Nucleic acid sequences, products, methods and uses for detection of influenza a virus

Abstract

The embodiment of the present application provides a nucleic acid sequence, a product, a method and an application for detecting influenza A virus, and relates to the technical field of biological detection. The embodiment of the present application designs eight sets of MCDA amplification primers for four common influenza A viruses, H1N1, H3N2, H5N1 and H7N9, and specific sequences of H gene and N gene of each virus. Different fluorescent markers are designed for the amplification primers for H gene and N gene, and a multi-cross isothermal amplification reaction is adopted, so that the amplification products of H gene and N gene can be obtained under one temperature condition, and the genome H gene and N gene of the virus sample to be detected are detected simultaneously by using a lateral flow biosensor strip. The nucleic acid sequence provided by the embodiment of the present application is used for detecting influenza A virus, has a rapid detection speed, has excellent specificity, can accurately identify four influenza A virus subtypes, and is suitable for popularization to clinical detection of influenza A virus.

Description

TECHNICAL FIELD

[0001] The embodiment of the present application relates to the technical field of biological detection, in particular to a nucleic acid sequence, product, method and application for detecting influenza A virus. BACKGROUND

[0002] Influenza viruses are divided into four types of A, B, C and D, and the influenza A virus has various subtypes. Among them, the influenza A and B viruses cause seasonal epidemic diseases, and the influenza A virus causes four influenza pandemics. The influenza A viruses currently spreading among people are H1N1 and H3N2 subtypes, and some sporadic cases are caused by avian influenza virus H7N9 and H5N1 subtypes. Monitoring the influenza A virus of the environment and sporadic cases of influenza can determine the type, which can provide basic data for timely detection of virus variation and response to influenza epidemic.

[0003] In the related art, the influenza virus is usually confirmed by methods such as virus isolation, reverse transcriptase-polymerase chain reaction (RT-PCR) detection of influenza-specific RNA or direct detection of influenza virus surface antigen in the laboratory. Isolation and identification of influenza virus strains are the gold standard for confirming virus types, but they require very high requirements for laboratories and operators, and are rarely carried out in primary hospitals. In clinical practice, colloidal gold rapid influenza diagnostic test can be used to detect influenza antigens, but the sensitivity is lower than that of the RT-PCR method. Although the detection technology based on RT-PCR has been applied to the detection and typing of influenza viruses, it is difficult to popularize in primary units or laboratories with poor conditions due to its dependence on special and expensive equipment and skilled operators, which to some extent limits the more widespread application of the technology and causes certain difficulties for timely monitoring of influenza.

[0004] Therefore, there is an urgent need for a new strategy for detecting influenza A virus to facilitate the detection of influenza A virus. SUMMARY

[0005] The embodiment of the present application provides a nucleic acid sequence, product, method and application for detecting influenza A virus, so as to more conveniently and quickly detect influenza A virus.

[0006] The first aspect of the embodiment of the present application provides a nucleic acid sequence for detecting influenza A virus, wherein the nucleic acid sequence has a multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 1 to SEQ ID No. 80.

[0007] SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9;

[0008] SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus, and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus.

[0009] Optionally, the 5' end of the primer sequence shown in SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, and SEQ ID No. 62 is connected with fluorescein isothiocyanate; the 5' end of the primer sequence shown in SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, and SEQ ID No. 72 is connected with digoxin; and the 5' end of the primer sequence shown in SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, and SEQ ID No. 73 is connected with biotin.

[0010] The second aspect of the embodiment of the present application provides a kit for detecting influenza A virus, wherein the kit comprises a nucleic acid amplification reagent containing the multiple crossover displacement amplification reaction primer sequences shown in SEQ ID No. 1 to SEQ ID No. 80.

[0011] SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9;

[0012] SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus, and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus.

[0013] Optionally, the 5' end of the primer sequence shown in SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, and SEQ ID No. 62 is connected with fluorescein isothiocyanate; the 5' end of the primer sequence shown in SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, and SEQ ID No. 72 is connected with digoxin; and the 5' end of the primer sequence shown in SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, and SEQ ID No. 73 is connected with biotin.

[0014] Optionally, the kit further comprises:

[0015] Betaine, MgSO4, NTP, 10x Bst DNA polymerase buffer, strand displacement DNA polymerase.

