Corynebacterium glutamicum and use thereof
By introducing the Peftu, Psod, or PH36 promoter and xylAB gene into Corynebacterium glutamicum and combining it with the PntAB gene, the problem of low efficiency in lysine production from lignocellulose fermentation in existing technologies has been solved. This has enabled high-yield fermentation with efficient utilization of glucose and xylose, thereby improving lysine production capacity.
Patent Information
- Application Number
- CN202111165962.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-09-30
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2041-09-30
AI Technical Summary
The lack of existing Corynebacterium glutamicum strains capable of utilizing glucose and xylose leads to low efficiency in the fermentation of lignocellulose to produce lysine and insufficient tolerance to inhibitors derived from lignocellulose.
By introducing an expression cassette containing the Peftu, Psod, or PH36 promoter and the xylAB gene, preferably combined with the PntAB gene, a starting strain C. glutamicum B253 was constructed to achieve efficient utilization of xylose and high-yield fermentation of glucose.
The modified strain significantly increased lysine production and was able to ferment efficiently in straw hydrolysate containing glucose and xylose, thus enhancing lysine production capacity and demonstrating promising application prospects.
Smart Images

Figure BDA0003291656020000081 
Figure BDA0003291656020000082 
Figure BDA0003291656020000091
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and relates to a Corynebacterium glutamicum and application thereof. BACKGROUND
[0002] Lysine is an important amino acid, which is widely used in food and feed fields, and is also a polymerization monomer of nylon material. The annual output of lysine reached 2 million tons in 2013, and the demand is very large. At present, the most common method for producing lysine is to use food starch as raw material to produce lysine through microbial fermentation. However, the expensive starch raw material greatly increases the production cost of lysine, hindering the commercial application of lysine. In order to reduce the cost of raw materials, some cheap carbon sources such as crude glycerol and silage feed juice have been tried to be used for producing lysine, but the product concentration is too low to be practically applied. Among the many cheap carbon sources, lignocellulose is the only reliable renewable carbon source due to its large supply and wide source.
[0003] Lignocellulose is mainly composed of cellulose, hemicellulose and lignin, and the xylose from hemicellulose accounts for 30% of the total sugar of lignocellulose. Using xylose for fermentation to produce lysine is one of the core steps of efficiently using lignocellulose biomass to produce lysine.
[0004] Corynebacterium glutamicum has a wide substrate production potential and is used to synthesize various amino acids, organic acids and biofuels and other bio-based chemicals. Conventional Corynebacterium glutamicum cannot utilize xylose, so it is a prerequisite for its lignocellulose fermentation to be able to utilize xylose in lignocellulose through metabolic engineering and synthetic biology modification.
[0005] The application with the application number CN201811465343.X and the title of "Recombinant Corynebacterium glutamicum with high yield of L-lysine and construction method thereof" discloses a method for improving lysine yield by introducing a phosphoglyceraldehyde dehydrogenase encoding gene gapC into the genome of Corynebacterium glutamicum CICC 23604. The high-yield lysine engineering strain constructed by the method can only utilize glucose, but cannot utilize xylose, so it is difficult to be applied to the lignocellulose fermentation to produce lysine.
[0006] The application with the application number CN200510076242.X and the title of "Method for fermentation to produce L-amino acid using bacteria with enhanced expression of xylose utilization genes" discloses a method for constructing a xylose to lysine synthesis pathway by expressing xylABFGHR gene locus derived from Escherichia coli MG1655 in Escherichia coli WC196ΔcadAΔldc through a plasmid. The starting strain used in the method is Escherichia coli, which has weak tolerance to inhibitors from lignocellulose and cannot grow normally and ferment lysine in a lignocellulose system.
[0007] Summarizing the above documents, the biggest obstacle to the fermentation production of lysine from lignocellulose is the lack of a strain that can utilize glucose and xylose and has strong tolerance to lignocellulose-derived inhibitors. Therefore, there is no report on the high-yield production of lysine from glucose and xylose in lignocellulose. SUMMARY
[0008] In view of the lack of a high-yield lysine production genetically engineered bacterium in the prior art, the present application provides an expression cassette capable of improving the lysine production of Corynebacterium glutamicum and a genetically engineered bacterium capable of efficiently producing lysine from straw hydrolysate. The genetically engineered bacterium can effectively utilize glucose and xylose in straw in the straw hydrolysate.
[0009] To solve the above technical problems, one of the technical solutions provided by the present application is an expression cassette, which comprises a promoter and a xylAB gene, wherein the promoter is Peftu, Psod or PH36.
[0010] Preferably, the nucleotide sequence of the xylAB gene is shown in SEQ ID NO: 4, or has at least about 95% identity with SEQ ID NO: 4.
[0011] Preferably, the nucleotide sequence of the Peftu promoter is shown in SEQ ID NO: 1, the nucleotide sequence of the Psod promoter is shown in SEQ ID NO: 2, and the nucleotide sequence of the PH36 promoter is shown in SEQ ID NO: 3.
[0012] To solve the above technical problems, another technical solution provided by the present application is an expression cassette combination comprising expression cassette A and expression cassette B, wherein the expression cassette A is the expression cassette according to the first technical solution, and the expression cassette B comprises a promoter and a PntAB gene; the nucleotide sequence of the PntAB gene is shown in SEQ ID NO: 8, and the promoter of the expression cassette B is Peftu with the nucleotide sequence shown in SEQ ID NO: 1, Psod with the nucleotide sequence shown in SEQ ID NO: 2, or PH36 with the nucleotide sequence shown in SEQ ID NO: 3.
[0013] Preferably, the nucleotide sequence of the expression cassette A is shown in SEQ ID NO: 5, and the nucleotide sequence of the expression cassette B is shown in SEQ ID NO: 9.
[0014] To solve the above technical problems, a third technical solution provided by the present application is a recombinant vector comprising the expression cassette according to the first technical solution or the expression cassette combination according to the second technical solution.
[0015] Preferably, when the recombinant vector comprises the expression cassette combination, the expression cassette A forms a recombinant integration vector with the backbone plasmid pK18mob; and the expression cassette B forms a recombinant expression vector with the backbone plasmid pPeftumob.
[0016] To solve the above technical problems, a fourth technical solution provided by the present application is a genetically engineered bacterium comprising the expression cassette according to the first technical solution or the expression cassette combination according to the second technical solution, wherein the genetically engineered bacterium is derived from Corynebacterium glutamicum, and the genetically engineered bacterium overexpresses the gene in the expression cassette or the expression cassette combination.
[0017] Preferably, the genetically engineered bacterium does not express the ldh gene, for example, the ldh gene is knocked out.
[0018] Preferably, after the expression cassette or the expression cassette combination is introduced into the starting bacterium, the expression cassette, the expression cassette A and / or the expression cassette B is integrated into the genome of the starting bacterium by homologous recombination, or exists in the starting bacterium in a non-integrated form.
[0019] In a preferred embodiment of the present application, the starting bacterium is C. glutamicum B253.
[0020] Preferably, when the genetically engineered bacterium comprises the expression cassette, the expression cassette is integrated into the genome of the starting bacterium; and when the genetically engineered bacterium comprises the expression cassette combination, the expression cassette A is integrated into the genome of the starting bacterium, and the expression cassette B exists in the starting bacterium in a non-integrated form.
[0021] More preferably, when the genetically engineered bacterium comprises the expression cassette, a recombinant integration vector comprising the expression cassette is introduced into the starting bacterium, so that the expression cassette is integrated into the ldh gene site on the genome; and / or when the genetically engineered bacterium comprises the expression cassette combination, the expression cassette A is integrated into the ldh gene site on the genome, and the non-integrated form is that a recombinant expression vector comprising the expression cassette B is transformed into the starting bacterium.
[0022] To solve the above technical problems, a fifth technical solution provided by the present application is a method for preparing lysine, the method comprising fermenting the genetically engineered bacterium according to the fourth technical solution in a fermentation medium.
