A detection method and device for detecting DNA and a target using DNA as an identification molecule

By combining ion exchanger-doped polymer film electrodes and magnetic materials, using zero-current open circuit potential to detect DNA, solving the complex structure and high cost of existing DNA sensors, and achieving fast and sensitive DNA detection, which is suitable for the identification of a variety of target objects and field applications.

CN115901892BActive Publication Date: 2025-08-01YANTAI INST OF COASTAL ZONE RES CHINESE ACAD OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202110972053.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-08-24
Publication Date
2025-08-01
Estimated Expiration
2041-08-24

AI Technical Summary

Technical Problem

Existing DNA sensors have the problem that the structure is complex, costly, are susceptible to complex matrix interference and are difficult to quickly detect DNA molecules, especially strongly hydrophilic DNA molecules that are difficult to directly enter the polymer sensitive membrane and interact with the recognition molecules.

Method used

The polymer film ion-selective electrode doped with ion exchanger is used to detect DNA or its derivatives through the chargeability of DNA or the interaction between the target object, and the zero-current open circuit potential is used to control the extraction of DNA functionalized magnetic beads in combination with magnetic materials and an external magnetic field to achieve quantitative/qualitative detection of DNA.

Benefits of technology

It realizes fast, sensitive and low-cost detection of DNA, is suitable for on-site applications, can identify multiple target objects, is versatile and high sensitivity, and simplifies the structure of the detection equipment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115901892B_ABST
    Figure CN115901892B_ABST
Patent Text Reader

Abstract

The present invention relates to a polymer-sensitive membrane ion-selective electrode, specifically a detection method and device for detecting DNA and targets (such as antibiotics) with DNA as the recognition molecule. The sample to be detected contains DNA, DNA derivatives or targets with DNA as the recognition molecule. By using the potential sensor of the ion-exchange agent-doped polymer membrane ion-selective electrode, through the charge property of DNA or the interaction between the DNA recognition molecule and the target, the potential of the ion-exchange agent-doped polymer membrane electrode changes, thereby realizing the quantitative / qualitative detection of DNA, DNA derivatives or targets with DNA as the recognition molecule in the sample. In the present invention, DNA serves as both a recognition element and an indicating ion, with a wide application range and universality; the electrode has a rapid response and simple operation, and has good practical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a polymer sensitive membrane ion selective electrode, and particularly to a detection method and device for detecting DNA and target substances (such as antibiotics) using DNA as an identification molecule. Background Art

[0002] Deoxyribonucleic acid (abbreviated as DNA in English) is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose, and phosphoric acid. There are 4 types of bases: adenine (A), guanine (G), thymine (T), and cytosine (C). The base arrangement in the DNA molecule is diverse, resulting in different properties of each deoxynucleotide chain, thus endowing DNA with different properties. DNA carries different amounts of charge in a specific solution, and the conformations of different DNAs are also different. As an ion, DNA can cause a potential response on a polymer sensitive membrane electrode.

[0003] An aptamer is a structured oligonucleotide sequence (RNA or DNA) obtained by an in vitro screening technique - systematic evolution of ligands by exponential enrichment (SELEX), and has strict recognition ability and high affinity with corresponding target molecules (proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules, etc.), and binds to the corresponding target substances with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions.

[0004] Current DNA sensors mostly use optical instruments as detection means. However, these methods are vulnerable to turbidity and chromaticity interference of complex matrices. Secondly, most DNA sensor arrays simply select non-specific sensing units, which require large instruments. Moreover, the instruments have complex structures and high costs, and are not suitable for on-site rapid detection. Developing DNA sensors with simple structures, low costs, and easy miniaturization remains a difficult problem. The potential sensor based on a polymer membrane ion-selective electrode is simple to fabricate, easy to operate, has a fast response speed, does not require expensive instruments, and is suitable for on-site rapid detection. However, since both the phosphoric acid ribose chain and the base are water-soluble molecules, single-stranded DNA has strong hydrophilicity; due to base complementary pairing in double-stranded DNA to form a conjugated structure, the intermolecular force reaches "saturation" and no longer relies on hydration hydrogen bonds. Instead, the phosphoric acid ribose chain interacts with hydrogen bonds in water, resulting in an outer hydrophilic phenomenon. Strongly hydrophilic DNA molecules are difficult to directly enter the polymer sensitive membrane phase and interact with the recognition molecules in the polymer membrane phase, making it difficult for existing methods to directly detect DNA molecules. The traditional polyion-selective electrode measures the potential response of the electrode under zero-current conditions, and this response process is a non-equilibrium state process. However, when measuring low-concentration polyions, the non-equilibrium extraction process is slow and the electrode response time is long. Stirring methods are usually adopted in research to improve the mass transfer rate of polyions, thereby shortening the response time and improving the detection sensitivity. At the same time, traditional polyion-selective electrodes are difficult to be used for detecting large substances such as DNA and Aptamer. Summary of the Invention

[0005] The object of the present invention is to provide a detection method and device for detecting DNA and target substances (such as antibiotics) using DNA as a recognition molecule.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] A detection method for detecting DNA and target substances using DNA as a recognition molecule. The sample to be detected contains DNA, DNA derivatives or target substances using DNA as a recognition molecule. Using a potential sensor of a polymer membrane ion-selective electrode doped with an ion exchanger, through the charge property of DNA or the interaction between the DNA recognition molecule and the target substance, the potential of the polymer membrane electrode doped with the ion exchanger changes, and further realizes the quantitative / qualitative detection of single-stranded DNA, DNA derivatives or target substances using DNA as a recognition molecule in the sample.

[0008] The detection adopts the technical detection method of open-circuit potential detection.

[0009] The above detection can be carried out under zero current; the potential measurement under zero current is to insert the reference electrode and the working electrode into the measurement cell together, and use an electrochemical external measurement device to record the potential change.

[0010] When the analyte is DNA or its derivative, the analyte is added to a buffer solution so that the DNA or its derivative in the analyte carries a negative charge. Then, a DNA fragment matching the DNA to be detected is added to the test solution, causing a change in the charge of the DNA in the analyte, and further causing a change in the potential of the polymer membrane electrode doped with an ion exchanger, thereby realizing the quantitative / qualitative detection of DNA and DNA derivatives. Among them, the buffer solution is a buffer solution with a pH of 6.8 - 8.0 (for example, phosphate buffer solution, Tris-hydrochloric acid buffer solution, disodium hydrogen phosphate-citric acid buffer solution, potassium dihydrogen phosphate-sodium hydroxide buffer solution, etc.).

[0011] When the analyte uses DNA as the recognition molecule, DNA serves as both the recognition molecule and the signal transduction molecule, interacting with the corresponding target in the test solution, causing changes in the charge and charge density of DNA, and further causing a change in the potential of the polymer membrane electrode doped with an ion exchanger, thereby realizing the detection of the target. Among them, the recognition molecule DNA is added to a buffer solution, and the buffer solution is a buffer solution with a pH of 6.8 - 8.0 (for example, phosphate buffer solution, Tris-hydrochloric acid buffer solution, disodium hydrogen phosphate-citric acid buffer solution, potassium dihydrogen phosphate-sodium hydroxide buffer solution, etc.).

[0012] When detecting DNA, the DNA fragment matching it or the DNA used as the recognition molecule is immobilized on magnetic materials to obtain DNA-functionalized magnetic beads.

[0013] The DNA for detecting DNA is a single-stranded DNA in which the same or different types and numbers of bases are connected by phosphodiester bonds; the DNA derivative is the modified DNA or a nucleic acid aptamer that binds to the target with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions, etc. The former is further a product obtained after the DNA functional group is modified by certain small molecule compounds, and among them, the product modified at the 3' end becomes the 3' end derivative of DNA, and the product modified at the 5' end becomes the 5' end derivative of DNA.

[0014] The DNA fragment matching the DNA to be detected is a single-stranded DNA fragment that can be complementary to the DNA single strand to be detected.

[0015] When the analyte is a target using DNA as the recognition molecule, the recognition molecule is immobilized on magnetic materials to obtain DNA-functionalized magnetic beads. DNA serves as both the recognition molecule and the signal transduction molecule, interacting with the target in the test solution, causing a change in the potential of the DNA-functionalized magnetic beads in the polymer membrane electrode doped with an ion exchanger, and realizing the qualitative / quantitative detection of the target in the test solution.

[0016] The magnetic material is magnetic iron oxide particles, magnetic beads, magnetic materials, magnetic materials encapsulated with gold or nano-gold, or magnetic materials modified with specific functional groups.

[0017] In the DNA-functionalized magnetic beads, DNA or DNA derivatives interact with the target in the sample to be detected (DNA can interact with the functional groups on the surface of the target molecule), causing changes in the charge and charge density of the DNA in the DNA-functionalized magnetic beads. Under the action of an external magnetic field, the amount of DNA on the DNA-functionalized magnetic beads effectively extracted onto the polymer sensitive membrane decreases, resulting in a change in the electrode potential, thereby achieving qualitative / quantitative detection of the target in the sample to be detected.

[0018] The above polymer membrane electrode is placed in an electrochemical cell, and an external magnetic field is used to control the effective extraction of DNA derivative-functionalized magnetic beads before and after binding to the antibiotic to be detected onto the polymer sensitive membrane, and the change in the electrode potential is recorded. Based on the change in the electrode potential before and after the interaction between the DNA derivative and the antibiotic, this potentiometric sensor can achieve highly sensitive detection of antibiotics in aqueous solutions.