[0016] The third aspect of the embodiment of the present application provides a detection system for detecting influenza A virus, which comprises: a kit and a lateral flow biosensor strip; the kit comprises nucleic acid amplification reagents, and the nucleic acid amplification reagents contain the multiple crossover displacement amplification reaction primer sequences shown in SEQ ID No. 1 to SEQ ID No. 80.

[0017] SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9.

[0018] SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus, and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus.

[0019] Optionally, the lateral flow biosensor strip comprises a sample pad, a gold label pad, a fiber membrane, a water absorption pad, and a back plate, the sample pad, the gold label pad, the fiber membrane, and the water absorption pad are sequentially assembled on the back plate, and the fiber membrane is provided with a detection line 1, a detection line 2, and a control line, wherein the gold label pad is coated with streptavidin coupled with gold nanoparticles, the detection line 1 and the detection line 2 are respectively coated with anti-fluorescein isothiocyanate antibody and anti-digoxin antibody, and the control line is coated with bovine serum albumin coupled with biotin.

[0020] The fourth aspect of the embodiment of the present application provides a detection method for detecting influenza A virus, and the method comprises the following steps:

[0021] Extracting a genome of a virus sample to be detected;

[0022] Based on the fact that the nucleic acid sequence has the primer sequence of the multiple cross displacement amplification reaction shown in SEQ ID No. 1 to SEQ ID No. 20, or the nucleic acid sequence has the primer sequence of the multiple cross displacement amplification reaction shown in SEQ ID No. 21 to SEQ ID No. 40, or the nucleic acid sequence has the primer sequence of the multiple cross displacement amplification reaction shown in SEQ ID No. 41 to SEQ ID No. 60, or the nucleic acid sequence has the primer sequence of the multiple cross displacement amplification reaction shown in SEQ ID No. 61 to SEQ ID No. 80, using the genome of the virus sample to be detected as a template to perform a multiple cross isothermal amplification reaction, so as to obtain an amplification product;

[0023] The amplification product is detected by using a lateral flow biosensor strip.

[0024] Optionally, the concentrations of the primers in the reaction system of the multi-cross isothermal amplification reaction are as follows: the concentration of the cross primer CP1 is 30 pmol, the concentration of the cross primer CP2 is 60 pmol, the concentrations of the displacement primers F1 and F2 are both 10 pmol, the concentrations of the amplification primers R1, R2, D1* and D2 are all 30 pmol, and the concentrations of the amplification primers C1* and C2 are both 20 pmol.

[0025] Optionally, the reaction system of the multi-cross isothermal amplification reaction further comprises 10 mM betaine, 6 mM MgSO4, 1 mM dNTP, 12.5 μL of 10× Bst DNA polymerase buffer, 10 U of strand displacement DNA polymerase, 1 μL of a genome template of a Candida albicans sample to be detected, and deionized water, which is supplemented to 25 μL.

[0026] In the embodiment of the application, in order to identify the specific type of the influenza A virus, the H gene and the N gene can be detected simultaneously, and thus, in the embodiment of the application, different fluorescent markers are designed for the amplification primers for the H gene and the N gene, and a multi-cross isothermal amplification reaction is used, so that the amplification products of the H gene and the N gene can be obtained under a single temperature condition, and the genome H gene and the N gene of the virus sample to be detected are simultaneously detected by using a lateral flow biosensor strip.

[0027] The nucleic acid sequence provided in the embodiment of the application is used for detecting the influenza virus, has a rapid detection speed, does not need a temperature changing device, saves the cost of purchasing a PCR amplification instrument in a laboratory, has excellent specificity, and can accurately identify four influenza A virus subtypes. The detection scheme is convenient, rapid, sensitive and specific, and is suitable for popularization to clinical detection of the influenza A virus. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the application, the following will briefly introduce the drawings needed to be used in the description of the embodiments of the application. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without any creative labor under the premise of the drawings.