[0023] Preferably, the fermentation medium is a medium containing glucose and / or xylose, such as a straw hydrolysate, which is a hydrolysate formed by enzymatic saccharification of crop straw, in which macromolecular carbohydrates such as cellulose, hemicellulose and lignin are degraded into small molecular carbohydrates such as glucose and xylose. The medium contains, for example, not less than 25 g / L of glucose and / or 25 g / L of xylose, such as 80-110 g / L of glucose and 25-40 g / L of xylose.
[0024] Further, the crop straw can be pretreated before being subjected to enzymatic saccharification to prepare the hydrolysate, such as screening, impurity removal, dry acid pretreatment and / or biological detoxification, so as to improve the saccharification efficiency of the crop straw and reduce the content of impurities such as acetic acid, furfural and 5-hydroxybenzaldehyde.
[0025] And / or, the fermentation conditions are: the temperature is 28-32℃, and / or, the aeration amount is 1.0-1.7vvm, and / or, the pH is 6.8-7.2, and / or, stirring is performed during fermentation, and the stirring speed is 400-800rpm.
[0026] To solve the above technical problems, the technical solution four provided by the present application is: the application of the expression cassette of the technical solution one, the expression cassette combination of the technical solution two, the recombinant vector of the technical solution three or the genetically engineered bacteria of the technical solution four in the preparation of lysine.
[0027] To solve the above technical problems, the technical solution five provided by the present application is: a preparation method of the genetically engineered bacteria of the technical solution four, comprising the following steps (not in order):
[0028] (1) introducing the expression cassette of the technical solution one or the expression cassette combination of the technical solution two into a starting bacterium, wherein the starting bacterium is C. glutamicum B253;
[0029] (2) knocking out the ldh gene to obtain the genetically engineered bacteria.
[0030] Preferably, in the preparation method, the expression cassette combination of the technical solution two is first introduced into the starting bacterium, wherein the starting bacterium is C. glutamicum B253, and then the ldh gene is knocked out to obtain the genetically engineered bacteria.
[0031] On the basis of conforming to the common sense in the art, the above-mentioned preferred conditions can be combined arbitrarily, that is, each preferred example of the present application is obtained.
[0032] The reagents and raw materials used in the present application are commercially available.
[0033] The positive progress effect of the present application is that:
[0034] The Peftu as the promoter of xylAB in the expression cassette provided by the present application can make it be expressed efficiently, thereby promoting the utilization of xylose by the starting strain. In addition to the high expression of Peftu, the genetically engineered strain provided by the present application preferably highly expresses the PntAB gene, and achieves a significantly better fermentation effect than the genetically engineered strain highly expressing other lysine synthesis promoting genes or knocking out lysine synthesis inhibiting genes. When using a straw hydrolysate containing glucose and xylose, the lysine yield of the genetically engineered strain of the present application is obviously improved compared with the starting strain. The genetically engineered strain provided by the present application can effectively utilize agricultural waste such as straw for fermentation, and has a good application prospect. DETAILED DESCRIPTION
[0035] The present application will be further described by way of examples, but the present application is not limited in the scope of the examples. The experimental methods not specified in the following examples are selected according to conventional methods and conditions, or according to the instructions of the commodity.
[0036] I. Strains used in the present application
[0037] Escherichia coli DH5α was used for the construction of expression plasmids and knockout plasmids, and E. coli BL21 was used to provide xylose utilization genes from E. coli. C. glutamicum B253 is a strain for producing lysine, which was purchased from Shanghai Industrial Microbes Institute (SIIM, Shanghai, China). In the present experiment, C. glutamicum B253 was mainly used as a starting strain.
[0038] II. Reagents and media
[0039] Cellulase CTec 2.0 for hydrolysis of cellulose and hemicellulose in lignocellulose was purchased from Novozymes (China) Co., Ltd. (Beijing, China). The filter paper enzyme activity of cellulase was measured to be 203.2 FPU / mL, the cellobiase activity was measured to be 4900.0 CBU / mL according to the method in NREL LAP-006 guide, and the protein concentration was measured to be 87.3 mg / mL according to the Bradford method. Restriction enzymes for cutting plasmids or gene fragments to generate sticky ends were purchased from Thermo Scientific (Wilmington, DE, USA). DNA polymerase for amplifying gene fragments and DNA ligase for ligating the cut gene fragments and plasmid vectors were purchased from Takara (Otsu, Japan). Seamless cloning kit for ligating gene fragments containing homologous fragments and plasmid vectors was purchased from Hanheng Biotechnology Co., Ltd. (Nanjing, China). Plasmid extraction kit, PCR product purification and recovery kit and gel recovery kit were purchased from Shanghai Jeery Biotech Co., Ltd. (Shanghai, China). Other reagents were purchased from local suppliers.
[0040] The culture medium used for culturing E. coli was Luria-Bertani (LB) medium, and the specific components were as follows: 10.0 g / L sodium chloride, 10.0 g / L peptone and 5.0 g / L yeast extract.
[0041] The culture medium used for culturing C. glutamicum had the following specific components:
[0042] (1) Seed medium: 25 g / L glucose, 1.5 g / L potassium dihydrogen phosphate, 2.5 g / L urea and 0.6 g / L magnesium sulfate, 25 g / L corn steep liquor.
[0043] (2) Fermentation medium: 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, 20 g / L corn steep liquor, and glucose and / or xylose were added as carbon source as appropriate.
[0044] Example 1: Starting strain C. glutamicum B253
[0045] After acid pretreatment, detoxification and enzymatic hydrolysis of wheat straw, wheat straw hydrolysate was obtained, and multiple strains of C. glutamicum were cultured in corn straw hydrolysate. It was found that C. glutamicum B253 (C. glutamicum B253) showed the highest cell growth and lysine production capacity. C. glutamicum B253 can utilize straw hydrolysate for fermentation, and C. glutamicum B253 can tolerate the inhibitors (acetic acid, furfural, 5-hydroxybenzaldehyde, etc.) in the straw hydrolysate for normal growth and lysine production.
[0046] Example 2: Integration of Peftu_xylAB expression cassette into the ldh gene locus of C. glutamicum B253 and knockout of the ldh gene
[0047] First, an integration plasmid of xylAB (cluster of genes encoding xylulose isomerase and xylulose kinase) was constructed as follows: the Peftu promoter (as shown in SEQ ID NO: 1) was amplified by PCR using the genome of C. glutamicum as a template and primers Peftu-F (as shown in SEQ ID NO: 13) and Peftu-R (as shown in SEQ ID NO: 14); the xylAB fragment (as shown in SEQ ID NO: 4) was amplified by PCR using the genome of E. coli BL21 as a template and primers xylAB-F (as shown in SEQ ID NO: 19) and xylAB-R (as shown in SEQ ID NO: 20); the Peftu_xylAB fusion fragment (as shown in SEQ ID NO: 5) was obtained by overlap extension PCR using Peftu and xylAB1 as templates and primers Peftu-xylAB-F (as shown in SEQ ID NO: 21) and Peftu-xylAB-R (as shown in SEQ ID NO: 22); the ldh-up fragment (as shown in SEQ ID NO: 6) was amplified by PCR using the genome of C. glutamicum as a template and primers ldh-up-F (as shown in SEQ ID NO: 23) and ldh-up-R (as shown in SEQ ID NO: 24); the ldh-down fragment (as shown in SEQ ID NO: 7) was amplified by PCR using the genome of C. glutamicum as a template and primers ldh-down-F (as shown in SEQ ID NO: 25) and ldh-down-R (as shown in SEQ ID NO: 26); the Δldh::xylAB fusion fragment was obtained by overlap extension PCR using the ldh-up fragment, Peftu_xylAB and ldh-down fragment as templates and primers ldh-up-F and ldh-down-R, and then treated with EcoRI and HindIII endonucleases, and inserted into the pK18mob plasmid (available from http: / / www.biovector.net / product / 1089.html) using T4 ligase to obtain the pK18-Δldh::xylAB plasmid. During this process, the LK plate containing kanamycin was used to screen the successfully ligated plasmid.