[0019] The DNA serving as the recognition molecule is a single-stranded DNA in which the same or different types and numbers of bases are linked by phosphodiester bonds; the DNA derivative is the modified DNA.

[0020] The DNA or DNA derivative serving as the recognition molecule is fixed on the magnetic beads, specifically, DNA, modified DNA, DNA derivative, or modified DNA derivative is fixed on the magnetic beads;

[0021] For example, DNA with amino groups and / or carboxyl groups at either end reacts with carboxylated (or aminated) magnetic beads, and the DNA is fixed on the magnetic beads;

[0022] DNA with amino thiol modification at the 3'-end and / or 5'-end reacts with magnetic beads with surface thiolation, and the DNA is fixed on the magnetic beads;

[0023] DNA labeled with biotin at the 3'-end and / or 5'-end reacts with magnetic beads modified with streptavidin, and the DNA is fixed on the magnetic beads;

[0024] If the DNA derivative has amino groups and / or carboxyl groups at either end, it reacts with carboxylated (or aminated) magnetic beads and is fixed on the magnetic beads;

[0025] If the DNA derivative has amino thiol modification at the 3'-end and / or 5'-end, it reacts with magnetic beads with surface thiolation and is fixed on the magnetic beads;

[0026] By weight, the polymer membrane composition comprises 20%-80% of a membrane matrix, 20%-80% of a plasticizer, and the balance is an ion exchanger;

[0027] The ion exchanger is an anion exchanger; among them, the anion exchanger is tri(dodecyl)methylammonium chloride, tri(dodecyl)methylammonium chloride derivative, tri(tetradecyl)methylammonium chloride, tri(tetradecyl)methylammonium chloride derivative, tetra(dodecyl)ammonium chloride, tetra(dodecyl)ammonium chloride derivative, cetyltrimethylammonium bromide, cetyltrimethylammonium bromide derivative, cetyltrimethylammonium chloride, cetyltrimethylammonium chloride derivative, didodecyldimethylammonium chloride or didodecyldimethylammonium chloride derivative, guanidine or guanidine derivative. Preferably, it is cetyltrimethylammonium chloride, cetyltrimethylammonium chloride derivative.

[0028] The membrane matrix is polyvinyl chloride, polyurethane, polybutyl acrylate, polyetherimide, rubber or sol-gel membrane; the plasticizer is o-nitrophenyl octyl ether, di-2-ethylhexyl sebacate, dibutyl sebacate or dioctyl sebacate;

[0029] The target substances are antibiotics, proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules.

[0030] The antibiotics can be tetracycline antibiotics (such as tetracycline, oxytetracycline and chlortetracycline), sulfonamide antibiotics (such as sulfadiazine, sulfathiazole and sulfamonomethoxine), quinolone antibiotics (such as enrofloxacin, norfloxacin and ciprofloxacin), β-lactam antibiotics (penicillins, cephalosporins), aminoglycoside antibiotics (such as streptomycin, gentamicin, neomycin and kanamycin), macrolide antibiotics (such as erythromycin, tylosin), chloramphenicol antibiotics (also known as chloramphenicol antibiotics: chloramphenicol, florfenicol and thiamphenicol), etc. The target substances include proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules, etc. that bind to nucleic acid aptamers with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions and electrostatic attractions, etc.

[0031] Meanwhile, the recognition molecule of the above antibiotics is

[0032] The DNA sequence of oxytetracycline: ACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT, the DNA sequence for recognizing sulfonamides: CATCCGTCACACCTGCTCCACCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC, the DNA sequence for recognizing kanamycin among aminoglycoside antibiotics: TGGGGGTTGAGGCTAAGCCGA, the DNA sequence for recognizing chloramphenicol among amide alcohol antibiotics: ACTTCAGTGAGTTG-TCCCACGGTCGGCGAGTCGGTGGTAG, or a random sequence that can recognize pathogenic bacteria and microorganisms, the DNA sequence for recognizing enrofloxacin among quinolone antibiotics: TCTCTGAGCCCGGGTTATTTCAGGGGGA, the DNA sequence for recognizing erythromycin among macrolide antibiotics: AGGAATTCACGTCTCACTGGATTCACG-CACGCCAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG, etc. The DNA is a DNA strand formed by connecting the same or different types and numbers of bases through phosphodiester bonds; the DNA derivative is a nucleic acid aptamer that binds to the target substance with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions.

[0033] A device for the detection method. The device is a potential sensor of an ion-exchanger-doped polymer membrane ion-selective electrode, which includes a detection cell, a working electrode, a reference electrode, a counter electrode, and an electrochemical external measurement device; the working electrode is an ion-exchanger-doped polymer membrane ion-selective electrode, which is placed in the detection cell, and the working electrode, the reference electrode, and the counter electrode are respectively connected to the electrochemical external measurement device.

[0034] The ion-exchanger-doped polymer membrane ion-selective electrode has a polymer membrane doped with an ion-exchanger adhered to the bottom of the electrode; alternatively, a conductive layer can also be provided between the bottom of the electrode and the polymer membrane.

[0035] The polymer membrane electrode can be a traditional polymer-sensitive membrane electrode with internal filling solution, a novel solid-state electrode, or a printed electrode.

[0036] The electrochemical external measurement device is an electrochemical workstation, an ion meter, or a potentiometer.

[0037] The reference electrode can be a saturated calomel electrode or a silver-silver chloride electrode; the auxiliary electrode / counter electrode can be a platinum wire.

[0038] Among them, the working electrode of the printed electrode can be a carbon electrode covered with a polymer sensitive film, the reference electrode can be a silver-silver chloride electrode, and the auxiliary electrode can be a platinum sheet electrode.

[0039] The device includes an external magnetic field.

[0040] Detection principle: The present invention uses DNA as an identification molecule and a signal transduction molecule, which interacts with the corresponding target in the liquid to be detected, causing a change in the electrode potential of the polymer film doped with an ion exchanger, and then enabling rapid quantitative / qualitative detection of the target; further, for most DNAs with a large charge density and many negative charges, they are modified with magnetic beads, and then the potential change caused by the extraction or adsorption of the magnetic beads to the surface of the polymer film electrode doped with an ion exchanger is controlled by an external magnetic field, thereby achieving an obvious and rapid response. At the same time, the interaction between the DNA derivative-functionalized magnetic beads and the corresponding target to be detected is utilized, and under the action of an external magnetic field, the charge of the DNA modified with magnetic beads during its extraction or adsorption to the surface of the polymer film electrode doped with an ion exchanger is reduced, thereby achieving the detection of the target. The present invention can utilize different sequences of DNA to recognize different target molecules, thereby enabling the detection of multiple substances, and thus it has universality.

[0041] The advantages of the present invention are as follows:

[0042] 1. The method of the present invention realizes the direct potential response to DNA and successfully solves the problem of direct potential analysis of hydrophilic recognition molecules; as a general direct potential detection method for hydrophilic recognition molecules, the method of the present invention can be flexibly supplemented and integrated with other analysis methods, providing a new and beneficial supplement to the prior art, and greatly expanding the application space and scenarios of the potential analysis method.

[0043] 2. The present invention uses a polymer film added with an ion exchanger to realize the real-time and rapid potential detection of DNA; the electrode structure is simple, the operation is convenient, and it can be mass-produced; it does not need to rely on complex instrument equipment, can be carried around, and realizes the on-site rapid detection of the target.

[0044] 3. The present invention realizes the rapid potentiometric detection of DNA by using a polymer membrane doped with an anion exchanger; the ion exchanger added to the polymer membrane is an anion exchanger; negatively charged DNA in the buffer solution is immobilized on magnetic beads, and under the action of a magnetic field, the DNA is driven to the surface of the polymer membrane and effectively extracted into the membrane. The DNA interacts with the anion exchanger in the polymer membrane, resulting in ion exchange and causing a change in the potential of the polymer membrane; the alkyl chain structure of the doped anion exchanger directly affects the potential response. According to the number of alkyl chains, trimethyldodecylammonium chloride, tetra(dodecyl)ammonium chloride, cetyltrimethylammonium bromide, and didodecyldimethylammonium chloride are selected; according to the experimental results, the doped anion exchanger is preferably cetyltrimethylammonium chloride and cetyltrimethylammonium chloride derivatives.

[0045] 4. During the detection process of the present invention, the DNA derivative serves as a new recognition molecule, which can not only achieve the selective recognition of the target substance, but also its polyion characteristics can be used for signal transduction of the potential signal.

[0046] 5. The present invention uses an externally applied magnetic field to directly extract the DNA-functionalized magnetic beads to the surface of the polymer sensitive membrane electrode, generating a rapid and highly sensitive potential response. This extraction process is simple and fast. In addition, under the condition of an externally applied magnetic field, the DNA-coupled magnetic beads can achieve the rapid separation and enrichment of the target substance, eliminating the matrix effect of the background solution.

[0047] The corresponding target substances for the detection include proteins, viruses, bacteria, cells, heavy metal ions, antibiotics, small molecules, etc. that have high affinity and strong specificity for nucleic acid aptamers (Aptamer) through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions. Description of the Drawings

[0048] Figure 1 It is the potentiometric response diagram for detecting DNA based on the polymer membrane electrode doped with an anion exchanger (cetyltrimethylammonium bromide) provided by the embodiment of the present invention.

[0049] Figure 2 It is the detection result and standard curve of the selected DNA for oxytetracycline in the embodiment of the present invention; among them, a is the real-time response curve and b is the calibration curve.