[0029] Figure 1 is a detection result graph corresponding to the embodiment 1 of the application;

[0030] Figure 2is the detection result graph corresponding to embodiment 2 of the application;

[0031] Figure 3 is the detection result graph corresponding to H1N1-MCDA-LFB in embodiment 3 of the application;

[0032] Figure 4 is the detection result graph corresponding to H3N2-MCDA-LFB in embodiment 3 of the application;

[0033] Figure 5 is the detection result graph corresponding to H5N1-MCDA-LFB in embodiment 3 of the application;

[0034] Figure 6 is the detection result graph corresponding to H7N9-MCDA-LFB in embodiment 3 of the application. DETAILED DESCRIPTION

[0035] In order to make the above objectives, characteristics and advantages of the present application more apparent, comprehensible and easily understood, the present application will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0036] Multi-cross displacement amplification (MCDA) technology is a new type of isothermal nucleic acid amplification technology developed in recent years. This technology gets rid of the problem of using expensive temperature-changing equipment in PCR. Compared with PCR technology, it has the advantages of isothermal, high efficiency, specificity and no need for special instruments. MCDA is based on the dynamic equilibrium state of DNA at about 65℃. When any primer extends to the complementary part of double-stranded DNA for base pairing, the other strand will dissociate and become single-stranded. On this premise, different specific primers recognize the specific region of the target gene, and under the action of strand displacement DNA polymerase, the 3' end of the outer primer segment is used as the starting point to pair with the complementary sequence of the template DNA, and the strand displacement DNA synthesis is started. At present, this technology has been successfully used for the detection of various bacteria, fungi and viruses and other pathogens.

[0037] Based on MCDA technology, the inventors developed a scheme for rapid detection of influenza A virus and typing thereof for the four common types of influenza A virus.

[0038] Specifically, the present application provides a nucleic acid sequence for detecting influenza A virus, wherein the nucleic acid sequence has a multi-cross displacement amplification reaction primer sequence shown in SEQ ID No. 1 to SEQ ID No. 80.

[0039] SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9;

[0040] SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus, and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus.

[0041] In the embodiment of the present application, eight sets of MCDA amplification primers are designed for the four common influenza A viruses H1N1, H3N2, H5N1 and H7N9, and the specific sequences of the H gene and the N gene of each virus. In the embodiment of the present application, in order to identify the specific type of influenza A, the H gene and the N gene can be detected simultaneously. Therefore, different fluorescent markers are designed for the H gene and the N gene in the embodiment of the present application, so as to simultaneously detect the H gene and the N gene of influenza A virus.

[0042] In the embodiment of the present application, the primers that can be labeled are the 5' ends of CP1, CP2, D1, C1, R1, D2, C2 and R2. Taking the labels D1 and C1 as an example: for the H gene, the 5' end of primer D1 is labeled with hapten fluorescein isothiocyanate (FITC), and the 5' end of primer C1 is labeled with biotin (Biotin); for the N gene, the 5' end of primer D1 is labeled with hapten digoxin (Dig), and the 5' end of primer C1 is still labeled with biotin (Biotin). The labeled primers are all marked with an asterisk to distinguish them. In the embodiment of the present application, the specific primer sequences and modifications are shown in Tables 1-8 as follows:

[0043] Table 1:

[0044]

[0045]

[0046] Table 2:

[0047] Sequence No. N1 primer Sequence (5'-3') 280 bp Modification SEQ ID No. 11 F1 CAGGGATAACTGGCATGGCT SEQ ID No. 12 D1* ATCCCACTGCATATGTATCCTATC 5'-Dig SEQ ID No. 13 C1* TTAGGGCGTGGATTGTCTCC 5'-Biotin SEQ ID No. 14 R1 GGACCACAACTGCCTGTCTT SEQ ID No. 15 R2 GGAGCAAATGGAGTAAAAGGGTT SEQ ID No. 16 C2 ACGGCAATGGTGTTTGGATAG SEQ ID No. 17 D2 ACGGTTTTGAGATGATTTGGGA SEQ ID No. 18 F2 TCCCGCTATATCCTGACCAC SEQ ID No. 19 CP1 TTAGGGCGTGGATTGTCTCC-GAATCGACCGTGGGTGTCTT SEQ ID No. 20 CP2 ACGGCAATGGTGTTTGGATAG-TGTCCCAGTCCATCCGTTCG

[0048] Table 3:

[0049]

[0050]

[0051] Table 4:

[0052] Sequence No. N2 primer Sequence (5'-3') 280 bp Modification SEQ ID No. 31 F1 CATCTGGGGACCAAGCAAGT SEQ ID No. 32 D1* TGCAGCCATGCTTTTCCAT 5'-Dig SEQ ID No. 33 C1* TGCATTTTTATCATCCCCCGTT 5'-Biotin SEQ ID No. 34 R1 CTATCTACAAGCCTCCCATTGT SEQ ID No. 35 R2 TTCATGGTCCAAAGAAATCCTCA SEQ ID No. 36 C2 CCCAGGAGTCAGAATGCGT SEQ ID No. 37 D2 GTAATGACTGATGGGAGTGCTT SEQ ID No. 38 F2 CACTTCCTGACAATGTGCTAGT SEQ ID No. 39 CP1 TGCATTTTTATCATCCCCCGTT-ATGGTCCAGCTCAAGTTGTCA SEQ ID No. 40 CP2 CCCAGGAGTCAGAATGCGT-AACGATTTTCCCCTCCTCAATG

[0053] Table 5:

[0054]

[0055]

[0056] Table 6:

[0057] Sequence No. N1 primer Sequence (5'-3') 280 bp Modification SEQ ID No. 51 F1 TCAACACCAAACTGAACCAATC SEQ ID No. 52 D1* GCAAAGAGATGAATTGCCAGAT 5'-Dig SEQ ID No. 53 C1* TGTGTACAGCCCATCCTCTA 5'-Biotin SEQ ID No. 54 R1 ATCCCCTTTGGACCCAATCC SEQ ID No. 55 R2 AGAGAGCCGTTCATCTCATGCT SEQ ID No. 56 C2 ACTTTCTTTTTGACTCAGGGAGC SEQ ID No. 57 D2 GAATGACAAGCACTCCAACGG SEQ ID No. 58 F2 GTTGTATGGGGAGGGAGCCT SEQ ID No. 59 CP1 TGTGTACAGCCCATCCTCTACTGAGAACGCTGTGGCTTCA SEQ ID No. 60 CP2 ACTTTCTTTTTGACTCAGGGAGC-TGAGGGCTCCTGTCTTTGAC

[0058] Table 7:

[0059]

[0060]

[0061] Table 8:

[0062] SEQ ID No. N9 primer Sequence (5'-3') 280 bp Modification SEQ ID No. 71 F1 CGACCCAGATGAATGCAGGT SEQ ID No. 72 D1* CCGTTTGAGTGTTTCCCTCTG 5'-Dig SEQ ID No. 73 C1* GCGCGATACTGGGACCTATC 5'-Biotin SEQ ID No. 74 R1 TGTGGGCGGTGATGATAGTG SEQ ID No. 75 R2 GTGTACAACAGCAGGGTGGA SEQ ID No. 76 C2 CATTGGGTGGTCAAGTACT SEQ ID No. 77 D2 GATGGCAAATCCAGGATGTCA SEQ ID No. 78 F2 CAACAGGCCTTCTGTTGTACC SEQ ID No. 79 CP1 GCGCGATACTGGGACCTATC-GCTCTCAGCCAAGGAACAAC SEQ ID No. 80 CP2 CATTGGGTGGTCAAGCACT-TGCATTGTTGTTTGGTCCTG

[0063] SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, SEQ ID No. 62, the 5' end of the primer sequence is connected with fluorescein isothiocyanate; SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, SEQ ID No. 72, the 5' end of the primer sequence is connected with digoxin; SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, SEQ ID No. 73, the 5' end of the primer sequence is connected with biotin.

[0064] In the embodiment of the present application, the MCDA reaction system contains 10 primers, which recognize 10 regions of the target sequence, including: 2 cross inner primers: CP1 and CP2 (Cross Primer, CP), CP1 contains Cls (complementary sequence of C1 region) and P1, i.e. 5'-Cls-P1, CP2 contains C2s (complementary sequence of C2 region) and P2, i.e. 5'-C2s-P2, the two cross primers CP1 and CP2 are the main primers for mediating MCDA amplification; 2 displacement primers: F1 and F2, which play a displacement role in the MCDA reaction, and displace the cross primers CP1 and CP2; 6 amplification primers: D1, C1, R1, D2, C2 and R2, which can accelerate the MCDA reaction and increase the amount of MCDA product.

[0065] In the embodiment of the present application, a kit for detecting influenza A virus is also provided, wherein the kit contains the nucleic acid amplification reagent.

[0066] Specifically, in the embodiment of the present application, the kit further comprises:

[0067] Betaine, MgSO4, NTP, 10x Bst DNA polymerase buffer, strand displacement DNA polymerase.