[0048] Then, the integrated plasmid pK18-Δldh::xylAB was transformed into C. glutamicum by electroporation, and the strain with correct homologous recombination was screened by PCR verification, and the recombinant C. glutamicum was obtained and named as C. glutamicum XyltoLy01.
[0049] Example 3: Overexpression of transhydrogenase PntAB in the modified strain by plasmid
[0050] First, the expression plasmid of PntAB was constructed, and the specific construction method was as follows: the PntAB (as shown in SEQ ID NO: 8) fragment was amplified by PCR using the genome of E. coli BL21 as the template and using PntAB-F (as shown in SEQ ID NO: 27) and PntAB-R (as shown in SEQ ID NO: 28) primers; and then the PntAB fragment was treated with EcoRI and HindIII endonucleases, and then inserted into the pTRCmob expression plasmid (the purchase route is http: / / www.bioon.com.cn / reagent / show_product.asp?id=4926211) using T4 ligase to obtain the pPeftu-PntAB expression plasmid, wherein the nucleotide sequence of Peftu-PntAB is as shown in SEQ ID NO: 9. Then, the expression plasmid pPeftu-PntAB was transformed into C. glutamicum XyltoLy01 by electroporation, and then the recombinant strain containing the pPeftu-PntAB expression plasmid was screened by PCR verification, and the obtained recombinant C. glutamicum was named as C. glutamicum XyltoLy02.
[0051] Example 4: Fermentation of genetically engineered bacteria constructed by different promoters
[0052] The genetically engineered bacteria were prepared as in Examples 2 and 3, except that the promoters were replaced by Psod (the nucleotide sequence is as shown in SEQ ID NO: 2) and PH36 (the nucleotide sequence is as shown in SEQ ID NO: 3), respectively. The fermentation process was as follows: the fermentation medium included 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, 20 g / L corn syrup, and 40 g / L xylose as the sole carbon source, and 25 μg / mL kanamycin was added. The fermentation was carried out in a 250 mL shake flask, and the culture conditions were 30°C, 200 rpm, and the fermentation time was 96 hours. The fermentation results are shown in Table 1:
[0053] Table 1: Screening of xylose utilization genes and expression promoters
[0054]
[0055] It can be seen that Peftu is the best promoter for xylAB.
[0056] Example 5 Fermentation of genetically engineered bacteria with different promoters
[0057] The genetically engineered bacteria were prepared as in Examples 2 and 3, except that dapA (as shown in SEQ ID NO: 10) was overexpressed by replacing the PntAB gene in the expression plasmid, pck was knocked out by replacing the ldh-up and ldh-down genes with pck-up and pck-down in the knockout plasmid, and xylAB was not introduced.
[0058] The fermentation process was as follows: fermentation medium: 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, 20 g / L corn steep liquor, and containing 25 g / L xylose and 25 g / L glucose. The fermentation was carried out in a 250 mL flask, and the culture conditions were 30°C, 200 rpm, the pH of the medium was adjusted to 7 with 5M NaOH every 6 hours, and the fermentation time was 96 hours. The results are shown in Table 2. It can be seen that the genetically engineered bacteria obtained by introducing the PntAB plasmid into the genetically engineered bacteria of Example 2 have the best fermentation effect.
[0059] Table 2 Expression of different genes to promote lysine production
[0060]
[0061]
[0062] Example 6: Lysine fermentation of modified strains in lignocellulose hydrolysate
[0063] Wheat straw was crushed and then sieved through a 10 mm diameter screen. The sieved straw was then washed with water to remove soil, stones and metal impurities. The dried straw was dried to constant weight in an oven at 105°C and then stored in a sealed plastic bag for use. After dry acid pretreatment, biological detoxification and enzymatic saccharification, wheat straw hydrolysate was obtained, which contained 95.4 g / L glucose and 34.7 g / L xylose. The modified xylose utilization strain C. glutamicum XyltoLy02 and the starting strain C. glutamicum B253 were cultured in wheat straw hydrolysate with the addition of 20 g / L ammonium sulfate and 5 g / L methionine and threonine for fermentation comparison. The fermentation temperature was 30°C, the pH was controlled at 7.0 with ammonia water, the aeration rate was 1.4 vvm, the rotation speed was 600 rpm, and the fermentation time was 72 h.
[0064] The results show that the starting strain can only utilize glucose in the wheat straw hydrolysate, and cannot utilize xylose. At the end of fermentation, 24.1 g / L of lysine is produced, and about 34 g / L of xylose remains unused, and glucose is completely consumed.
[0065] The modified strain C. glutamicum XyltoLy02 can utilize glucose and xylose in the wheat straw hydrolysate, and at the end of fermentation, 33.1 g / L of lysine is produced, and glucose and xylose are completely consumed. Compared with the starting strain, the lysine yield is increased by 37.3%. The fermentation results show that the modified strain obtained by the present application has strong inhibitor tolerance and high lysine production capacity, and has good application prospect.