[0050] Figure 3 It is the schematic diagram and physical diagram of the sensor device based on the printed electrode provided by the embodiment of the present invention.

[0051] Figure 4 It is the potentiometric response diagram for detecting DNA based on the polymer membrane electrode doped with different ion exchangers provided by the embodiment of the present invention.

[0052] Figure 5Schematic diagram and physical diagram of the sensor device based on the polymer sensitive film electrode with internal liquid filling provided by the embodiment of the present invention.

[0053] Figure 6 Schematic diagram and physical diagram of the sensor device based on the all-solid-state ion-selective electrode provided by the embodiment of the present invention.

[0054] Figure 7 Schematic process diagram of the printed electrode provided by the embodiment of the present invention. Detailed implementation manners

[0055] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods without specific conditions noted in the following examples are selected according to conventional methods and conditions.

[0056] In the present invention, DNA and its derivatives can generate an ion potential response on the polymer membrane electrode doped with an ion exchanger, and based on this, the potential detection of DNA can be realized.

[0057] Furthermore, taking DNA and its derivatives as recognition molecules and signal transduction molecules, after interacting with the target, the bases in DNA and its derivatives can interact with the functional groups on the surface of the target, thereby changing the number and density of charges on the surface of DNA, and further causing a change in the electrode potential on the surface of the sensitive membrane sensor, and the potential detection of the target can be realized.

[0058] To improve the detection sensitivity, the printed electrode is placed on a small flat magnet, and an external magnetic field is used to control the effective extraction of DNA-functionalized magnetic beads into the polymer sensitive membrane phase, resulting in a change in the electrode potential. During measurement, an electrochemical system is used to record the potential change between the working electrode and the reference electrode on the printed electrode. The device is as follows: the working electrode and the reference electrode on the printed electrode are respectively connected to the electrochemical system. The printed electrode is inserted into the detection cell containing the detection solution. The detection cell is placed on the small flat magnet. The open-circuit potential measurement technique is used to realize the detection of the analyte. In the present invention, DNA serves as both a recognition element and an indicator ion, with a wide application range.

[0059] Example 1

[0060] The device includes a detection cell, an ion-selective polymer membrane electrode, a reference electrode, a counter electrode, and an electrochemical external measurement device. The ion-selective polymer membrane electrode is placed in the detection cell, and the ion-selective polymer membrane electrode, the reference electrode, and the counter electrode are respectively connected to the electrochemical external measurement device. Among them, the reference electrode is a silver-silver chloride electrode, and the counter electrode is a platinum wire electrode.

[0061] 1. Preparation of the ion-selective polymer membrane electrode

[0062] Weigh 170.32 mg of polyurethane, 170.32 mg of o-nitrophenyl octyl ether, 13.57 mg of cetyltrimethylammonium bromide, and 0.619 mg of tetra(dodecyl)ammonium tetrakis(4-chlorophenyl)borate and dissolve them in 3 mL of tetrahydrofuran. After stirring evenly, drop the solution onto the working electrode surface of the printed electrode. After the tetrahydrofuran evaporates, it serves as a polymer membrane electrode for later use.

[0063] 2. Potential determination of DNA

[0064] DNA (GTGCAGCGATGTTTCCGGTGC) is negatively charged in a phosphate buffer solution (1 mM, pH 7) at pH 7 to obtain a DNA buffer solution. Add magnetic beads (iron oxide nanoparticles and their derivatives) to the prepared DNA buffer solution and incubate for 60 minutes.

[0065] At the same time, use a phosphate buffer solution (Buffer) at pH 7, a DNA buffer solution (ssDNA), and a phosphate buffer solution (MBs) at pH 7 containing magnetic beads as controls. Take 10 μL of each and add them to the working electrode of the printed electrode placed in the detection cell, and measure the open-circuit potential, which are recorded as E1 and E2 respectively; prepare a phosphate buffer solution (1 mM, pH 7), place the printed electrode in the detection cell, and measure the open-circuit potential, which is recorded as Buffer; prepare a phosphate buffer solution (1 mM, pH 7) containing single-stranded DNA (1.0×10 -5 M), place the printed electrode in the detection cell, and measure the open-circuit potential, which is recorded as ssDNA; the real-time response curve is as Figure 1 .

[0066] It can be seen from Figure 1 that when DNA is not fixed to the magnetic beads, the potential response of DNA is small and almost the same as that of the background solution (i.e., Buffer); the change in the potential response obtained by using the magnetic bead-based method is significantly greater than the potential determination of DNA without using magnetic beads.

[0067] Example 2

[0068] The device is as Figure 3 shown and includes a detection cell, a printed electrode, an electrochemical external measurement device, and an external magnetic field; the printed electrode is placed in the detection cell, an external magnetic field is applied, and the working electrode and the reference electrode of the printed electrode are respectively connected to the electrochemical external measurement device. The working electrode of the printed electrode is obtained according to the preparation method described in Example 1 above.

[0069] 2. Potential determination of oxytetracycline

[0070] The DNA derivative (aptamer: ACGTTGACGCTGGTGCCCGGTTGTGG-TGCGAGTGTTGTGT) carries a negative charge in a phosphate buffer solution (1 mM, pH 7) at pH 7. Prepare a phosphate buffer solution containing DNA (1 mM, pH 7), mix it with a dispersion of magnetic beads (iron oxide particles and their derivatives), and incubate for 60 minutes. Prepare phosphate buffer solutions with different concentrations of oxytetracycline (OTC), mix them with the DNA-functionalized magnetic beads, and incubate for 60 minutes. Place the printed electrode in the detection cell, and take 10 μL of the phosphate buffer solution mixed with the DNA-functionalized magnetic beads with the above different concentrations of oxytetracycline (1.0×10 -6 、1.0×10 -7 、1.0×10 -8 、1.0×10 -9 M) and drop it onto the working electrode in the detection cell, and record the potential change. The detection process is as shown in Figure 7 shown, and the real-time response curve and calibration curve are as shown in Figure 2 .

[0071] The real-time response curve is as shown in Figure 2 a, and the calibration curve is as shown in Figure 2 b. As can be seen from Figure 2 , this method can be used for the potentiometric determination of oxytetracycline. As the concentration of oxytetracycline increases, the potential difference gradually increases. Under the optimal conditions, the linear determination range of the potentiometric nucleic acid aptamer sensor for oxytetracycline is 1 - 1000 nM. The optimal conditions refer to a buffer solution pH of 7 and a magnetic field suction of 9 kg.

[0072] Example 3

[0073] The difference from Example 1 is that the polymer membrane in the ion-selective polymer membrane electrode is prepared as follows

[0074] The polymer membrane components are 175.2 mg of polyurethane, 175.2 mg of o-nitrophenyl octyl ether, and 0.6 mg of tri(dodecyl)methylammonium chloride. After weighing, dissolve them in 3.2 mL of tetrahydrofuran, stir evenly, and set aside.

[0075] The electrode is obtained by attaching the polymer membrane obtained above to the electrode substrate. After drying, it can be used for the determination of negatively charged DNA in the buffer solution to be measured.

[0076] Example 4

[0077] The difference from Example 1 is that the polymer membrane in the ion-selective polymer membrane electrode is prepared as follows

[0078] The ion selective electrode membrane components are 175.2 mg of polyurethane, 175.2 mg of o-nitrophenyl octyl ether, and 0.6 mg of tetra(dodecyl)ammonium chloride, which are weighed and dissolved in 3.2 mL of tetrahydrofuran, stirred evenly, and set aside.

[0079] The polymer film obtained above is attached to an electrode substrate to obtain an electrode, which can be used to measure negatively charged DNA in a buffer solution to be tested after drying.

[0080] Example 5

[0081] The difference from Example 1 is that the polymer membrane in the ion-selective polymer membrane electrode is prepared as follows:

[0082] The ion selective electrode membrane components are 175.2 mg of polyurethane, 175.2 mg of o-nitrophenyl octyl ether, and 0.6 mg of didodecyldimethylammonium chloride, which are weighed and dissolved in 3.2 mL of tetrahydrofuran, stirred evenly, and set aside.

[0083] The polymer film obtained above is attached to an electrode substrate to obtain an electrode, which can be used to measure negatively charged DNA in a buffer solution to be tested after drying.

[0084] Example 6

[0085] The polymer membrane of the ion-selective polymer membrane electrode was prepared as follows

[0086] The polymer membrane components are 175.2 mg of polyvinyl chloride, 175.2 mg of o-nitrophenyl octyl ether, and 0.6 mg of tridodecylmethylammonium chloride, which are weighed and dissolved in 3.2 mL of tetrahydrofuran, stirred evenly, and set aside.

[0087] The polymer film obtained above is attached to an electrode substrate to obtain an electrode, which can be used to measure negatively charged DNA in a buffer solution to be tested after drying.

[0088] Example 7

[0089] The ion-selective polymer membranes prepared in Examples 1, 4, 5, and 6 were assembled into electrodes according to the method described in Example 1. Potential measurements were performed according to the DNA potential measurement method in Example 1 to record potential changes. The obtained potential changes were compared. The degree of potential change was as follows. Figure 4 .

[0090] Depend on Figure 4 It can be seen that when the preferred hexadecyltrimethylammonium chloride is used as the ion exchanger, a more obvious change in polymer membrane potential can be obtained; compared with tri(dodecyl)methylammonium chloride and tetra(dodecyl)ammonium chloride, when didodecyldimethylammonium chloride is used as the ion exchanger, a more obvious change in potential can be obtained.