[0068] In the embodiment of the present application, a detection system for detecting influenza A virus is also provided, wherein the detection system comprises: the kit and a lateral flow biosensor strip.

[0069] The lateral flow biosensor strip comprises a sample pad, a gold label pad, a fiber membrane, a water absorption pad and a back plate, the sample pad, the gold label pad, the fiber membrane and the water absorption pad are sequentially assembled on the back plate, and the fiber membrane is provided with a detection line 1, a detection line 2 and a control line, wherein the gold label pad is coated with streptavidin coupled with gold nanoparticles at the position of the gold label pad, anti-fluorescein isothiocyanate antibody and anti-digoxin antibody are coated at the positions of the detection line 1 and the detection line 2 respectively, and biotin-coupled bovine serum albumin is coated at the position of the control line.

[0070] In the embodiment of the present application, the lateral flow biosensor strip is specifically a double-channel biological detector (LFB), and specifically, the LFB comprises five parts, a sample pad, a gold label pad, a fiber membrane, a water absorption pad and a back plate. First, the sample pad, the gold label pad, the fiber membrane and the water absorption pad are sequentially assembled on the back plate. Then, SA-G (streptavidin coupled with gold nanoparticles) is coated at the position of the gold label pad, anti-FITC (anti-fluorescein isothiocyanate antibody) and anti-DIG (anti-digoxin antibody) are coated at the positions of the detection line 1 and the detection line 2 respectively, and B-BSA (biotin-coupled bovine serum albumin) is coated at the position of the control line (CL), and after drying, a plastic shell is packaged to be used.

[0071] Based on the detection system for detecting the influenza A virus, the embodiment of the present application further provides a non-diagnostic purpose detection method for detecting the influenza A virus, and the method comprises the following steps:

[0072] S1, extracting a genome of a virus sample to be detected;

[0073] S2, performing a multiple cross displacement amplification reaction on the basis that a nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 1 to SEQ ID No. 20, or a nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 21 to SEQ ID No. 40, or a nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 41 to SEQ ID No. 60, or a nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 61 to SEQ ID No. 80, using the genome of the virus sample to be detected as a template to obtain an amplification product;

[0074] S3, detecting the amplification product by using a lateral flow biosensor strip.

[0075] In the reaction system of the multiple cross displacement amplification reaction, the concentrations of the primers are as follows: the concentration of the cross primer CP1 is 30 pmol, the concentration of the cross primer CP2 is 60 pmol, the concentrations of the displacement primers F1 and F2 are both 10 pmol, the concentrations of the amplification primers R1, R2, D1* and D2 are all 30 pmol, and the concentrations of the amplification primers C1* and C2 are both 20 pmol.

[0076] Specifically, the reaction system of the multiple cross displacement amplification reaction further comprises 10 mM of Betain, 6 mM of MgSO4, 1 mM of dNTP, 12.5 μL of 10×Bst DNA polymerase buffer, 10 U of strand displacement DNA polymerase, 1 μL of the template (the genome of the virus sample to be detected), and deionized water added to 25 μL. The reaction conditions of the multiple cross displacement amplification reaction are as follows: the amplification product can be obtained by reacting at 65℃ for 30 min.

[0077] In the embodiment of the present application, through experimental exploration, it is determined that the optimal reaction temperature for simultaneously performing the multiple cross displacement amplification reaction on the H gene and the N gene is 65℃, and in the embodiment of the present application, the multiple cross displacement amplification reaction is performed at 65℃, and no temperature change is needed, and the amplification products of the H gene and the N gene can be obtained at one temperature.

[0078] In the embodiment of the present application, four groups of multiple cross displacement amplification reaction primer sequences (the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 1 to SEQ ID No. 20, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 21 to SEQ ID No. 40, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 41 to SEQ ID No. 60, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 61 to SEQ ID No. 80) can be used respectively to perform multiple cross isothermal amplification reaction using the genome of the virus sample to be detected as a template, and four groups of amplification products are obtained respectively.

[0079] The four groups of amplification products are detected by using a lateral flow assay biosensor, thereby achieving detection and typing identification of the four types of influenza A viruses.