[0066] The above specifically describes the operation examples of the technical solutions of the present application, and is not regarded as the application limitation of the present application. Any equivalent replacement of the operation conditions is within the protection scope of the present application. SEQUENCE LISTING <110> Shanghai Kaisai Biotechnology Co., Ltd. CIBT America, Inc. <120> Corynebacterium glutamicum and application thereof <130> P21016188C <160> 34 <170> PatentIn version 3.5 <210> 1 <211> 335 <212> DNA <213> artificial sequence <220> <223> Peftu <400> 1 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 agtcgtagcc accacgaagt ccaggaggac ataca 335 <210> 2 <211> 288 <212> DNA <213> artificial sequence <220> <223> Psod <400> 2 agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa tgttcctttc 60 gaaaattgag gaagccttat gccctacaac cctacttagc tgccaattat tccgggcttg 120 tgacccgcta cccaataaat aggtgggctg aaaaatttcg ttgcaatatc aacaaaaagg 180 cctatcattg ggaagtgtcg caccaagtac ttttgcgaag cgccatctga cggattttca 240 aaagatgtat atgctcggtg cggaaaccta cgaaaggatt ttttaccc 288 <210> 3 <211> 95 <212> DNA <213> artificial sequence <220> <223> PH36 <400> 3 caaaagctgg gtacctctat ctggtgccct aaacggggga atattaacgg gcccagggtg 60 gtcgcacctt ggttggtagg agtagcatgg gatcc 95 <210> 4 <211> 2849 <212> DNA <213> artificial sequence <220> <223> xylAB <400> 4 atgcaagcct attttgacca gctcgatcgc gttcgttatg aaggctcaaa atcctcaaac 60 ccgttagcat tccgtcacta caatcccgac gaactggtgt tgggtaagcg tatggaagag 120 cacttgcgtt ttgccgcctg ctactggcac accttctgct ggaacggggc ggatatgttt 180 ggtgtggggg cgtttaatcg tccgtggcag cagcctggtg aggcactggc gttggcgaag 240 cgtaaagcag atgtcgcatt tgagtttttc cacaagttac atgtgccatt ttattgcttc 300 cacgatgtgg atgtttcccc tgagggcgcg tcgttaaaag agtacatcaa taattttgcg 360 caaatggttg atgtcctggc aggcaagcaa gaagagagcg gcgtgaagct gctgtgggga 420 accgccaact gctttacaaa ccctcgctac ggcgcgggtg cggcgacgaa cccagatcct 480 GAAGTCTCTG ATGTTTGGCC GCGGCGGCGG CGGCGGCGGC GCGGCGGCGG 60 GGCGGTGAAA ACTATGTCCT GTGGGGCGGT Cgtgaaggtt acgaaacgct gttaaatacc 600 GACTTGCgtc aggagcgtga acaactgggc cgctttatgc agatggtggt tgagcataaa 660 CATAAAATCG GTTTCCAGGG CACGTTGCTT ATCGAACCGA AACCgcaaga accgaccaaa 720 CATCAATATG ATTACGATGC CGCGACGGTC TATGGCTTCC TGAAACAGTT TGgtctggaa 780 AAAGAGATTA AACTGAACAT TGAAGCTAAC CACGCgacgc tggcaggtca ctctttccat 840 CATGAAATAG CCACCgCCAT TGCgCTTGGC CTGTTcggtt CTGTCGACGC CAACCgTGGC 900 GATGCGCAAC TGGGCTGGGA CACCgACCAG TTCCCgACAG TGTGGAAGAG AATGCGCTG 960 GTGATGTATG AAATTCTCAA AGCAGGCgGT TTCACCACC GGTGgtCTGA CTCGATGCC 1020 AAAGTACGTC GTCAAAGTAC TGATAAATAT GATCTGTTTT ACGGTcatat Cggcgcgatg 1080 GATAcgATGG CACTGGCGCT GAAAATTGCA GCgCATGA TTGAAGATGG CGAGCTGGAT 1140 AAACGCATCG CgcAGCgTTA TTCCGGCTGG AATAGCGAAT TGGGCCAGCA AATCCTGAAA 1200 ggccaaatgt cactggcaga tttagccaaa tatgctcagg aacataattt gtctccggtg 1260 catcagagtg gtcgccagga gcaactggaa aatctggtaa atcattatct gttcgacaaa 1320 taacggctaa ctgtgcagtc cgttggcccg gttatcggta gcgataccgg gcattttttt 1380 aaggaacgat cgatatgtat atcgggatag atcttggcac ctcgggcgta aaagttattt 1440 tgctcaacga gcagggtgag gtggttgctt cgcaaacgga aaagctgacc gtttcgcgcc 1500 cgcatccact ctggtcggaa caagacccgg aacagtggtg gcaggcaact gatcgcgcaa 1560 tgaaagctct gggcgatcag cattctctgc aggacgttaa agcattgggt attgccggcc 1620 agatgcatgg agcaacctta ctggatgctc aacaacgggt attgcgccct gccattttgt 1680 ggaacgacgg gcgctgtgcg caagagtgca ctttgctgga agcgagagtt ccgcaatcac 1740 gagtgattac cggcaacctg atgatgcccg gatttactgc gcctaaattg ctatgggttc 1800 agcggcatga gccggagata ttccgtcaaa tcgacaaagt attattaccg aaagattact 1860 tgcgtctgcg tatgacgggg gagtttgcca gcgatatgtc tgacgcagct ggcaccatgt 1920 ggctggatgt cgcaaagcgt gactggagtg acgtcatgct gcaggcttgc gacttatctc 1980 gtgaccagat gcccgcatta tacgaaggca gcgaaattac tggtgctttg ttacctgaag 2040 ttgcgaaagc gtggggtatg gcgacggtgc cagttgtcgc aggcggtggc gacaatgcag 2100 ctggtgcagt tggtgtggga atggttgatg ctaatcaggc aatgttatcg ctggggacgt 2160 cgggggtcta ttttgctgtc agcgaagggt tcttaagcaa gccagaaagc gccgtacata 2220 gcttttgcca tgcgctaccg caacgttggc atttaatgtc tgtgatgctg agtgcagcgt 2280 cgtgtctgga ttgggccgcg aaattaaccg gcctgagcaa tgtcccagct ttaatcgctg 2340 cagctcaaca ggctgatgaa agtgccgagc cagtttggtt tctgccttat ctttccggcg 2400 agcgtacgcc acacaataat ccccaggcga agggggtttt ctttggtttg actcatcaac 2460 atggccccaa tgaactggcg cgagcagtgc tggaaggcgt gggttatgcg ctggcagatg 2520 gcatggatgt cgtgcatgcc tgcggtatta aaccgcaaag tgttacgttg attgggggcg 2580 gggcgcgtag tgagtactgg cgtcagatgc tggcggatat cagcggtcag cagctcgatt 2640 accgtacggg aggggatgtg gggccagcac tgggcgcagc aaggctggcg cagatcgcgg 2700 cgaatccaga gaaatcgctc attgaattgt tgccgcaact accgttagaa cagtcgcatc 2760 taccagatgc gcagcgttat gccgcttatc agccacgacg agaaacgttc cgtcgcctct 2820 atcagcaact tctgccatta atggcgtaa 2849 <210> 5 <211> 3184 <212> DNA <213> artificial sequence <220> <223> Peftu_xylAB <400> 5 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 agtcgtagcc accacgaagt ccaggaggac atacaatgca agcctatttt gaccagctcg 360 atcgcgttcg ttatgaaggc tcaaaatcct caaacccgtt agcattccgt cactacaatc 420 ccgacgaact ggtgttgggt aagcgtatgg aagagcactt gcgttttgcc gcctgctact 480 ggcacacctt ctgctggaac ggggcggata tgtttggtgt gggggcgttt aatcgtccgt 540 ggcagcagcc tggtgaggca ctggcgttgg cgaagcgtaa agcagatgtc gcatttgagt 600 ttttccacaa gttacatgtg ccattttatt gcttccacga tgtggatgtt tcccctgagg 660 gcgcgtcgtt aaaagagtac atcaataatt ttgcgcaaat ggttgatgtc ctggcaggca 720 agcaagaaga gagcggcgtg aagctgctgt ggggaaccgc caactgcttt acaaaccctc 780 gctacggcgc gggtgcggcg acgaacccag atcctgaagt cttcagctgg gcggcaacgc 840 aagttgttac agcgatggaa gcaacccata aattgggcgg tgaaaactat gtcctgtggg 900 gcggtcgtga aggttacgaa acgctgttaa ataccgactt gcgtcaggag cgtgaacaac 960 tgggccgctt tatgcagatg gtggttgagc ataaacataa aatcggtttc cagggcacgt 1020 tgcttatcga accgaaaccg caagaaccga