[0091] Example 8

[0092] It is different from Example 1 in that the polymer membrane in the ion - selective polymer membrane electrode is prepared as follows

[0093] Weigh 170.32 mg of polyvinyl chloride, 170.32 mg of o - nitrophenyl octyl ether, 13.57 mg of cetyltrimethylammonium bromide, and 0.619 mg of tetra - (dodecyl) ammonium tetra - (4 - chlorophenyl) borate, dissolve them in 3 mL of tetrahydrofuran. After stirring evenly, drop the solution onto the surface of the working electrode of the printed electrode. After the tetrahydrofuran volatilizes, it is used as the polymer membrane electrode for standby.

[0094] The electrode is obtained by attaching the polymer membrane obtained above to the electrode substrate. After air - drying, it can be used to measure negatively - charged DNA in the buffer solution to be measured.

[0095] Example 9

[0096] It is different from Example 1 in that the polymer membrane in the ion - selective polymer membrane electrode is prepared as follows

[0097] The ion - selective electrode membrane components are 175.2 mg of polyurethane, 175.2 mg of o - nitrophenyl octyl ether, and 0.6 mg of tetra - (dodecyl) ammonium chloride. After weighing, dissolve them in 3.2 mL of tetrahydrofuran, stir evenly, and then use for standby.

[0098] The electrode is obtained by attaching the polymer membrane obtained above to the electrode substrate. After air - drying, it can be used to measure negatively - charged DNA in the buffer solution to be measured.

[0099] Example 10

[0100] It is different from Example 1 in that the polymer membrane in the ion - selective polymer membrane electrode is prepared as follows

[0101] The ion - selective electrode membrane components are 175.2 mg of polyurethane, 175.2 mg of o - nitrophenyl octyl ether, and 0.6 mg of didodecyldimethylammonium chloride. After weighing, dissolve them in 3.2 mL of tetrahydrofuran, stir evenly, and then use for standby.

[0102] The electrode is obtained by attaching the polymer membrane obtained above to the electrode substrate. After air - drying, it can be used to measure negatively - charged DNA in the buffer solution to be measured.

[0103] Example 11

[0104] It is different from Example 1 in that the ion - selective polymer membrane electrode is prepared as follows

[0105] Weigh 170.32 mg of polyurethane, 170.32 mg of o-nitrophenyl octyl ether, 13.57 mg of cetyltrimethylammonium bromide, and 0.619 mg of tetra(dodecyl)ammonium tetrakis(4-chlorophenyl)borate and dissolve them in 3 mL of tetrahydrofuran. After stirring evenly, pour the solution into a glass ring with an inner diameter of 5 cm fixed on a glass plate. After the tetrahydrofuran has evaporated, use a punch to cut the membrane into small round pieces with a diameter of 3 mm and paste them onto the pipette tips with PVC tubes at the bottom to serve as polymer membrane electrodes for later use.

[0106] The device is as Figure 5 shown and includes a detection cell, a traditional polymer membrane electrode with internal filling solution, an electrochemical external measurement device, and an external magnetic field.

[0107] Example 12

[0108] Preparation of a novel all-solid-state ion-selective polymer membrane electrode: Weigh 170.32 mg of polyurethane, 170.32 mg of o-nitrophenyl octyl ether, 13.57 mg of cetyltrimethylammonium bromide, and 0.619 mg of tetra(dodecyl)ammonium tetrakis(4-chlorophenyl)borate and dissolve them in 3 mL of tetrahydrofuran. Stir evenly. Take 10 μL of the membrane solution and drop it onto the solid electrode, and let it dry.

[0109] The device is as Figure 6 shown and includes a detection cell, a novel all-solid-state ion-selective polymer membrane electrode, an electrochemical external measurement device, and an external magnetic field.

[0110] Example 14

[0111] DNA (ACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT) is negatively charged in Tris-HCl buffer (1 mM, pH 7) to obtain a DNA buffer solution. Add magnetic materials wrapped with gold nanoparticles to the prepared DNA buffer solution, mix and incubate for 60 minutes. After magnetic separation and washing, take 10 μL and add it to the working electrode of the printed electrode placed in the detection cell, and measure the open-circuit potential and record it as E1; add a polypeptide solution with a positive charge (RRRRRRRRR) to mask the negative charge of DNA, incubate for 60 minutes. After magnetic separation and washing, take 10 μL and add it to the working electrode of the printed electrode placed in the detection cell, and measure the open-circuit potential and record it as E2; add oxytetracycline (1.0×10 -6 M) that can interact with DNA, incubate for 60 minutes. After magnetic separation and washing, take 10 μL and add it to the working electrode of the printed electrode placed in the detection cell, and measure the open-circuit potential and record it as E3;

[0112] The results showed that E2 decreased significantly compared with E1, and E3 increased significantly compared with E2 but was still smaller than E1; by masking the negative charge of DNA with a positively charged polypeptide and reacting the complex solution with oxytetracycline, and then changing the polymer membrane potential, qualitative / quantitative potentiometric determination of oxytetracycline can be achieved.

[0113] Example 15

[0114] The difference from Example 14 is that

[0115] Specific functional group-modified magnetic materials were added to the prepared DNA-1 (GTGCAGCGATGTTTCCGGTGC) disodium hydrogen phosphate-citric acid buffer solution, and the mixture was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open-circuit potential was measured and recorded as E1; DNA-2 (GGCAGGACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT) disodium hydrogen phosphate-citric acid buffer solution that partially matched this DNA was added, and it was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open-circuit potential was measured and recorded as E2; oxytetracycline (1.0×10 -6 M) that could react with DNA-2 was added, and it was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open-circuit potential was measured and recorded as E3;

[0116] The results showed that E2 increased significantly compared with E1, and E3 decreased significantly compared with E2 but was still larger than E1; by the fact that oxytetracycline can interact with DNA-2, and then changing the polymer membrane potential, qualitative / quantitative potentiometric determination of oxytetracycline can be achieved.

[0117] Example 16

[0118] The difference from Example 15 is that

[0119] The configured DNA-1 (GTGCAGCGATGTTTCCGGTGC) was added to a potassium dihydrogen phosphate-sodium hydroxide buffer solution containing gold-coated magnetic materials, and the mixture was incubated for 60 minutes. After magnetic separation and washing, DNA-2 (GGCAGGACGTTGACGCTGGTGCCCGGTTGTGGTGCGAGTGTTGTGT), which is partially complementary to this DNA, was added to the potassium dihydrogen phosphate-sodium hydroxide buffer solution, and the mixture was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open circuit potential was measured and denoted as E1; DNA-3 (CTACTCTCATCCGTCACA) buffer solution, which is partially complementary to DNA-2, was added, and the mixture was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open circuit potential was measured and denoted as E2; oxytetracycline (1.0×10 -6 M), which can interact with DNA-2, was added, and the mixture was incubated for 60 minutes. After magnetic separation and washing, 10 μL was taken and added to the working electrode of the printed electrode placed in the detection cell, and the open circuit potential was measured and denoted as E3;

[0120] The results showed that E2 increased significantly compared with E1, E3 decreased significantly compared with E2, and was less than E1; oxytetracycline can interact with DNA-2, displace DNA-3, thereby changing the potential of the polymer membrane and realizing potential signal amplification, and qualitative / quantitative potential determination of oxytetracycline can be achieved.

[0121] Example 16

[0122] The DNA aptamer sequence CATCCGTCACACCTGCTCCACCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC, which has a selective recognition effect on sulfonamides, was selected and labeled with biotin according to the prior art, that is, biotin-CATCCGTCACACCTGCTCCA-CCCACTACACTCATCCGTCACACCTGCTCCCCCCACTGGGTGTTCGGTCCCGTATC; and then sulfonamides were detected:

[0123] The potential sensor obtained in Example 1 above was used to detect sulfonamides. During the measurement, an open circuit potential measurement technique was adopted. A phosphate buffer solution containing DNA (1 mM, pH 7) was configured, mixed with streptavidin-modified magnetic beads (purchased commercially), incubated for 30 min, and then washed twice with a phosphate buffer solution (containing 1 mM sodium chloride) with a pH of 7.4 and a concentration of 1 mM to prepare DNA-modified magnetic beads. 10 μL of the DNA-modified magnetic beads was dropped onto the electrode, and the open circuit potential E1 was measured.

[0124] Sulfanilamide was configured into phosphate buffer solutions with different concentrations (1.0×10 -6 、1.0×10 -7 、1.0×10 -8 、1.0×10 - 9 M) in a conventional manner;

[0125] Take 10 μL of the DNA-modified magnetic beads obtained above and mix them with the sulfanilamide solutions with different concentrations obtained above, and incubate them for one hour respectively. After incubation, wash them twice and dilute them to 10 μL. Take 10 μL of the solution after incubation with different concentrations of sulfanilamide diluted above and drop it onto the electrode for potential measurement to obtain the potential change E2 of bacteria with different concentrations.

[0126] Calculate the potential change (the potential difference between E1 and E2) caused by the DNA-modified magnetic beads on the electrode before and after incubation with sulfanilamide, and plot a graph of the logarithm of the sulfanilamide concentration to draw a standard curve.

[0127] As can be seen from the above potential measurement of sulfanilamide, the added sulfanilamide is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of sulfanilamide increases, the potential difference gradually increases.