[0080] Specifically, the step S3 includes: 10 μL of the MCDA product is directly dropped to the sample pad area of the LFB, and then 100 μL of the detection buffer is added to the sample pad area, and the MCDA product moves from the bottom to the top (from the sample pad to the absorbent pad) under the siphon effect. When the MCDA product reaches the gold label pad, one end of the double-labeled product (i.e. the biotin-labeled end) reacts with the SA-G (streptavidin conjugated with gold nanoparticles). When the product continues to move, the other end of the double-labeled product (i.e. the fluorescein isothiocyanate-labeled end or the digoxin-labeled end) binds to the antibody in the detection line 1 area or the detection line 2 area, and the double-labeled product is fixed on the detection line. With the accumulation of the product in the detection line area, the SA-G (streptavidin conjugated with gold nanoparticles) at the other end performs a color development reaction. If the MCDA product includes the product carrying two labels, the detection line 1 and the detection line 2 can both develop color, thereby achieving double-channel visual detection of the MCDA product. In addition, the excess SA-G (streptavidin conjugated with gold nanoparticles) can directly develop color with the B-BSA (streptavidin conjugated with gold nanoparticles) in the CL (quality control line) area, so as to judge whether the LFB is normal.

[0081] In the embodiment of the present application, the above-mentioned nucleic acid sequence is also provided for non-diagnostic application in the detection of influenza A virus.

[0082] The technical solutions provided by the present application are described in detail below in combination with the embodiments, but they should not be understood as limitations to the protection scope of the present application.

[0083] The deoxyribonucleic acid constant temperature amplification kit, the disposable lateral flow biosensor strip (#2) and the specific nucleic acid amplification detection reagent involved in the embodiments of the present application are purchased from Tianjin Huidexin Science and Technology Development Co., Ltd. The nucleic acid extraction kit is purchased from Qiagen Company in Germany. The DL1000 DNA Marker is purchased from Baosheng Engineering (Dalian) Co., Ltd. The rest of the reagents are commercially available and pure products.

[0084] The main instruments used in the embodiments of the present application are as follows: the PCR instrument is QuantStudio 3, a product of the United States thermo company; the electrophoresis equipment is a product of Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd.; the gel imaging system is Bio-Rad Gel Dox XR, a product of the United States Bio-Rad. The constant temperature amplification is realized by using the PCR instrument.

[0085] The strains used in the embodiments of the present application are obtained from the preserved strains after clinical isolation, culture and identification in the clinical laboratory of Shougang Hospital, or are obtained from the subculture strains purchased from the American Type Culture Collection, and the virus strains are obtained from commercially available quality control products.

[0086] Example 1: Feasibility verification of MCDA-LFB detection of four subtypes of influenza A virus:

[0087] The target genes of the four viruses are respectively amplified by MCDA, and then detected by a double-channel biosensor (LFB), and the detection results are as shown in Figure 1 wherein I, II, III and VI respectively represent: only H gene amplification product, only N gene amplification product, H gene and N gene mixed amplification product, and negative blank control product. As can be seen from Figure 1 , no matter which influenza A virus genome is used as a template, the corresponding MCDA primer can amplify the target fragment, and the double-channel LFB can detect the amplification product positive for both H gene and N gene (as shown in Figure 1 the third block of LFB in ).

[0088] Example 2: Sensitivity verification of MCDA-LFB detection of four subtypes of influenza A virus:

[0089] The continuously diluted influenza A virus genome is subjected to standard MCDA amplification reaction, two detection methods are used to distinguish the MCDA amplification results of the four subtypes of influenza A virus, and the distinguishing results are as shown in Figure 2 .

[0090] First, visual dye method was used to detect the MCDA amplification results. Specific nucleic acid amplification detection reagent was added to the reaction mixture, and the reaction solution changed from colorless to blue was positive reaction, and the original color remained negative reaction. The detection showed that the detection lower limit of four subtypes of influenza A virus H1N1, H3N2, H5N1 and H7N9 was 1 fg, 1 fg, 10 fg and 1 pg, respectively, and the positive amplification tube turned blue. When the content of each influenza A virus genome in the reaction system was lower than the above detection lower limit, or the template added was double distilled water (DW), the reaction solution did not change in color and remained colorless, indicating a negative result.