ccaaacatca atatgattac gatgccgcga 1080 CGGTCTATGG CTTCCCTGAA ACAGTTTGGT CTGGAAAAAG AGATTAACCT GAACATTGAA G 1140 CTAACCACGC GACGCTGGCA GGTCACTCTT TCCATCATGA AAATAGCCAC CGCCATTGCG C 1200 TTGGCCTGTT CGGTTCTGTC GACGCCAACC GTGGCGATGC GCAACTGGGC TGGGACACCG 1260 ACCAGTTCCC GAACAGTGTG GAAGAGAATG CGCTGGTGAT GTATGAAATT CTCAAAGCAG 1320 GCGGTTTCAC CACCGGTGGT CTGAACTTCG ATGCCAAAGT ACGTCGTCAA AGTACTGATA 1380 AATATGATCT GTTTTACGGT CATATCGGCG CGATGGATAC GATGGCACTG GCGCTGAAAA 1440 TTGCAGCGCG CATGATTGAA GATGGCGAGC TGGATAAAAC GCATCGCAGC GTTATTCCG 1500 GCTGGAA TAGC GAATTGGGC CAGCAAATCCTGAAAGGCC AAATGTCAC TG GCAGATTTAG 1560 CCAAATATG CTCAGGAACAT AATTGTCTCC GGTGCATCAG AGTGGTCGCC AGGAGCAAC 1620 TGGAAAATCT GGTAATATTA TCTGTTCGAC AAATAACGGC TAAC TGTGCAGTC C GTTG 1680 GCCC GGTATC GGTAGCGAT ACCGGGCATTTTTT TAAGGAACGA TC GATATGTAT ATC GG 1740 GATAGATCTT GGCACCTCGG GCGTAAAAGT TATT TTGCTCAACG AGCAGG TGA GGTGGT 1800 TGCTTCGCAA ACGGAAAAGC TGACCCTTTT CGCCGCCCAT CCACCTTGGT CGGAACAAGA 1860 CCCGGAACAG TGTTGGCAGG CAACCGATCG CGCAATGAAA GCTCTGGGCG ATCAGCATT 1920 TCTGCAGGAC GTTAAGCATC GGCTATTGCC GGCCAGATGC ATGGAGCAAC CTTACTGGA 1980 TGCTCAACAACGGGTATTGC GCCCTGCCAT TTTGTGGAAC GACGGGCGCT GTGCGCAAGA 2040 GTGCACCTTG CTGGAAGCGA GATTCGCAAT CACGAGTGAT TACCGGCAAC CTGATGAT 2100 GCCCAGATTG CTATGAGTTC AGCGGATGAG CCAGAGATAT TCCTG 2160 TCAATCGACA AAGTATTATT ACCGAAAGAT TACTTGCCTC TGCCTATGAC GGGGGAGTT 2220 TGCCAGCGAT ATGTCTGACG CAGCTGGCAC CATGTGGCTG GATGTCGCAA AGCCTGACT 2280 GAGTGACGTC ATGCTGCAGG CTTGCGACTT ATCTCGTGAC CAGATGCCCG CATTATCGA 2340 AGGCAGCGAA ATTACTGGTG CTTGTTACCT GAGGTTGCGA AGCCTGGGG TATGGCGAC 2400 GGTGCCAGTT GTCGCAGGCG GTGGCGACAA TGCAGCTGGT GCAGTTGGTG TGGGAATGGT 2460 TGATGCTAAT CAGGCAATGT TATCGCTGGG GACGTCGGGG GTCTATTTTG CTGTCAGCG 2520 agggttctta agcaagccag aaagcgccgt acatagcttt tgccatgcgc taccgcaacg 2580 ttggcattta atgtctgtga tgctgagtgc agcgtcgtgt ctggattggg ccgcgaaatt 2640 aaccggcctg agcaatgtcc cagctttaat cgctgcagct caacaggctg atgaaagtgc 2700 cgagccagtt tggtttctgc cttatctttc cggcgagcgt acgccacaca ataatcccca 2760 ggcgaagggg gttttctttg gtttgactca tcaacatggc cccaatgaac tggcgcgagc 2820 agtgctggaa ggcgtgggtt atgcgctggc agatggcatg gatgtcgtgc atgcctgcgg 2880 tattaaaccg caaagtgtta cgttgattgg gggcggggcg cgtagtgagt actggcgtca 2940 gatgctggcg gatatcagcg gtcagcagct cgattaccgt acgggagggg atgtggggcc 3000 agcactgggc gcagcaaggc tggcgcagat cgcggcgaat ccagagaaat cgctcattga 3060 attgttgccg caactaccgt tagaacagtc gcatctacca gatgcgcagc gttatgccgc 3120 ttatcagcca cgacgagaaa cgttccgtcg cctctatcag caacttctgc cattaatggc 3180 gtaa 3184 <210> 6 <211> 943 <212> DNA <213> artificial sequence <220> <223> ldh-up <400> 6 ggaacaccat gcgattaagg tgcgctgctt gaattgcaga attatgcaag atgcgccgca 60 acaaaacgcg atcggccaag gtcaaagtgg tcaatgtaat gaccgaaacc gctgcgatga 120 aactaatcca cggcggtaaa aacctctcaa ttaggagctt gacctcatta atgctgtgct 180 gggttaattc gccggtgatc agcagcgcgc cgtaccccaa ggtgccgaca ctaatgcccg 240 cgatcgtctc cttcggtcca aaattcttct gcccaatcag ccggatttgg gtgcgatgcc 300 tgatcaatcc cacaaccgtg gtggtcaacg tgatggcacc agttgcgatg tgggtggcgt 360 tgtaaatttt cctggatacc cgccggttgg ttctggggag gatcgagtgg attcccgtcg 420 ctgacgcatg ccccaccgct tgtaaaacag ccaggttagc agccgtaacc caccacggtt 480 tcggcaacaa tgacggcgag agagcccacc acattgcgat ttccgctccg ataaagccag 540 cgcccatatt tgcagggagg attcgcctgc ggtttggcga cattcggatc cccggaacca 600 gctctgcaat cacctgcgcg ccgagggaag cgaggtgggt ggcaggtttt agtgcgggtt 660 taagcgttgc caggcgagtg gtgagcagag acgctagtct ggggagcgaa accatattga 720 gtcatcttgg cagagcatgc acaattctgc agggcataga ttggttttgc tcgatttaca 780 atgtgatttt ttcaacaaaa ataacacatg gtctgaccac attttcggac ataatcgggc 840 ataattaaag gtgtaacaaa ggaatccggg cacaagctct tgctgatttt ctgagctgct 900 ttgtgggttg tccggttagg gaaatcagga agtgggatcg aaa 943 <210> 7 <211> 959 <212> DNA <213> artificial sequence <220> <223> ldh-down <400> 7 atctttggcg cctagttggc gacgcaagtg tttcattgga acacttgcgc tgccaacttt 60 ttggtttacg ggcaaaatga aactgttgga tggaatttaa agtgtttgta gcttaaggag 120 ctcaaatgaa tgagtttgac caggacattc tccaggagat caagactgaa ctcgacgagt 180 taattctaga acttgatgag gtgacacaaa ctcacagcga ggccatcggg caggtctccc 240 caacccatta cgttggtgcc cgcaacctca tgcattacgc gcatcttcgc accaaagacc 300 tccgtggcct gcagcaacgc ctctcctctg tgggagctac ccgcttgact accaccgaac 360 cagcagtgca ggcccgcctc aaggccgccc gcaatgttat cggagctttc gcaggtgaag 420 gcccacttta tccaccctca gatgtcgtcg atgccttcga agatgccgat gagattctcg 480 acgagcacgc cgaaattctc cttggcgaac ccctaccgga tactccatcc tgcatcatgg 540 tcaccctgcc caccgaagcc gccaccgaca ttgaacttgt ccgtggcttc gccaaaagcg 600 gcatgaatct agctcgcatc aactgtgcac acgacgatga aaccgtctgg aagcagatga 660 tcgacaacgt ccacaccgtt gcagaagaag ttggccggga aatccgcgtc agcatggacc 720 ttgccggacc aaaagtacgc accggcgaaa tcgccccagg cgcagaagta ggtcgcgcac 780 gagtaacccg cgacgaaacc ggaaaagtac tgacgcccgc aaaactgtgg atcaccgccc 840 acggctccga accagtccca gcccccgaaa gcctgcccgg tcgccccgct ctgccgattg 900 aagtcacccc agaatggttc gacaaactag aaatcggcag cgtcatcaac gtcccagac 959 <210> 8 <211> 2932 <212> DNA <213> artificial sequence <220> <223> PntAB <400> 8 atgcgaattg gcataccaag agaacggtta accaatgaaa cccgtgttgc agcaacgcca 60 aaaacagtgg aacagctgct gaaactgggt tttaccgtcg cggtagagag cggcgcgggt 120 caactggcaa gttttgacga taaagcgttt gtgcaagcgg gcgctgaaat tgtagaaggg 180 aatagcgtct ggcagtcaga gatcattctg aaggtcaatg cgccgttaga tgatgaaatt 240 gcgttactga atcctgggac aacgctggtg agttttatct ggcctgcgca gaatccggaa 300 ttaatgcaaa aacttgcgga acgtaacgtg accgtgatgg cgatggactc tgtgccgcgt 360 atctcacgcg cacaatcgct ggacgcacta agctcgatgg cgaacatcgc cggttatcgc 420 gccattgttg