATGCTACCTTTCAACTTGAGAAGCCG;
[0052] SNP3 forward HEX primer 2 (SEQ ID NO.11): GAAGGTCGGAGTCAACGGATTACCTTTCAACTTGAGAAGCCA;
[0053] SNP3 universal reverse primer (SEQ ID NO.12): TGCCAAGCTTGTTGGAATAGATG;
[0054] The FAM primers are labeled with a FAM fluorescent marker at the 5' end of the primer sequence, while the HEX primers are labeled with a HEX fluorescent marker at the 5' end of the primer sequence. Different fluorescent markers are used to distinguish different genotypes.
[0055] Example 2: Validation of KASP tags
[0056] 1. KASP validation population selection: Sixteen soybean germplasm resources with known genotypes (obtained through resequencing) were randomly selected as validation materials, and the protein content of all samples was determined using the protein content determination method described in Example 1.
[0057] 2. DNA extraction: Genomic DNA was extracted from the above-mentioned young soybean leaves using the CTAB method, and the concentration and purity were determined by NanoDrop (ensuring that the A260 / A280 of the genomic DNA was between 1.7 and 2.0; if not, it should be extracted again). The DNA was diluted to a working concentration of 50 ng / µL as the DNA template for KASP detection.
[0058] 3. Primer preparation: The primer pairs synthesized in Example 1 for each SNP site were prepared in the following volume ratio: forward FAM primer 1: forward HEX primer 2: universal reverse primer: water = 12:12:30:46 (primer concentration diluted to 100 µmol / mL). Each SNP site primer mixture needs to be prepared separately and a separate PCR amplification system is required before fluorescence detection.
[0059] 4. KASP-PCR reaction:
[0060] The reaction system (5 μL) included 1.5 µL of DNA template, 2.5 µL of KASP mix, 0.07 µL of KASP primer mixture (FAM primer + HEX primer + reverse primer), and ddH2O to bring the total to 5 µL.
[0061] The reaction procedure is shown in Table 1 below:
[0062] Table 1 Reaction conditions
[0063]
[0064] Results Detection and Analysis: After the reaction, fluorescence signals were collected using the software included with the QuantStudio 5 real-time fluorescence PCR instrument, and cluster analysis was performed. The results are shown below. Figure 1 , Figure 2 , Figure 3 Comparison with WGS sequencing data revealed that the KASP genotyping results of all 16 samples were completely consistent with known sequencing results, proving that the KASP marker primers designed in this invention have extremely high reliability and accuracy.
[0065] The results showed that three genotype combinations (SNP1-SNP2-SNP3) were found in the 16 samples: Hap1: GG-GG-GG, Hap2: GG-CC-AA, Hap3: CC-GG-GG, and Hap4: CC-CC-AA. Among the 16 samples, 7 were Hap1 (mean protein content 39.13±1.13), 2 were Hap2 (mean protein content 43.1±0.99), 5 were Hap3 (mean protein content 46.98±3.31), and 2 were Hap4 (mean protein content 47.05±1.91). Kruskal-Wallis + Mann–Whitney differential analysis showed a significant difference in protein content between Hap1 and Hap3 (p=0.0057).
[0066] Table 2. Association analysis of 16 soybean SNP gene combinations with soybean protein content trait.
[0067]
[0068] Note: All data in the table are mean ± standard error. Different superscript letters between data in the same column indicate significant differences. P < 0.01), with the same letter indicating no significant difference ( P > 0.01).
[0069] Example 3
[0070] The KASP labeling kit includes the following primer set, KASP Master Mix, PCR reaction buffer, negative control, and positive control.
[0071] The primer set includes: SNP1 forward primer 1 (SEQ ID NO.4): GAAGGTGACCAAGTTCATGCTTTGGAAATGAACGCAAACTTGAG
[0072] SNP1 forward primer 2 (SEQ ID NO.5): GAAGGTCGGAGTCAACGGATTTTGGAAATGAACGCAAACTTGAC
[0073] SNP1 universal reverse primer (SEQ ID NO.6): CATTGCCAGCCTATCCTTTCTT
[0074] SNP2 forward FAM primer 1 (SEQ ID NO.7): GAAGGTGACCAAGTTCATGCTCTCTTGCAGCCTCTCCTCC
[0075] SNP2 forward HEX primer 2 (SEQ ID NO. 8): GAAGGTCGGAGTCAACGGATTCTCTTGCAGCCTCTCCTCG
[0076] SNP2 universal reverse primer (SEQ ID NO.9): GGTAGAGAGGAGGGGCA
[0077] SNP3 forward FAM primer 1 (SEQ ID NO.10): GAGGTGACCAAGTTCATGCTACCTTTCAACTTGAGAAGCCG
[0078] SNP3 forward HEX primer 2 (SEQ ID NO.11): GAAGGTCGGAGTCAACGGATTACCTTTCAACTTGAGAAGCCA
[0079] SNP3 universal reverse primer (SEQ ID NO.12): TGCCAAGCTTGTTGGAATAGATG
[0080] The forward primers 1 and 2 for each group were labeled with FAM fluorescent dye and HEX fluorescent dye at the 5' end of their sequences, respectively, to distinguish different genotypes. In KASP amplification systems at different sites, a positive control was used as a template sequence to determine the genotype, which can indicate the accuracy of the genotyping results.