[0091] Secondly, double-channel LFB was used to detect the MCDA product. The results showed that the detection lower limit of four subtypes of influenza A virus H1N1, H3N2, H5N1 and H7N9 was 1 fg, 1 fg, 10 fg and 1 pg, respectively, and LFB appeared red line in TL1, TL2 and CL regions. When the content of each influenza A virus genome in the reaction system was lower than the above detection lower limit, or the template added was double distilled water (DW), LFB only appeared red line in CL region, indicating a negative result.

[0092] Example 3: Specificity verification of MCDA-LFB for detecting four subtypes of influenza A virus

[0093] Common viruses, mycoplasma, chlamydia and bacteria were used as templates to evaluate the specificity of MCDA-LFB for detecting four subtypes of influenza A virus (strain information is shown in Table 9). The detection results are shown in Table 10, wherein Figures 3-6 Figure 3 , 4 , 5, 6 are the specificity results of H1N1-MCDA-LFB, H3N2-MCDA-LFB, H5N1-MCDA-LFB and H7N9-MCDA-LFB respectively for detecting four subtypes of influenza A virus.

[0094] ​H1N1-MCDA-LFB technology refers to using the primer sequence of the multi-cross displacement amplification reaction for detecting the H1N1 influenza virus to perform the multi-cross displacement amplification reaction, and using the lateral flow biosensor strip to detect the amplification reaction product. H3N2-MCDA-LFB technology refers to using the primer sequence of the multi-cross displacement amplification reaction for detecting the H3N2 influenza virus to perform the multi-cross displacement amplification reaction, and using the lateral flow biosensor strip to detect the amplification reaction product. H5N1-MCDA-LFB technology refers to using the primer sequence of the multi-cross displacement amplification reaction for detecting the H5N1 influenza virus to perform the multi-cross displacement amplification reaction, and using the lateral flow biosensor strip to detect the amplification reaction product. H7N9-MCDA-LFB technology refers to using the primer sequence of the multi-cross displacement amplification reaction for detecting the H7N9 influenza virus to perform the multi-cross displacement amplification reaction, and using the lateral flow biosensor strip to detect the amplification reaction product.

[0095] In Figures 3-6 , 1-4 are templates of four subtypes of the influenza virus H1N1, H3N2, H5N1 and H7N9, 5-39 are templates of non-influenza virus (in which the templates of the influenza virus B, human parainfluenza virus 3 and respiratory syncytial virus A / B are RNA gene reverse transcription products), and 40 is the addition of distilled water of the same volume as a negative control. It can be seen from the results that the MCDA-LFB technology has high specificity in detecting four subtypes of the influenza virus.

[0096] Table 9, strain information and specificity results of the MCDA-LFB detection method:

[0097]

[0098]

[0099]

[0100] The above provides a nucleic acid sequence, product, method and application for detecting the influenza virus A, and the principle and implementation mode of the application are described by using specific examples; the above examples are only used to help understand the method and core idea of the application; meanwhile, for the general technical personnel in the art, according to the idea of the application, the specific implementation mode and application range will be changed, and the above description should not be understood as the limitation of the application.

Claims

1. A nucleic acid sequence for detection of influenza A virus, characterized in that, The nucleic acid sequence has a plurality of cross-substitution amplification reaction primer sequences shown in SEQ ID No. 1 to SEQ ID No. 80; Among them, SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9; Among them, SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus; and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus; The 5' end of the primer sequence shown in SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, and SEQ ID No. 62 is connected with fluorescein isothiocyanate; the 5' end of the primer sequence shown in SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, and SEQ ID No. 72 is connected with digoxin; and the 5' end of the primer sequence shown in SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, and SEQ ID No. 73 is connected with biotin.

2. A kit for detection of influenza A virus, characterized by, The kit comprises a nucleic acid amplification reagent containing the plurality of cross-substitution amplification reaction primer sequences shown in SEQ ID No. 1 to SEQ ID No. 80; Among them, SEQ ID No. 1 to SEQ ID No. 20 are used for detecting influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting influenza A virus H7N9; Among them, SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of influenza A virus; and SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of influenza A virus; SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of the influenza A virus; SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of the influenza A virus; SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, SEQ ID No. 62, the 5' end of the primer sequence is connected with fluorescein isothiocyanate; SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, SEQ ID No. 72, the 5' end of the primer sequence is connected with digoxin; SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, SEQ ID No. 73 The 5' end of the primer sequence is connected with biotin.