[0128] Example 17

[0129] The difference from Example 16 is that:

[0130] The DNA aptamer sequence TGGGGGTTGAGGCTAAGCCGA that has a selective recognition effect on aminoglycoside antibiotics (kanamycin) was selected and labeled with biotin according to the prior art, that is, biotin-TGGGGGTTGAGGCTAAGCCGA; and then kanamycin was detected.

[0131] As can be seen from the above potential measurement for kanamycin, the added kanamycin is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of kanamycin increases, the potential difference gradually increases.

[0132] Example 18

[0133] The difference from Example 16 is that:

[0134] Select the DNA aptamer sequence ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGT-GGTAG that has a selective recognition effect on amide alcohol antibiotics (chloramphenicol), and label it with biotin according to the prior art, that is, biotin-ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAG; and then detect chloramphenicol. From the above potentiometric determination of chloramphenicol, the added chloramphenicol is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of chloramphenicol increases, the potential difference gradually increases.

[0135] Example 19

[0136] The difference from Example 16 is that:

[0137] Select the DNA aptamer sequence TCTCTGAGCCCGGGTTATTTCAGGGGGA that has a selective recognition effect on quinolone antibiotics (enrofloxacin), and label it with biotin according to the prior art, that is, biotin-TCTCTGAGCCCGGGTTATTTCAGGGGGA; and then detect enrofloxacin. From the above potentiometric determination of enrofloxacin, the added enrofloxacin is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of enrofloxacin increases, the potential difference gradually increases.

[0138] Example 20

[0139] The difference from Example 16 is that:

[0140] Select the DNA aptamer sequence AGGAATTCACGTCTCACTGGATTCACGCACGC-CAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG that has a selective recognition effect on macrolide antibiotics (erythromycin), and label it with biotin according to the prior art, that is, biotin-AGGAATTCACGTCTCACTGGATTCACGCACGCCAAGGACTGCACTTAAGGTTAGATAGCCCCATGCAGTGAGTCAGGATATCG; and then detect erythromycin. From the above potentiometric determination of erythromycin, the added erythromycin is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of erythromycin increases, the potential difference gradually increases.

[0141] Example 21

[0142] The difference from Example 16 is as follows:

[0143] Select the DNA aptamer sequence GTACTTAATTTGAGGTGACGGGCACGTGAAACAGGCGAG that has a selective recognition effect on the protein (trypsin), and label it with biotin according to the prior art, that is, biotin-GTACTTAATTTGAGGTGACGGGCACGTGAAACAGGCGAG; then detect trypsin. From the above potentiometric determination of trypsin, the added trypsin is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of trypsin increases, the potential difference gradually increases.

[0144] Example 22

[0145] The difference from Example 16 is as follows:

[0146] Select the DNA aptamer sequence CACTTTCCGGTTAATTTATGCTCTACCCGTCCACCT-ACCG that has a selective recognition effect on the virus (B.1.1.7 SARS-CoV-2), and label it with biotin according to the prior art, that is, biotin-CACTTTCCGGTTAATTTATGCTCTACCCGTCCACCTACCG; then detect B.1.1.7 SARS-CoV-2. From the above potentiometric determination of B.1.1.7 SARS-CoV-2, the added B.1.1.7 SARS-CoV-2 is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of B.1.1.7 SARS-CoV-2 increases, the potential difference gradually increases.

[0147] Example 23

[0148] The difference from Example 16 is as follows:

[0149] Select the DNA aptamer sequence TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC that has a selective recognition effect on bacteria (E. coli), and label it with biotin according to the existing technology, that is, biotin-TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC; then detect E. coli. From the above potentiometric measurement of E. coli, the added E. coli is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of E. coli increases, the potential difference gradually increases.

[0150] Example 24

[0151] The difference from Example 16 is:

[0152] Select the DNA aptamer sequence GGTTGGTGTGGTTGG that has a selective recognition effect on heavy metal ions (Pb 2+ ) and label it with biotin according to the existing technology, that is, biotin-GGTTGGTGTGGTTGG; then detect Pb 2+ . From the above potentiometric measurement of Pb 2+ , the added Pb 2+ is recognized and bound by the corresponding aptamer DNA, causing a change in the charge density of the aptamer DNA before and after incubation. As the concentration of Pb 2+ increases, the potential difference gradually increases.

[0153] Example 25

[0154] The difference from Example 2 is:

[0155] The device is as Figure 3 shown and includes a detection cell, a printed electrode, an electrochemical external measurement device, and an external magnetic field; the printed electrode is placed in the detection cell, and an external magnetic field (magnets with different fixed magnetic field intensities) is applied. The working electrode and the reference electrode of the printed electrode are respectively connected to the electrochemical external measurement device. The ion-selective polymer membrane of the working electrode is obtained according to the preparation method described in Example 1 above. The stirred polymer membrane is introduced into a glass cup with an inner diameter of 5 cm fixed on a glass plate. After the tetrahydrofuran volatilizes, the membrane is cut into small circular pieces with a diameter of 3 mm using a puncher and pasted on the pipette tip with a PVC tube at the bottom to serve as a polymer membrane electrode.

[0156] Example 26

[0157] The difference from Example 2 is as follows:

[0158] The device is as shown in Figure 3 and includes a detection cell, a printed electrode, an electrochemical external measurement device, and an external magnetic field; the printed electrode is placed in the detection cell, and an external magnetic field (an electromagnet with a fixed and adjustable magnetic field intensity) is applied. The working electrode and the reference electrode of the printed electrode are respectively connected to the electrochemical external measurement device. The ion-selective polymer membrane of the working electrode is obtained according to the preparation method described in Example 1 above. 10 μL of the uniformly stirred membrane solution is dropped onto the solid electrode and dried to obtain a polymer membrane electrode.

[0159] Example 27

[0160] The difference from the principle in the above examples, where the aptamer and the target substance bind with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions, resulting in a conformational change of the aptamer and a change in its charge density for direct potentiometric detection, is as follows:

[0161] By introducing other single-stranded DNAs to perform partial base complementary pairing with the single-stranded DNA immobilized on the magnetic beads, and then the single-stranded DNA on the magnetic beads binds to the target, causing complementary strand displacement, resulting in a change in the charge density of the DNA on the magnetic beads for direct potentiometric detection of the principle and method.

[0162] Example 28

[0163] The difference from Example 27 is as follows:

[0164] By introducing other single-stranded DNAs to perform partial base complementary pairing with the single-stranded DNA immobilized on the magnetic beads, and then the introduced single-stranded DNA binds to the target, causing complementary strand displacement, resulting in a change in the charge density of the DNA on the magnetic beads for direct potentiometric detection of the principle and method.