[0081] The positive control for the GG genotype at SNP1 locus is (SEQ ID NO.13): TTGGAAATGAACGCAAACTTGAGTCCGAAAGAAAGGATAGGCTGGCAATG
[0082] The positive control for the CC genotype at the SNP1 locus is (SEQ ID NO.14): TTGGAAATGAACGCAAACTTGACTCCGAAAGAAAGGATAGGCTGGCAATG
[0083] The positive control for the GG genotype at SNP2 locus is (SEQ ID NO.15): GGTAGAGAGGAGGGGCAGCAACAAGGGGAGGAGAGGCTGCAAGAG
[0084] The positive control for the CC genotype at SNP2 locus is (SEQ ID NO.16): GGTAGAGAGGAGGGGCAGCAACAAGGCGAGGAGAGGCTGCAAGAG
[0085] The positive control for the GG genotype at SNP3 is (SEQ ID NO.17): ACCTTTCAACTTGAGAAGCCGCGACCCCATCTATTCCAACAAGCTTGGCA
[0086] The positive control for the AA genotype at SNP3 locus is (SEQ ID NO.18): ACCTTTCAACTTGAGAAGCCACGACCCCATCTATTCCAACAAGCTTGGCA.
[0087] Example 4: Application of markers in screening new population materials
[0088] Materials: 173 natural soybean populations were selected.
[0089] Detection: Genomic DNA was extracted from leaves using the kit described in Example 3, following the method in Example 2, and genotyping was performed using the KASP marker kit of this invention. The cluster analysis results for the three SNP loci (SNP1, SNP2, and SNP3) are shown below. Figure 4 , Figure 5 , Figure 6 Positive controls can be set up to verify the accuracy and reliability of the test results.
[0090] The protein content of all samples was determined using the method described in Example 1, and the protein content of each genotype was statistically analyzed. Results: The three SNP loci of 173 materials were successfully genotyped. Integrating the genotyping results from the three loci, four genotypes were identified (specific alleles are described in Example 2), further dividing the materials into four populations: 91 samples of Hap1 (protein content 38.77 ± 1.27), 5 samples of Hap2 (protein content 42.72 ± 2.79), 45 samples of Hap3 (protein content 44.52 ± 2.99), and 32 samples of Hap4 (protein content 44.47 ± 2.82). Kruskal-Wallis + Mann–Whitney analysis was performed to analyze the protein content between multiple groups. The results showed a significant difference in protein content between Hap1 and Hap2 (p = 0.0045) and between Hap1 and Hap3 (p = 1.07 x 10⁻⁶). -17 There was a significant difference in the protein content of Hap1 versus Hap4 (p=1.17x10). -15 The results are shown in Table 3. The box plot of protein content differences between groups is shown below. Figure 7 As shown, the soybean protein content of samples carrying SNP1-SNP2-SNP3 genotypes CC-GG-GG or CC-CC-AA is significantly higher than that of samples carrying the GG-GG-GG genotype, and higher than that of samples carrying the GG-CC-AA genotype.
[0091] Table 3. Association analysis between soybean SNP combinatorial gene polymorphism and soybean protein content trait.
[0092]
[0093] Note: All data in the table are mean ± standard error. Different superscript letters between data in the same column indicate significant differences. P < 0.01), with the same letter indicating no significant difference ( P > 0.01).
[0094] Application: Based on this typing result, breeders prioritize excluding low-protein SNP combinations like Hap1 and selecting resources carrying SNP combinations Hap3 and Hap4 as breeding parents for high-protein varieties. Specifically, soybean samples carrying SNP1-SNP2-SNP3 genotypes CC-GG-GG or CC-CC-AA are selected as high-protein samples for breeding, and further screening of offspring carrying these superior SNP combinations can be conducted. This significantly improves the targeting and efficiency of selection, saving manpower, resources, and land costs associated with field trials.
Claims
1. A set of SNP combinations for detecting soybean protein content in breeding, characterized in that, The SNP combinations associated with soybean protein content include SNP1, SNP2, and SNP3. The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, where S at position 23 bp represents G or C. The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, where S at position 27 bp represents G or C. The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, where R at position 21 bp represents G or A. Samples carrying the genotypes CC-GG-GG, CC-CC-AA, or GG-CC-AA for SNP1-SNP2-SNP3 respectively had significantly higher soybean protein content than samples carrying the GG-GG-GG genotype.