aagcggcaca tgaatttggg cgcttcttta ccgggcaaat tactgcggcc 480 gggaaagtgc caccggcaaa agtgatggtg attggtgcgg gtgttgcagg tctggccgcc 540 attggcgcag caaacagtct cggcgcgatt gtgcgtgcat tcgacacccg cccggaagtg 600 aaagaacaag ttcaaagtat gggcgcggaa ttcctcgagc tggattttaa agaggaagct 660 ggcagcggcg atggctatgc caaagtgatg tcggacgcgt tcatcaaagc ggaaatggaa 720 ctctttgccg cccaggcaaa agaggtcgat atcattgtca ccaccgcgct tattccaggc 780 aaaccagcgc cgaagctaat tacccgtgaa atggttgact ccatgaaggc gggcagtgtg 840 attgtcgacc tggcagccca aaacggcggc aactgtgaat acaccgtgcc gggtgaaatc 900 ttcactacgg aaaatggtgt caaagtgatt ggttataccg atcttccggg ccgtctgccg 960 acgcaatcct cacagcttta cggcacaaac ctcgttaatc tgctgaaact gttgtgcaaa 1020 gagaaagacg gcaatatcac tgttgatttt gatgatgtgg tgattcgcgg cgtgaccgtg 1080 atccgtgcgg gcgaaattac ctggccggca ccgccgattc aggtatcagc tcagccgcag 1140 gcggcacaaa aagcggcacc ggaagtgaaa actgaggaaa aatgtacctg ctcaccgtgg 1200 cgtaaatacg cgttgatggc gctggcaatc attctttttg gctggatggc aagcgttgcg 1260 ccgaaagaat tccttgggca cttcaccgtt ttcgcgctgg cctgcgttgt cggttattac 1320 gtggtgtgga atgtatcgca cgcgctgcat acaccgttga tgtcggtcac caacgcgatt 1380 TCGGATGGCT GAAAGAAGCC GAGGAGGCTG TACACCGACA CAGAGCCCGA 60 CTTATCGGTA TCGGTAACCA TGGTAACCGA TGGTAACCGA TGGTAACCGA 120 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 TATCGGTAAC CATGGTAACC GATGGTAACC GATGGTAACC GATGGTAACC G 180 gcaagtgctg gcattgctga taatgaccgc aattgcgctg gtattcggct ggcatttagt 2160 cgcctccatc ggtggtgcag atatgccagt ggtggtgtcg atgctgaact cgtactccgg 2220 ctgggcggct gcggctgcgg gctttatgct cagcaacgac ctgctgattg tgaccggtgc 2280 gctggtcggt tcttcggggg ctatcctttc ttacattatg tgtaaggcga tgaaccgttc 2340 ctttatcagc gttattgcgg gtggtttcgg caccgacggc tcttctactg gcgatgatca 2400 ggaagtgggt gagcaccgcg aaatcaccgc agaagagaca gcggaactgc tgaaaaactc 2460 ccattcagtg atcattactc cggggtacgg catggcagtc gcgcaggcgc aatatcctgt 2520 cgctgaaatt actgagaaat tgcgcgctcg tggtattaat gtgcgtttcg gtatccaccc 2580 ggtcgcgggg cgtttgcctg gacatatgaa cgtattgctg gctgaagcaa aagtaccgta 2640 tgacatcgtg ctggaaatgg acgagatcaa tgatgacttt gctgataccg ataccgtact 2700 ggtgattggt gctaacgata cggttaaccc ggcggcgcag gatgatccga agagtccgat 2760 tgctggtatg cctgtgctgg aagtgtggaa agcgcagaac gtgattgtct ttaaacgttc 2820 GATGAACACT GGCTATGCTG GTGTGCAAAA CCCGCTGTTCTTCAAGGAAA ACACCCACAT 2880 GCTGTTTGGT GACGCCAAAG CCAGCGTGGA TGCAATCCTG AAAGCTCTGT AA 2932 <210> 9 <211> 3295 <212> DNA <213> artificial sequence <220> <223> Peftu_PntAB <400> 9 CGAAAAGCAATTTGCTTTTC GACGCCCCACC CCgcgcgttttagcgtgtc agtaggcgcg 60 TAGGGTAAGTG GGGTAGCGGCTTGTTAGAT ATCTTGAATC GGCTTTCAAC AGCATTGAT 120 TTCGATGTAT TTAGCTGGCC GTTACCCTGC GAATGTCCAC AGGGTAGCTG GTAGTTTGA A 180 AATCAACGCC GTTGCCTTAA GGATTCA GTA ACTGGCACATTTTGTAATGC GCTAGATCTG 240 TGTGCTCAGT CTTCCAGGCT GCTTATCACA GTGAAAGCAA AACCAATTCG TGGCTGCAAA 300 AGTCGTAGCC ACCACGAAGT CCAGGAGGAC ATACAACCAT GGAATTCGAG CTCGTA CCC 360 GGGATGCGAA TTGGCATACC AAGAGAACGG TTAACCAATG AAACCCGTGT TGCAGCAACG 420 CCAAAAACAG TGGAACAGCT GCTGAAACTG GGTTTTACCG TCgcggtagag cGGCgcg 480 ggtcaactgg caagttttga cgataaagcg tttgtgcaag cgggcgctga aattgtagaa 540 gggaatagcg tctggcagtc agagatcatt ctgaaggtca atgcgccgtt agatgatgaa 600 attgcgttac tgaatcctgg gacaacgctg gtgagtttta tctggcctgc gcagaatccg 660 gaattaatgc aaaaacttgc ggaacgtaac gtgaccgtga tggcgatgga ctctgtgccg 720 cgtatctcac gcgcacaatc gctggacgca ctaagctcga tggcgaacat cgccggttat 780 cgcgccattg ttgaagcggc acatgaattt gggcgcttct ttaccgggca aattactgcg 840 gccgggaaag tgccaccggc aaaagtgatg gtgattggtg cgggtgttgc aggtctggcc 900 gccattggcg cagcaaacag tctcggcgcg attgtgcgtg cattcgacac ccgcccggaa 960 gtgaaagaac aagttcaaag tatgggcgcg gaattcctcg agctggattt taaagaggaa 1020 gctggcagcg gcgatggcta tgccaaagtg atgtcggacg cgttcatcaa agcggaaatg 1080 gaactctttg ccgcccaggc aaaagaggtc gatatcattg tcaccaccgc gcttattcca 1140 ggcaaaccag cgccgaagct aattacccgt gaaatggttg actccatgaa ggcgggcagt 1200 gtgattgtcg acctggcagc ccaaaacggc ggcaactgtg aatacaccgt gccgggtgaa 1260 atcttcacta cggaaaatgg tgtcaaagtg attggttata ccgatcttcc gggccgtctg 1320 ccgacgcaat cctcacagct ttacggcaca aacctcgtta atctgctgaa actgttgtgc 1380 aaagagaaag acggcaatat cactgttgat tttgatgatg tggtgattcg cggcgtgacc 1440 gtgatccgtg cgggcgaaat tacctggccg gcaccgccga ttcaggtatc agctcagccg 1500 caggcggcac aaaaagcggc accggaagtg aaaactgagg aaaaatgtac ctgctcaccg 1560 tggcgtaaat acgcgttgat ggcgctggca atcattcttt ttggctggat ggcaagcgtt 1620 gcgccgaaag aattccttgg gcacttcacc gttttcgcgc tggcctgcgt tgtcggttat 1680 tacgtggtgt ggaatgtatc gcacgcgctg catacaccgt tgatgtcggt caccaacgcg 1740 atttcaggga ttattgttgt cggagcactg ttgcagattg gccagggcgg ctgggttagc 1800 ttccttagtt ttatcgcggt gcttatagcc agcattaata ttttcggtgg cttcaccgtg 1860 actcagcgca tgctgaaaat gttccgcaaa aattaagggg taacatatgt ctggaggatt 1920 agttacagct gcatacattg ttgccgcgat cctgtttatc ttcagtctgg ccggtctttc 1980 gaaacatgaa acgtctcgcc agggtaacaa cttcggtatc gccgggatgg cgattgcgtt 2040 aatcgcaacc atttttggac cggatacggg taatgttggc tggatcttgc tggcgatggt 2100 cattggtggg gcaattggta tccgtctggc gaagaaagtt gaaatgaccg aaatgccaga 2160 actggtggcg atcctgcata gcttcgtggg tctggcggca gtgctggttg gctttaacag 2220 ctatctgcat catgacgcgg gaatggcacc gattctggtc aatattcacc tgacggaagt 2280 gttcctcggt atcttcatcg gggcggtaac gttcacgggt tcggtggtgg cgttcggcaa 2340 actgtgtggc aagatttcgt ctaaaccatt gatgctgcca aaccgtcaca aaatgaacct 2400 ggcggctctg gtcgtttcct tcctgctgct gattgtattt gttcgcacgg acagcgtcgg 2460 cctgcaagtg ctggcattgc tgataatgac cgcaattgcg ctggtattcg gctggcattt 2520 agtcgcctcc atcggtggtg cagatatgcc agtggtggtg tcgatgctga actcgtactc 2580 cggctgggcg gctgcggctg cgggctttat