[0165] The corresponding target substances detected in the embodiments are not limited to the above embodiments, including proteins that bind to nucleic acid aptamers with high affinity and strong specificity through covalent bonds, hydrogen bonds, van der Waals forces, hydrophobic interactions, and electrostatic attractions, such as {ε-p protein, β-lactamase enzyme protein, β-arrestin, α-thrombin protein, α-CGRP protein, α-bungarotoxin and cardiotoxin, α6β4 protein, α4 integrin, Yes-associated protein (YAP), YAP WW1 protein, XMRV RT protein, XIa protein, WWP1 protein, WT1 protein, WT and M3 enzyme protein, VWF A1 domain protein, VSGs protein, VP35 protein, VP1 protein, von Willebrand factor protein, vitamin D protein, virus-encoded hemagglutinin protein, virus tat protein, vero cell toxin protein, vascular endothelial growth factor protein, vascular endothelial growth factor A (VEGF-A) protein, vascular endothelial growth factor VEGF165 protein, VCLD protein, vascular endothelial growth factor (VEGF*165*) protein, Vc2 protein, vasopressin protein, VASN protein, vascular endothelial growth factor receptor 2 (VEGFR2) protein, vanillin protein, vaccinia virus protein, USP14 protein, urinary creatinine protein, uPA protein, UCH37 protein, U1A protein, protein tyrosine kinase-7 (PTK7) protein, tumor necrosis factor-α (TNFα) protein, tryptophan protein, TRPV1 protein, troponin T (TnT) protein, troponin (TI) protein, tropomyosin-related kinase receptor type B (TrkB) protein, tropomyosin, triclosan protein, transferrin receptor protein, transcription factor protein, TPB protein, TB protein, Tospovirus N protein, TomSys protein, Toll-like receptor (TLR) 3, 7, 8, and 9 proteins, tobramycin protein, TO1-biotin protein, TNF-a protein, TLR-9 protein, Tim-3 protein, thrombospondin-1 (TSP-1) protein, thrombin, ApoE, PAI-1, IgE, lysozyme, carcinoembryonic antigen, hirudin, prostate-specific antigen (PSA), and 4-1BB protein, thioflavin T (ThT) protein, soluble interleukin 2 receptor alpha (sIL-2Ra) protein, N-peptide, and U1A protein, mAb 2G12 protein, human immunodeficiency virus reverse transcriptase (HIV-1RT) protein, Arabidopsis thaliana thiC TPP protein, TGF-β protein, TGFBR2 protein, TGF-β1 protein, TfR protein, TF AP-1 (5ECdsAP1) protein, TEV protease gene protein, tetraphenylethylene protein, tetramethylrhodamine protein, tetracycline (TET) protein, TetR protein, tenascin-C protein, TCF4 protein, TCF, and β-catenin protein, TBP protein, Tb protein,tau441 protein, TATA-box binding protein, target RNA hairpin protein, Taq polymerase protein, T. cruzi trypomastigote protein, sγc protein, synaptosome-associated protein 25 (cSNAP-25), surface glycoprotein (gp 120), sulforhodamine B protein, sulfamethazine protein, STX protein, streptavidin (SA) protein, STIV protein, STIP1 protein, Stat5 protein, STAT3 dimerization domain protein, STAT1 protein, STAT protein, staphylococcal enterotoxin B (SEB), β-lactoglobulin, β-catenin protein, β-bungarotoxin protein, sphingosine 1-phosphate protein, SPC protein soluble interleukin 5 receptor protein, SmpB protein, small malachite green protein, SMAD4 protein, SLAMF7 protein, Sip1 protein, Siglec-5 protein, sialyl-Lewis-X protein, Shp2 protein, kainate receptor protein, sGP protein, pre-fibrillar amyloid aggregate of serum albumin, serotonin protein, Sec7 domain of cytohesin-1 protein, Sec7 domain of cytohesin-1 protein, SEB protein, sea protein, selectin, SCs protein, SARS-CoV-2 protein, SARS-CoV helicase protein, SAM-I riboswitch protein, Salmonella invasion protein A (SipA) protein, Salmonella enteritidis protein, Salmonella enterica serovar Typhimurium protein, Salmonella protein, SAH protein, S-adenosylmethionine protein, S845GluA1 AMPA protein, S100A8 protein, S100 calcium-binding protein B (S100B. Gene ID#6285), S. typhimurium protein, Staphylococcus aureus protein, RTA protein, RT enzyme protein, RT protein, RstA protein, Rrm4 protein, RNase E protein, RNAP protein, RNA-dependent RNA polymerase (RdRp) protein, RNA-dependent RNA polymerase protein, RNA helicase protein DHX9 protein, RIG-I protein, ricin protein, ribozyme protein, riboflavin protein, rHuEPO-a protein, rHuEPO protein, RhoGEFs protein, RhoA protein, RhD antigen protein, Rev protein, RET protein, Rep protein, Rep N-terminal protein, RelA protein, recombinant human erythropoietin-α (rHuEPO-α) protein, Rb1 protein, RasGAP SH3 protein, rapamycin protein, RAP1 protein, Raf-1 protein, RAD52 protein, RAC protein, rabbit immunoglobulin G protein, rabbit IgG protein, PTK7 receptor protein, PSMA protein, PSA protein, PrPs protein, PrP protein, prothrombin protein, protein tyrosine phosphatase 1B (PTP1B) protein, protein immunoglobulin E protein, protein C, protein AProstate-specific membrane antigen (PSMA) protein, prostate cancer cell protein, prokaryotic ubiquitin-like protein, programmed death ligand 1 protein, progastrin-releasing peptide (proGRP) protein, PQQGDH protein, PPV protein, polychlorinated biphenyls (PCBs) protein, poly-α-D-glutamic acid (α-PDGA)-protein, p-nosyl-l-lysine (PSL) protein, pLDH protein, Plasmodium lactate dehydrogenase protein, Plasmodium falciparum lactate dehydrogenase protein, plasma CVD risk protein, PfLDH protein, PfEMP1 protein, peanut allergen Ara h 1 protein, PE protein, PD-L1 protein, PDGFRβ protein, DGF-BB, PDGF-AB, PDGF-AA protein, PCSK9 protein, PCNA protein, PC-3 protein, pBT-SmpB or pBT-ArfA protein, patulin protein, pattern recognition receptor (PRR) protein, paromomycin protein, PAP protein, PAT protein, pAF protein, PAE protein, p4E protein, P2 DNA polymerase IV (Dpo4) protein, P16 protein, P protein, oxytetracycline (OTC) protein, OX40 protein, ochratoxin A (OTA) protein, osteopontin, OPN protein, oocyte zona pellucida (ZP) protein, okadaic acid protein, OFL protein, nucleolar protein, nucleolar protein receptor protein, nucleocapsid protein, NS5B viral protein, NS3 protease domain protein, NS2 protein, NS1 protein, Nox protein, novel recombinant anti-neuroexcitatory peptide protein, norovirus protein, Nogo-66 receptor (NgR) protein, non-structural 5B (NS5B) polymerase, NMM protein, nicotinic acetylcholine receptor, N-glycosylated peptide fragment of vascular endothelial growth factor protein, NGAL protein, NF-κB protein, NFAT5 protein, neuropeptide nociceptin / orphanin FQ (N / OFQ) protein, neomycin-B, neomycin protein, NCp7 protein, NCL protein, Nampt protein, myoglobin, myelin basic protein (MBP), myelin protein, MutS protein, mutant p53 protein, mutant huntingtin protein, Musashi-1 (MSI1) protein, murine norovirus protein, murine myelin protein, murine c-kit receptor, mucin1 (MUC1) protein, MUC16 protein, MU target protein, mTECs protein, mTCT8–4 protein, MT1-MMP protein, MSCs protein, MS2-MBP protein, MS2-CP protein, PP7 protein, MS2 coat protein, MRP1-CD28 protein, MREs protein, MPT64 protein, mPPs protein, mouse Lcn2 (mLcn2) protein, morin protein, monomeric L-selectin protein, MLL1 protein, MK protein, mitochondrial cytochrome c protein, miRNA-21 protein, minT1-LF protein, mIgG2b proteinmiRNA protein, microcystin-LR (MC-LR) protein, METH protein, mEND protein, MDM2 protein, mCRP protein, MCP-1 protein, MCF-7R cell protein, Mb protein, ManLAM and M.tb H37Rv protein, manganese ion protein, MAGE-A3 protein, M2-PK protein, M1 influenza virus protein, lysozyme analyte protein, lysozyme (Lyz) protein, ergotamine, ergoline and ergopeptine alkaloid protein, lysine protein, lymphocytic leukemia protein, lung cancer receptor tyrosine kinase AXL protein, L-selectin protein, LPSs protein, Listeria monocytogenes protein, Listeria protein, lipopolysaccharide protein, lipoarabinomannan protein, LH protein, Leishmania protein, lead (II) protein, low density lipoprotein, Latelet-derived growth factor (PDGF) protein, L-arginine amide protein, LAG3 protein, lactoferrin, lactate dehydrogenase protein, Ku70 protein, KRAzR protein, KRAS protein, kinase protein, kanamycin protein, K88 protein, K homology (KH) protein, JAB1 / CSN5 protein, IXa protein, isoleucine protein, isoflavone aglycone, berberine hydrochloride, jatrorrhizine hydrochloride, tetradine, geniposide, oxymatrine and zizyphus saponin A protein, irinotecan protein, IRES protein, intracellular cancer-related microRNA protein, intrinsic A protein, interleukin 6 receptor (IL-6R) protein, interferon-γ protein, interferon protein, integrin α6β4 protein, insulin receptor (IR) protein, IMP3 protein, immunoglobulin M (IgM)- and immunoglobulin D (IgD) protein, immunoglobulin E (IgE) protein, ricin protein, imidacloprid protein, Ile, tryptophan, His, Phe, tyrosine, arginine and leucine protein, IL-6R domain 3 (IL-6R D3) protein, IL-6R protein, IL-6 protein, IL4Ra protein, IL-1α protein, IL-17A protein, IL-10 receptor protein, IgG protein, IGF-IIR protein, IGF-I protein, DNA binding protein 1 inhibitor, ICOS protein, hypoxanthine protein, human immunodeficiency virus type 1 (HIV-1) Rev protein, human α-thrombin protein, human tumor necrosis factor α (TNF-a) protein, human transferrin receptor (TfR) protein, human protein tyrosine kinase 7 (PTK7) protein, human platelet antigen HPA-1a protein, human LIN28A protein, human leukocyte elastase (HLE) protein, human interleukin (IL)-10 and human 4-1BB receptor protein, human interleukin 6 receptor protein, human immunodeficiency virus type 1 reverse transcriptase protein, human immunodeficiency virus reverse transcriptase (HIV RT) protein, human histone H4 protein, human epidermal growth factor receptor 2 (HER2) protein, human E2F3 protein,Human cardiac troponin I (cTnI) protein, B cell surface protein CD20 protein, human α-thrombin (Tmb) protein, human ApoA1 protein, human 8-oxoG DNA glycosylase 1 (hOGG1) protein, HTLV-I Rex protein, hTERT protein, HspX protein, HSP90, integrin αVβ5 and Contactin-1 protein, Hsp70 protein, Hsp27 protein, HSL protein, HSF1 protein, Hsc70 protein, HRP-II protein, HPV-16L1 VLPs protein, HPV16E7 protein, host cell protein (HCP) protein, Hodgkin lymphoma (HL) tumor cell protein, hMMP-9 protein, HMGB1 protein, HIV-RT protein, HIV-1 Tat protein, HIV-1 RT protein, HIV-1 RNase H protein, HIV-1 reverse transcriptase (RT) protein, HIV-1 Rev protein, HIV-1 PR protein, HIV-1 integrase inhibitor protein, HIV-1 integrase protein, HIV-1 glycoprotein gp120, HIV reverse transcriptase (HIVRT) protein, HIV integrase protein, his-tag protein, hIgE protein, HIF-1α protein, Hfq protein, hFc1 protein, HepG2 protein, hepatocyte growth factor receptor (cMet) protein, hepatitis C virus protein, heparanase protein, heme protein, hemagglutinin (HA) protein, heavy metal protein, HE4 protein, HDV ribozyme protein, HCV-CRE protein, HCV NS3 protein, HCV non-structural protein, hepatitis C protein, hCG protein, hepatocellular carcinoma protein, HBsAg protein, HA protein, HAT protein, H4-K16Ac peptide protein, H3 peptide protein, H1-HA1 protein, GST-Snu13 fusion protein, GRK2 protein, Gremlin-1 protein, G-protein coupled receptor kinase protein, GPCR-AAB protein, GPC3 protein, GP120 protein, gonadotropin protein, glycoprotein, glycine protein, GluR1 protein, GLP-1 protein, gliadin, Gk-S15 protein, GFP protein, GDH protein, Gauss luciferase (GLuc) protein, Galectin-1 protein, FQ protein, FOXM1 protein, folate protein, FokI protein, flavin mononucleotide protein, FIXa protein, FIX protein, fibronectin, fibrin D-dimer, fibrinogen and fibrinogen γ-chain protein, FGFR3 protein, FGFR1 protein, FGFR protein, ferritin preparation protein, Fc domain protein, FB1 protein, factor IXa protein, factor IX protein, exosome protein, exosite I protein, eukaryotic initiation factor 4A (eIF4A) protein, ethanolamine protein, ETA-AABs protein, estrogen receptor α (ERα) protein, E-selectin proteinEscherichia coli thioredoxin A (TrxA) protein, Escherichia coli RNA polymerase, ESAT-6 protein, ERα protein, ERBB3 receptor