2. The application of a set of KASP primer pairs for detecting SNP combinations related to soybean protein content in breeding, characterized in that, The SNP combinations associated with soybean protein content include SNP1, SNP2, and SNP3. The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, where S at position 23 bp represents G or C; the nucleotide sequence of SNP2 is shown in SEQ ID NO.2, where S at position 27 bp represents G or C; and the nucleotide sequence of SNP3 is shown in SEQ ID NO.3, where R at position 21 bp represents G or A. Samples carrying the genotypes CC-GG-GG, CC-CC-AA, or GG-CC-AA for SNP1-SNP2-SNP3 respectively have significantly higher soybean protein content than samples carrying the GG-GG-GG genotype. The KASP primer pairs include three sets of primer pairs for detecting SNP1, SNP2, and SNP3. The primer pairs for detecting SNP1 include forward primers 1 and 2 as shown in SEQ ID NO.4-5 and a universal reverse primer as shown in SEQ ID NO.
6. The primer pairs for detecting SNP2 include... The primer pairs for detecting SNP3 include reverse primers 1 and 2 as shown in SEQ ID NO. 7-8 and the universal forward primer as shown in SEQ ID NO. 9; the primer pairs for detecting SNP3 include forward primers 1 and 2 as shown in SEQ ID NO. 10-11 and the universal reverse primer as shown in SEQ ID NO. 6; the purpose of the breeding is to screen samples with high soybean protein content.
3. The application of a kit for detecting SNP combinations related to soybean protein content in breeding, characterized in that, The SNP combinations associated with soybean protein content include SNP1, SNP2, and SNP3; wherein, the nucleotide sequence of SNP1 is shown in SEQ ID NO.1, where S at position 23 bp represents G or C; the nucleotide sequence of SNP2 is shown in SEQ ID NO.2, where S at position 27 bp represents G or C; and the nucleotide sequence of SNP3 is shown in SEQ ID NO.3, where R at position 21 bp represents G or A. The soybean protein content of samples carrying the SNP1-SNP2-SNP3 genotypes CC-GG-GG, CC-CC-AA, or GG-CC-AA are significantly higher than that of samples carrying the GG-GG-GG genotype. The kit includes three primer pairs for detecting SNP1, SNP2, and SNP3. The primer pairs for detecting SNP1 include forward primers 1 and 2 as shown in SEQ ID NO.4-5 and a universal reverse primer as shown in SEQ ID NO.6; the primer pairs for detecting SNP2 include... The primer pairs for detecting SNP3 include reverse primers 1 and 2 as shown in SEQ ID NO. 7-8 and the universal forward primer as shown in SEQ ID NO. 9; the primer pairs for detecting SNP3 include forward primers 1 and 2 as shown in SEQ ID NO. 10-11 and the universal reverse primer as shown in SEQ ID NO. 6; the purpose of the breeding is to screen samples with high soybean protein content.
4. The application according to claim 3, characterized in that, The kit also includes KASP Master Mix, PCR reaction buffer, negative control, and positive control.
5. The application according to claim 4, characterized in that, The nucleotide sequence of the positive control is shown in SEQ ID NO.13-18.
6. A method for detecting SNP combinations related to soybean protein content, characterized in that, It includes the following steps: S1. Extract genomic DNA from the soybean sample to be tested; S2. Using the extracted DNA as a template, PCR amplification was performed using KASP-labeled primer pairs. The KASP primer pairs included: a primer pair for detecting SNP1 consisting of forward primers 1 and 2 as shown in SEQ ID NO. 4-5 and a universal reverse primer as shown in SEQ ID NO. 6; a primer pair for detecting SNP2 consisting of reverse primers 1 and 2 as shown in SEQ ID NO. 7-8 and a universal forward primer as shown in SEQ ID NO. 9; and a primer pair for detecting SNP3 consisting of forward primers 1 and 2 as shown in SEQ ID NO. 10-11 and a universal reverse primer as shown in SEQ ID NO.
6. S3. Perform fluorescence detection on the PCR amplification products, and determine the genotype of the sample at the tag SNP site by analyzing the fluorescence signal intensity. S4. Based on the genotype determined in step S3, determine the SNP combination type carried by the sample.
7. The method as described in claim 6, characterized in that, The PCR amplification program consisted of: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, followed by annealing and extension at 61℃ for 60 s, for 10 cycles with a decrease of 0.6℃ per cycle; denaturation at 94℃ for 20 s, followed by annealing and extension at 55℃ for 60 s, for 35 cycles; and final extension at 72℃ for 5 min.
8. The application of the method according to claim 6 or 7 in breeding, characterized in that, The purpose of the breeding is to screen soybean samples with high protein content, and to obtain soybean samples with high protein content whose genotypes for SNP1-SNP2-SNP3 correspond to CC-GG-GG or CC-CC-AA respectively.
9. The application of the method of claim 6 or 7 in screening soybeans with high protein content.
Citation Information
Patent Citations
Soybean protein content QTL (Quantitative Trait Loci) qPRO111 as well as molecular marker and application thereof
CN116516049A
KASP molecular marker for identifying soybean protein content and application
CN120555639A