3. The kit of claim 2, wherein The kit further comprises: Betaine, MgSO4, NTP, 10x Bst DNA polymerase buffer, strand displacement DNA polymerase.

4. A detection system for detection of influenza A virus, characterized by, The detection system comprises: a kit, a lateral flow biosensor strip; the kit contains nucleic acid amplification reagents, and the nucleic acid amplification reagents contain the multiple cross displacement amplification reaction primer sequences shown in SEQ ID No. 1 to SEQ ID No. 80; SEQ ID No. 1 to SEQ ID No. 20 are used for detecting the influenza A virus H1N1, SEQ ID No. 21 to SEQ ID No. 40 are used for detecting the influenza A virus H3N2, SEQ ID No. 41 to SEQ ID No. 60 are used for detecting the influenza A virus H5N1, and SEQ ID No. 61 to SEQ ID No. 80 are used for detecting the influenza A virus H7N9; SEQ ID No. 1 to SEQ ID No. 10, SEQ ID No. 21 to SEQ ID No. 30, SEQ ID No. 41 to SEQ ID No. 50, and SEQ ID No. 61 to SEQ ID No. 70 are used for detecting the H gene of the influenza A virus; SEQ ID No. 11 to SEQ ID No. 20, SEQ ID No. 31 to SEQ ID No. 40, SEQ ID No. 51 to SEQ ID No. 60, and SEQ ID No. 71 to SEQ ID No. 80 are used for detecting the N gene of the influenza A virus; The 5' end of the primer sequence shown in SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, and SEQ ID No. 62 is connected with fluorescein isothiocyanate; the 5' end of the primer sequence shown in SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, and SEQ ID No. 72 is connected with digoxin; the 5' end of the primer sequence shown in SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, and SEQ ID No. 73 is connected with biotin.

5. The assay system of claim 4, wherein the detection moiety is a fluorescent moiety. The lateral flow biosensor strip comprises a sample pad, a gold label pad, a fiber membrane, a water absorption pad, and a back plate, the sample pad, the gold label pad, the fiber membrane, and the water absorption pad are sequentially assembled on the back plate, the fiber membrane is provided with a detection line 1, a detection line 2, and a control line, wherein the gold nanoparticle coupled streptavidin is coated on the position of the gold label pad, the anti-fluorescein isothiocyanate antibody and the anti-digoxin antibody are respectively coated on the position of the detection line 1 and the position of the detection line 2, and the biotin coupled bovine serum albumin is coated on the position of the control line.

6. A method for the detection of influenza A virus for non-diagnostic purposes, characterized in that The method comprises: extracting the genome of the virus sample to be detected; The nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 1 to SEQ ID No. 20, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 21 to SEQ ID No. 40, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 41 to SEQ ID No. 60, or the nucleic acid sequence has the multiple cross displacement amplification reaction primer sequence shown in SEQ ID No. 61 to SEQ ID No. 80, and a multiple cross isothermal amplification reaction is performed using the genome of a virus sample to be detected as a template to obtain an amplification product; the 5' end of the primer sequence shown in SEQ ID No. 2, SEQ ID No. 22, SEQ ID No. 42, SEQ ID No. 62 is connected with fluorescein isothiocyanate; the 5' end of the primer sequence shown in SEQ ID No. 12, SEQ ID No. 32, SEQ ID No. 52, SEQ ID No. 72 is connected with digoxin; the 5' end of the primer sequence shown in SEQ ID No. 3, SEQ ID No. 13, SEQ ID No. 23, SEQ ID No. 33, SEQ ID No. 43, SEQ ID No. 53, SEQ ID No. 63, SEQ ID No. 73 is connected with biotin; The amplification product is detected by using a lateral flow biosensor strip.

7. The method of claim 6, wherein, The concentration of the primer in the reaction system of the multiple cross isothermal amplification reaction is as follows: the concentration of the cross primer CP1 is 30 pmol, the concentration of the cross primer CP2 is 60 pmol, the concentration of the displacement primer F1 and F2 is 10 pmol, the concentration of the amplification primer R1, R2, D1* and D2 is 30 pmol, and the concentration of the amplification primer C1* and C2 is 20 pmol.

8. The nucleic acid sequence of claim 1 for non-diagnostic purposes in the detection of influenza A virus.

Images