protein, ErbB2 protein, EPO protein, epirubicin protein, epinephrine protein, epidermal growth factor receptor variant III protein, epidermal growth factor receptor (EGFR) protein, EpCAM protein, enhanced green fluorescent protein (eGFP) protein, endotoxin protein, endothelin B receptor (ETBR) protein, endoglin, enantiomeric protein, eIF4G protein, eIF4E protein, eIF4A protein, EGFRvIII protein, EGFR1, MMP7, CA6, KIT, CRP, C9 and SERPINA3 protein, eEF1A protein, Escherichia coli protein AlkB protein, Dxl6 protein, D-vasopressin protein, duck HBV core protein, Ds-Px protein, Drosophila B52 protein, d-peptide protein, doxorubicin (DOX) protein, dopamine protein, DOCK8 protein, DNA polymerase protein, DMHBI protein, DFHBI and fluorescent protein, dexamethasone (DXN) protein, DENV-2 EDIII protein, DENV-2 ED3 protein, DEHP protein, DEC205 protein, cytohesin-2 protein, cytoadhesin protein, cytochrome c protein, cystatin C protein, CypB protein, cyclophilin B protein, cyclin-dependent protein kinase protein, cyclin-dependent kinase 2 (Cdk2) protein, CTX3 protein, CTx protein, cTnI protein, CTLA-4 protein, C-terminal peptide protein, Cry1Ab protein, CRP protein, CRMP2 protein, creatine kinase MB (CKMB) protein, creatine kinase B type protein, C-reactive protein (CRP) protein, clarithromycin protein, CPS protein, cortisol protein, COM protein, colorectal cancer protein, colon cancer receptor protein, coenzyme A (CoA) protein, codeine protein, coat protein (MCP), coagulation factor VIII protein, c-Met and CD71 protein, cMb protein, cJun protein, ciprofloxacin protein, cholesterol esterase protein, chloramphenicol protein, CFP-10.ESAT-6 heterodimer protein, CFP-10 protein, ceruloplasmin (Cp) protein, cell surface receptor protein, cell surface nucleolar protein, cell surface antigen protein, nuclear protein, cell membrane protein tyrosine kinase 7 (PTK7) protein, CDK2 protein, CD71 protein, CD30 receptor protein, CD28 protein, CD200R1 agonist protein, CD200R1 protein, CD19 protein, CD18 protein, CD133 protein, CD117 protein, CD109 protein, CD105 protein, CCR5 protein, CCK-BR protein, CC chemokine receptor 5 (CCR5) protein, CBD3 protein, cathepsin E protein, carbonic anhydrase IX (CAIX) proteinCaprolactam protein, CAP protein, cancer biomarker PDGF-BB protein, cancer biomarker MUC-1 protein, Campylobacter jejuni protein, Campylobacter protein, Camptothecin (CPT) protein, Cam protein, Calcitonin gene-related peptide (CGRP) protein, Calcineurin protein, CA125 protein, CA I protein, C5a and C5a-desArg protein, C4-HSL protein, btuB protein, BSA protein, Bru protein, Bovine thrombin protein, Bovine prion protein (bPrP) protein, Bovine pregnancy-associated glycoproteins (bPAGs) protein, Bont protein, BoNT / A protein, Bleomycin (BLM) protein, Bisphenol A (BPA) protein, Biofilm protein, BIM protein, Bevacizumab protein, Beta1-AAB protein, beta1(II)-AABs protein, Benzylguanine protein, Bcs1 protein, B cell lymphoma protein, B cell activation factor receptor (BAFF-R) protein, BAFF-R protein, Bacillus thuringiensis spore protein, Bacillus anthracis spore protein, B1-CT protein, Bacillus subtilis glyQS T-box protein, B. cereus fluoride riboswitch protein, Aβ binding partner protein, Aβ42 protein, Aβ40 protein, AVP protein, ATP and GTP protein, ATP and ADA protein, a-synuclein, Arsenic protein, Arginine amide and related ligands, Arginine amide protein, Ara h 1 protein, AR protein, APC protein, Anti-lysozyme protein, Anti-FLAG M2 antibody protein, Annexin A2 (ANXA2) protein, Angiopoietin-2 and Thrombospondin-2, Angiopoietin protein, Ang2 protein, Ang1 protein, β-amyloid peptide protein, Amyloid protein, AMPA receptor protein, AML1 protein, AML cell protein, Aminoglycoside protein, Amino protein, AMGs protein, ALPPL2 protein, alpha4 integrin protein, ALP protein, AlkB protein, Aldehyde-inactivated type A botulinum neurotoxin protein, AK protein, AIB1-CID protein, AGR2 protein, AGEs protein, Ag85 protein, AFM1 protein, Aflatoxin M1 protein, Aflatoxin B2 protein, Aflatoxin B1 protein, Advanced glycation end products (AGE) protein, Adipocyte protein, ADH protein, Adenosine deaminase (added) protein, Adenosine protein, Adenine and Guanine protein, Acute myeloid leukemia 1 (AML1) protein, Active protein kinase protein, Activated protein C (APC) protein, Acetylcholinesterase protein, ABF1 protein, ABA protein, A549 cell protein, 8-OHdG protein, 5'-AMP-activated protein kinase (AMPK) protein, 4-1BB–OPN protein, 4-1BB protein, 3CD protein, 2G12 protein, 2,4,6-Trinitrotoluene protein, 1AM0 protein, 17β-Estradiol protein,16S ribosomal RNA protein, (d-)CGRP protein, annexin, β-lactoglobulin (β-LG)}, viruses {vesicular stomatitis virus, Venezuelan equine encephalitis virus, Staphylococcus aureus virus, respiratory syncytial virus, prion, mycotoxin patulin virus, murine norovirus, methicillin-resistant Staphylococcus aureus (MRSA) virus, influenza virus (A / California / 2009 / 07, H1N1), influenza virus, HuNoV virus, human cellular prion, HIV-1 virus, HIV virus, hepatitis B and C viruses (HBV, HCV virus), hepatitis D virus, H5N1 virus, H5N1 avian influenza virus, Escherichia coli virus, apple stem grooving virus (ASPV), Vibrio parahaemolyticus virus}, bacteria {Salmonella typhimurium, Pseudomonas aeruginosa, Vibrio alginolyticus, Listeria monocytogenes, Lactobacillus acidophilus, Escherichia coli, Mycobacterium tuberculosis, Salmonella enterica, Bacillus anthracis,}, cells {CD30 cell marker}, cells {Vibrio parahaemolyticus cells, vascular smooth muscle cells (VSMC) cells, Vibrio alginolyticus cells, U87MG cells, U87-EGFRvIII cells, polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) cells, TIM3-expressing lymphocytes, TICs cells, TESA cells, T cells, Staphylococcus aureus (S. aureus) cells, SMMC-7721 cells, skeletal muscle cells, SK-BR-3 breast cancer cells, Salmonella typhimurium cells, Salmonella O8 cells, Salmonella enteritidis cells, SA cells, S. typh cells, S. Paratyphi A cells, grouper brain (GB) cells, Ramos target cells, prostate cancer stem cells, prostate cancer cells (DU145), breast cancer cells (MCF-7), cervical cancer cells (HeLa), porcine endothelial progenitor cells, PMDC05 cells, PL45 cells, PCa-3M-1E8 cells, PANSORBIN cells, PANC-1 tumor cells, Pseudomonas aeruginosa cells, ovarian cancer cells, NK-type leukemia (NKL) cells, mycoplasma-infected cells, Mycobacterium tuberculosis cells, MRSA cells, murine tumor endothelial cells (mTECs), Maver-1 lymphoma cells, LH86 cells, K562 leukemia cancer cells, HUVEC cells, human embryonic kidney 293 (HEK-293) cells, HSPB1 cells, HL-60 cells, HER-2 cells, HepG2 cells, liver cancer cells, HCT116 cells, HCC cells, Gram-negative bacteria cells, gastric cancer AGS cells, Epstein-Barr virus-positive nasopharyngeal carcinoma cells, Escherichia coli O157:H7 cells, Escherichia coli O111 cells, E6 / E7-HTECs cells, circulating tumor cells (CTC), CHO-K1 cells, CEM–CCRF cells, CCRF-CEM cells, Campylobacter jejuni cells,Burkitt lymphoma cells, Bifidobacterium cells, BG1 cells, subpopulation cells of the A549 lung cancer cell line, A549 lung cancer cells, A2780Rcis cell line cells}, heavy metal ions {As(III), zinc ions, uranium ions, titanium ions, silver ions, platinum(II) ions, potassium ions, Pb(II) ions, mercury ions, Mg(II) ions, gadolinium(III) ions, cadmium(II) ions}, antibiotics {chloramphenicol (CAP), penicillin G (PEN), patulin (PAT), ofloxacin (OFL), neomycin, tobramycin, kanamycin, enrofloxacin, doxorubicin, daunorubicin, ciprofloxacin (CIP), ampicillin (AMP)}, small molecules {α-bungarotoxin, zinc oxide, zearalenone (ZEN), fumonisins, tumor necrosis factor a, tumor necrosis factor (TNF), TrpRS, bisphenol A}, other compounds {zeolitic imidazolate framework-8 (ZIF-8), tryptophan, transferrin receptor (TfnR), trans-activating response element (TAR) of HIV-1, thrombin (Thr), adenosine triphosphate (ATP), tetrahydrocannabinol (THC), tetanus toxoid, tDNA, TAR BRU variant, Sudan III, stilbene, steroid testosterone, STAT3, ssDNA, spiropyran isomers, saxitoxin, SAM-1, SAM VI, Sam alpha, PreQ1, radon, ractopamine, P-selectin, progesterone, PA toxin, theophylline (th-TAR), ochratoxin-A (OTA), naringenin, mycotoxin lactone, mitochondrial receptor, microRNA-34a (miR-34a), microcystin-LR, malachite green dye, triphenylmethane, methylphosphonic acid, lysine, L-tryptophan, β-estradiol, isocarbophos (IPS), invA gene, Hsp70-ATP, Hoechst dye, HIV RNAs, fluorescent cyanine dye, flavin mononucleotide (FMN), S-adenosylmethionine (SAM), cyclic di-GMP (c-di-GMP), d-RNA G-quadruplex (rG4), diazinon, cylindrospermopsin (CYN), cocaine, adenosine 5'-monophosphate (AMP), chlorpyrifos, brain natriuretic peptide (BNP), Bacillus thuringiensis (BT) HD-73 spores, abscisic acid (ABA), acetylcholine, 2-aminopurine, oligopeptides, adenosine, amino acid derivatives, ibuprofen or thalidomide derivatives, zeatin, zearalenone (ZEN), von Willebrand factor (VWF), vitamin D, vitamin B, urea, tyramide (TA), thioflavin T, thiazole orange (TO1), thiamine pyrophosphate (TPP), thiamine pyrophosphate (TPP), TGF-β receptor II (TβRII), tetrahydrofolic acid, tartrate, tar, T-2 toxin, sulfadimethoxine, sulfamethazine (SDM), steroids, singlet glycine, silicon rhodamine, S-ibuprofen,S-adenosylmethionine (SAM), S-adenosylmethionine (SAM), ricin A chain (RTA), quinine, poly(etherimide) (PEI), polystyrene (PS), poly[ethylene-co-(vinyl acetate)] (PEVA), phthalate, phenylalanine, N-methylporphyrin IX (NMM), N-acetylneuraminic acid (Neu5Ac), mycotoxin T-2, mucin-1, MUC-1, MSK, MnSOD, methamphetamine (MTA), desoxyephedrine, melamine (MA), MeCbl, MC-LR, MBI-eEF1A, ManLAM, malathion, malachite green (MG), l-tyrosine amide (l-Tym), l-tryptophan, lipopolysaccharide (LPS), L-histidine, l-arginine, l-arginine amide (l-Arm), isoquinoline alkaloid, hyperbranched polymer (HBP), hnRNP A1, hGlyRα1, hEPOR, guanine, guanidine, glycerol-AGEs, glutamine, glucose, ghrelin, furfuryl alcohol, GDF8, GDF11, GalNAc, flavin mononucleotide (FMN), riboflavin, ethidium, FePP, docetaxel, diclofenac (DCF), DFHO (3,5-difluoro-4-hydroxybenzylideneimidazolinone-2-oxime) fluorophore, daunorubicin (DNR), DFHBI, DFHBDI, DFBHI-1T, dATP (AP-ATP(R4e), dabigatran etexilate, cytotoxic T lymphocyte-associated antigen, cytochrome c (Cyt c), cytidine, cylindrospermopsin, cyclic diguanosine monophosphate, cyclic dinucleotide, cyclic bis-GMP, cyclic AMP-GMP, coenzyme A, cocaine, clenbuterol (CLB), citrulline, cholera toxin, cellulose, CdTe quantum dots, cdGMP, carboxymethyl cellulose (CMC), carbofuran, c-AMP-GMP, B-type natriuretic peptide (BNP), BoNT, Aβ oligomer, azoaromatic compound, atrazine, a-syn oligomer, arsenite, Aod pfl riboswitch compound, α-hemolysin, aldicarb compound, AFB1 compound, AFB2 compound, acetamiprid compound, 5-hydroxytryptophan (5-HTP), 3',3'-cGAMP, 3,5-difluoro-4-hydroxybenzylideneimidazolinone (DFHBI), 2'-deoxyguanosine compound, 2,4,6-trinitrotoluene (TNT), 19-nortestosterone (NT), 17-β-estradiol compound} etc. Sequence Listing <110> Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences <120> A detection method and device for DNA and target substances using DNA as a recognition molecule <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <400> 1 acgttgacgc tggtgcccgg ttgtggtgcg agtgttgtgt 40 <210> 2 <211> 76 <212> DNA <213> Artificial Sequence <400> 2 catccgtcac acctgctcca cccactacac tcatccgtca cacctgctcc ccccactggg 60 tgttcggtcc cgtatc 76 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 tgggggttga ggctaagccg a 21 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 acttcagtga gttgtcccac ggtcggcgag tcggtggtag 40 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <400> 5 tctctgagcc cgggttattt caggggga 28 <210> 6 <211> 83 <212> DNA <213> Artificial Sequence <400> 6 aggaattcac gtctcactgg attcacgcac gccaaggact gcacttaagg ttagatagcc 60 ccatgcagtg agtcaggata tcg 83