gctcagcaac gacctgctga ttgtgaccgg 2640 tgcgctggtc ggttcttcgg gggctatcct ttcttacatt atgtgtaagg cgatgaaccg 2700 ttcctttatc agcgttattg cgggtggttt cggcaccgac ggctcttcta ctggcgatga 2760 tcaggaagtg ggtgagcacc gcgaaatcac cgcagaagag acagcggaac tgctgaaaaa 2820 ctcccattca gtgatcatta ctccggggta cggcatggca gtcgcgcagg cgcaatatcc 2880 tgtcgctgaa attactgaga aattgcgcgc tcgtggtatt aatgtgcgtt tcggtatcca 2940 cccggtcgcg gggcgtttgc ctggacatat gaacgtattg ctggctgaag caaaagtacc 3000 gtatgacatc gtgctggaaa tggacgagat caatgatgac tttgctgata ccgataccgt 3060 actggtgatt ggtgctaacg atacggttaa cccggcggcg caggatgatc cgaagagtcc 3120 gattgctggt atgcctgtgc tggaagtgtg gaaagcgcag aacgtgattg tctttaaacg 3180 ttcgatgaac actggctatg ctggtgtgca aaacccgctg ttcttcaagg aaaacaccca 3240 catgctgttt ggtgacgcca aagccagcgt ggatgcaatc ctgaaagctc tgtaa 3295 <210> 10 <211> 939 <212> DNA <213> artificial sequence <220> <223> dapA <400> 10 atggcttccg caactttcac cggcgtgatc ccacccgtaa tgaccccact ccacgccgac 60 ggcagcgtag atgtagaaag cctccgcaag ctcgttgacc acctcatcaa tggtggcgtc 120 gacggacttt tcgcactggg ctcctcaggc gaagcggcat tcctcaccca cacccagcgc 180 aaacttgcac tgacgactat catcgagcac accgcaggcc gcgttcctgt aactgctgat 240 gtcattgaaa ccaccactgc tcgcgtgatt gagctcgtgg aagatgccct ggaagctggt 300 gccgaaggcc tcattgccac cgcacctttc tacacccgca cccacgatgt ggaaattgaa 360 gaacacttcc gcaagatcca cgccgtcgct ccagagctcc cactgtttgc ctacaacatc 420 ccagtgtcgg tgcactccaa cctcaaccca gtcatgcttt tgacgctggc caaggatggc 480 gttctcgcag gcaccaaaga ttccagtggc aatgatggcg caatccgctc actgatcgaa 540 gctcgtgatg atgctggact cactgagcag ttcaagatcc tcaccggcag cgaaaccacc 600 gttgatttct cctaccttgc tggtgccgat ggagttgtcc caggcctagg caatgttgat 660 CCTGCAGCATACGCAGCTTTAGCAA AACTCTGCCTCGATGGAAAGTGGGCAGAAGCTGCT 720 GCTTTGCAGAAGCGCATCAACCACCTCTTCCACATCGTCTTCGTGGGAGACCTCCCAT 780 ATGTCCGGATCCAGCGCTGGTTTGGGCGGTTTCAAGACAGC ACTCGCACACCTTGGCATT 840 ATTGAATCCAATGCGATGGCAGTTCCTCACCAGAGCCTCAGCGACGAAGA AACTGCTCGC 900 ATTCACGCCATTGTTCATGAATTCCCTGTACACC GCTTA A 939 <210> 11 <211> 897 <212> DNA <213> artificial sequence <220> <223> pck-up <400> 11 GTA GCTTTTGGTCGAAGAGGGAGTGGGCATGCCCATTACTTTTAAGCCTTTGGGGCAGTGA 60 AACCGCTAAATGGGGGC GTTGTGCGCTCGATC ACTGGTCTAGACCTTTGAGCTCCAAGAG 120 TTGCAATTTCGC GAATACTTCAACACTGTGTTTGCAATGTTGTTAATAAATGGGTTCGCC 180 AGTGGATTCTGTCGT TAGTACTGGCCGTCGTGGTGAGATCATGTATT TAGGTAGGGCAA A 240 GTTAAGTTCAGGGCACCTTTTGATACGATTAAC TGGAT AACCCTCTGGG GTAATGTGGG 300 gatgtgtgtg agtaattttc aaagtattca aaagggggat ctagggtaaa aatttggctt 360 caagtacata cctttagttc ggtagttgag ggcgggtggt gacagtgcga gcatgcatgt 420 gggtgtaaat gttgttttaa aaaggggtgt actgacagtg ggccggtttg tgctggtcgg 480 ccactagcgg agtgcttgga ttgtgatggc agagtaaggg aaagggatta ccagtaccgc 540 tgttcttggc gttttgttgc ctattgtccg aatgttaagt gttaatggtc ggaaatctgg 600 gaaagttgtc tcctggaatg tgtgagaatt gcccaaatct gaacccaatg gccatggacg 660 gggaatgaac tgtcagagaa cggttgaggt taattcttga aaccaccccc aaaataggct 720 atttaaacgg gtgctctcat attaaagaaa gtgtgtagat gcgtgtgggc agggggtagg 780 tccactggta atgacaaatg tgtccgttgt ctcacctaaa gttttaacta gttctgtatc 840 tgaaagctac gctagggggc aagaactctg tcgaatgaca caaaatctgg agaagta 897 <210> 12 <211> 945 <212> DNA <213> artificial sequence <220> <223> pck-down <400> 12 agttcacgct taagaactgc taaataacaa gaaaggctcc caccgaaagt gggagccttt 60 cttgtcgtta agcgatgaat tcctcaaaac ctcagtgctt tttaaacacc aacaccaagt 120 tacttaccgc gaattcttgg agcactggga ctttaaccat ccaccaggcc caatacgggt 180 ggtagcgggg aaaagcggca accaattccg cattgcccac ggaggctccc cattccagcc 240 cctcccggca ggacacatta aacagtgact ccccgaaaac gttcttgggt ggatgcccgt 300 gtttcttcgt gtagcgatcg cgggcaaatt ctccgccaac gtagtgttcc cacagtccgg 360 tttcatggcc gccgaagggc cctaaccaaa tggtgtagct caggattgcc aggccgccgc 420 tgcgggtgac gcggagcatt tcttctccca attcccacgg tgcggagaca tgttctgcaa 480 cgttggagga gtacaccacg tcaaaggaat cgggaagaaa cggcaggtcg aggccggatc 540 cgcggactga tccgtggacg tcgatgccag ctgcggacat ttcgccaacg tcgggttcga 600 cggagaagta ggtggcgccc agtgtctcaa aggcttcggc aaagtatccg ggtccgccac 660 cgacgtcgag aactttcagg tcatttaatc cggcgccaga aatatcttca gacaaagccg 720 ccaccagact cgaggtatcg agggccaggt ttccgtaaaa gatgtcaggt cgggtttgtt 780 cgtatttgaa atcagacagt aaaccccacg acctgcccaa ggtagccagg cgacgaagag 840 ccggaagctc cggaaatgat gccatttatg cgcgggtcca gttgaggtcg cggatgtctt 900 cgccgttcat ccatcgcaaa atggtggtga tggcatcgtc gatgg 945 <210> 13 <211> 44 <212> DNA <213> artificial sequence <220> <223> Peftu‑F <400> 13 ctggtttgac agcttatcat cgaaaagcaa tttgcttttc gacg 44 <210> 14 <211> 42 <212> DNA <213> artificial sequence <220> <223> Peftu‑R <400> 14 ccgagctcga attccatggt tgtatgtcct cctggacttc gt 42 <210> 15 <211> 41 <212> DNA <213> artificial sequence <220> <223> Psod‑F <400> 15 ctggtttgac agcttatcat agcggtaacc atcacgggtt c 41 <210> 16 <211> 40 <212> DNA <213> artificial sequence <220> <223> Psod-R <400> 16 ccgagctcga attccatggt gggtaaaaaa tcctttcgta 40 <210> 17 <211> 42 <212> DNA <213> artificial sequence <220> <223> PH36-F <400> 17 ctggtttgac agcttatcat caaaagctgg gtacctctat ct 42 <210> 18 <211> 40 <212> DNA <213> artificial sequence <220> <223> PH36-R <400> 18 ccgagctcga attccatggt ggatcccatg ctactcctac 40 <210> 19 <211> 29 <212> DNA <213> artificial sequence <220> <223> xylAB-F <400> 19 tcccccggga tgcaagccta ttttgacca 29 <210> 20 <211> 32 <212> DNA <213> artificial sequence <220> <223> xylAB-R <400> 20 ctagtctaga ttacgccatt aatggcagaa gt 32 <210> 21 <211> 43 <212> DNA <213> artificial sequence <220> <223> Peftu_xylAB-F <400> 21 aatcaggaag tgggatcgaa acgaaaagca atttgctttt cga 43 <210> 22 <211> 35 <212> DNA <213> artificial sequence <220> <223> Peftu_xylAB-R <400> 22 ccaactaggc gccaaagatt tacgccatta atggc 35 <210> 23 <211> 32 <212> DNA <213> artificial sequence <220> <223> ldh-up-F <400> 23 tcccccgggg gaacaccatg cgattaaggt gc 32 <210> 24 <211> 43 <212> DNA <213> artificial sequence <220> <223> ldh-up-R <400> 24 caaattgctt ttcgtttcga tcccacttcc tgatttccct aac 43 <210> 25 <211> 32 <212> DNA <213> artificial sequence <220> <223> ldh-down-F <400> 25 ttaatggcgt aaatctttgg cgcctagttg gc 32 <210> 26 <211> 31 <212> DNA <213> artificial sequence <220> <223> ldh-down-R <400> 26 ctagtctaga gtctgggacg ttgatgacgc t 31 <210> 27 <211> 29 <212> DNA <213> artificial sequence <220> <223> PntAB-F <400> 27 tcccccggga tgcgaattgg cataccaag 29 <210> 28 <211> 30 <212> DNA <213> artificial sequence <220> <223> PntAB-R <400> 28 ctagtctaga ttacagagct ttcaggattg 30 <210> 29 <211> 29 <212> DNA <213> artificial sequence <220> <223> dapA-F <400> 29 tcccccggga tggcttccgc aactttcac 29 <210> 30 <211> 30 <212> DNA <213> artificial sequence <220> <223> dapA-R <400> 30 ctagtctaga ttaagcggtg tacaggaatt 30 <210> 31 <211> 34 <212> DNA <213> artificial sequence <220> <223> pck-up-F <400> 31 tcccccgggg tagcttttgg tcgaagaggg agtg 34 <210> 32 <211> 47 <212> DNA <213> artificial sequence <220> <223> pck-up-R <400> 32 gttcttaagc gtgaacttac ttctccagat tttgtgtcat tcgacag 47 <210> 33 <211> 48 <212> DNA <213> artificial sequence <220> <223> pck-down-F <400> 33 caaaatctgg agaagtaagt tcacgcttaa gaactgctaa ataacaag 48 <210> 34 <211> 31 <212> DNA <213> artificial sequence <220> <223> pck-down-R <400> 34 ctagtctaga ccatcgacga tgccatcacc a 31
Claims
1. A genetically engineered bacterium, characterized in that, The genetic engineering bacteria comprise an expression cassette combination, the expression cassette combination comprises expression cassette A and expression cassette B, the expression cassette A comprises a promoter and a xylAB gene, the nucleotide sequence of the xylAB gene is as shown in SEQ ID NO: 4, the promoter of the expression cassette A is Peftu with the nucleotide sequence as shown in SEQ ID NO: 1; the expression cassette B comprises a promoter and a PntAB gene; the nucleotide sequence of the PntAB gene is as shown in SEQ ID NO: 8, the promoter of the expression cassette B is Peftu with the nucleotide sequence as shown in SEQ ID NO:
1. The genetic engineering bacteria do not express the ldh gene, and the starting bacteria of the genetic engineering bacteria are Corynebacterium glutamicum.
2. The genetically engineered bacteria of claim 1, wherein, The nucleotide sequence of the expression cassette A is as shown in SEQ ID NO: 5, and the nucleotide sequence of the expression cassette B is as shown in SEQ ID NO:
9.
3. The genetically engineered bacteria of claim 1, wherein, After the expression cassette combination is introduced into the starting bacteria, the expression cassette A and / or the expression cassette B are integrated on the genome of the starting bacteria by homologous recombination, or exist in the starting bacteria in a non-integrated form.
4. The genetically engineered bacteria as described in claim 1, characterized in that, In the genetic engineering bacteria, the ldh gene is knocked out.
5. The genetically engineered bacterium of any one of claims 1-4, wherein, The starting bacteria are C. glutamicum B253.
6. The genetically engineered bacterium of any one of claims 1-4, wherein, The expression cassette A is integrated on the genome of the starting bacteria, and the expression cassette B exists in the starting bacteria in a non-integrated form.
7. The genetically engineered bacteria as described in claim 6, characterized in that, The expression cassette A is integrated into the ldh gene site on the genome, and the non-integrated form is that a recombinant expression vector comprising the expression cassette B is transformed into the starting bacteria.
8. A method of preparing lysine, characterized by, The method is to ferment the genetic engineering bacteria according to any one of claims 1-7 in a fermentation medium.
9. The method of claim 8, wherein, The fermentation medium is a medium containing glucose and / or xylose; And / or, the fermentation conditions are that the temperature is 28-32℃, the aeration amount is 1.0-1.7vvm, the pH is 6.8-7.2, stirring is carried out during fermentation, and the stirring speed is 400-800rpm.
10. The method of claim 9, wherein, The fermentation medium is a straw hydrolysate.
11. The method of claim 9, wherein, The fermentation medium contains not less than 25 g / L of glucose and / or 25 g / L of xylose.
12. The method of claim 9, wherein, The fermentation medium contains 80-110 g / L of glucose and 25-40 g / L of xylose.
13. Use of the genetic engineering bacteria according to any one of claims 1-7 in the preparation of lysine.
Citation Information
Patent Citations
Recombinant corynebacterium glutamicum in high L-lysine yield and construction method thereof
CN109370974A
Method for producing L-amino acids by fermentation using bacteria having enhanced expression of xylose utilization genes
CN1749390B
Corynebacterium glutamicum strain capable of fermenting xylose to produce succinic acid and application
CN110551648A
Construction method of synthetic path for generating glutamic acid by utilizing xylose in corynebacterium glutamicum
CN112458108A
Microorganisms of corynebacterium which can utilize xylose and method for producing l-lysine using same
US20140377816A1