Claims

1. A detection method for detecting a target using DNA as an identification molecule, characterized in that: The target substance in the analyte contains a target substance with DNA as the recognition molecule. A potentiometric sensor of an ion-exchange agent-doped polymer membrane ion-selective electrode is used. Through the interaction between the DNA recognition molecule and the target substance, the potential of the ion-exchange agent-doped polymer membrane electrode changes, and then the quantitative / qualitative detection of the target substance with DNA as the recognition molecule in the sample is realized; When the analyte uses DNA as the recognition molecule, DNA serves as both the recognition molecule and the signal transduction molecule, interacts with the corresponding target substance in the analyte, causing changes in the charge and charge density of DNA, and then changing the potential of the ion-exchange agent-doped polymer membrane electrode, thereby realizing the detection of the target substance; among them, the recognition molecule DNA is added to a buffer solution, and the buffer solution is a buffer solution with a pH of 6.8 - 8.

0.

2. The detection method of the target using DNA as the recognition molecule according to claim 1, characterized in that: The analyte is a target substance with DNA as the recognition molecule. The recognition molecule is fixed on a magnetic material to obtain DNA-functionalized magnetic beads. DNA serves as both the recognition molecule and the signal transduction molecule, interacts with the target substance in the test solution, causing changes in the potential of the DNA-functionalized magnetic beads in the ion-exchange agent-doped polymer membrane electrode, and realizing the qualitative / quantitative detection of the target substance in the test solution.

3. The detection method of the target using DNA as the recognition molecule according to claim 2, characterized in that: The DNA or DNA derivative in the DNA-functionalized magnetic beads interacts with the target substance in the analyte, causing changes in the charge and charge density of the DNA in the DNA-functionalized magnetic beads. Under the action of an external magnetic field, the amount of DNA on the DNA-functionalized magnetic beads effectively extracted onto the polymer sensitive membrane decreases, causing a change in the electrode potential, and realizing the qualitative / quantitative detection of the target substance in the test solution.

4. The detection method of the target using DNA as the recognition molecule according to any one of claims 1-3, characterized in that: By weight, the polymer membrane composition contains 20% - 80% of a membrane matrix, 20% - 80% of a plasticizer, and the balance is an ion-exchange agent; the ion-exchange agent is an anion-exchange agent; among them, the anion-exchange agent is trimethyl(tetradecyl)ammonium chloride, trimethyl(tetradecyl)ammonium chloride derivatives, trimethyl(dodecyl)ammonium chloride, trimethyl(dodecyl)ammonium chloride derivatives, tetramethyl(dodecyl)ammonium chloride, tetramethyl(dodecyl)ammonium chloride derivatives, cetyltrimethylammonium bromide, cetyltrimethylammonium bromide derivatives, cetyltrimethylammonium chloride, cetyltrimethylammonium chloride derivatives, didodecyldimethylammonium chloride or didodecyldimethylammonium chloride derivatives, guanidine or guanidine derivatives.

5. The detection method of the target object using DNA as the recognition molecule according to any one of claims 1 to 3, characterized in that: The target substance is an antibiotic, protein, virus, bacterium, cell, heavy metal ion or small molecule.

Citation Information

Patent Citations

  • Method and device for detecting polypeptide and detecting bacteria by taking polypeptide as identification molecule

    CN110487870A