An aptamer sensor for detecting silent information regulator 2 in living cells, a preparation method thereof, and applications thereof

Abstract

The present invention provides an aptamer sensor for detecting silent information regulator 2 in living cells, a preparation method thereof and an application thereof. The aptamer sensor can be endocytosed by RSC96 cells, H9c2 cells and HUVECs cells, so as to perform in-situ imaging detection of silent information regulator 2 in cells, and is not easily enzymolyzed by enzymes in cells, and has excellent in-situ imaging effect, providing an economical and highly feasible method for rapid in-situ detection of cellular silent information regulator 2; the use of the aptamer sensor can achieve rapid screening of silent information regulator 2 regulators, with low screening cost and good application prospects.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomaterials, and specifically discloses an aptamer sensor for detecting sirtuin 2 in living cells, a preparation method thereof, and an application thereof. Background Art

[0002] Silent information regulator 2 (SIRT2) is an important member of the Sirtuins family of NAD+-dependent deacetylases. The members of the Sirtuins family are located in different parts of the cell. Among them, SIRT2 is mainly located in the cytoplasm, and it participates in the regulation of various biological processes such as cell proliferation and apoptosis, DNA damage, and inflammatory response by deacetylating substrates. SIRT2 is considered a potential target for the treatment of diabetes, neurodegenerative diseases, and certain cancers. Therefore, establishing a high-throughput screening method for SIRT2 modulators is of great significance for the development of new drugs for the treatment of related diseases.

[0003] Cell models are the most commonly used in vitro models for screening bioactive ingredients due to their advantages such as good repeatability and easy high-throughput implementation. Currently, the main detection methods for proteins related to cell signaling pathways include immunofluorescence, Western blot, and enzyme-linked immunosorbent assay (ELISA). Although ELISA, Western blot, and immunofluorescence based on the principle of antigen-antibody interaction have the advantages of a wide linear range, good repeatability, and reliable experiments, antibodies have the disadvantages of being easily affected by temperature and pH, poor stability, easy inactivation and denaturation, and high production costs. The length of the drug action time has an important impact on the efficacy of the drug, but antibodies are not easily taken into cells, making it difficult to use them for detecting the protein expression levels at different times in living cells, thus increasing the time cost and economic cost of screening the drug activity at different time points after administration.

[0004] Fluorescence imaging technology can perform real-time in-situ detection of target molecules, with the advantages of non-destructiveness, strong specificity, and high sensitivity. Nucleic acid aptamers, also known as "chemical antibodies", are specific nucleic acid sequences that are repeatedly screened in vitro and can bind to target molecules with high affinity and specificity. The fluorescence imaging method of sensors using aptamers as recognition elements has attracted much attention because of its high sensitivity, strong specificity, simplicity, and rapidity, and can effectively make up for the deficiencies of conventional protein detection methods. However, there is currently no aptamer sensor for in-situ imaging detection of SIRT2 in living cells, which is not conducive to the high-throughput screening of SIRT2 modulators at the cellular level. Summary of the Invention

[0005] The first object of the present invention is to provide an aptamer sensor for detecting sirtuin 2, which can solve the technical problem that there is currently no method for detecting sirtuin 2 in living cells.

[0006] The second object of the present invention is to provide a preparation method of the aptamer sensor, which is simple to operate and improves the preparation efficiency of the aptamer sensor.

[0007] The third object of the present invention is to provide an application of the aptamer sensor in the screening of sirtuin 2 regulators, which can solve the technical problem of high cost of the current screening method.

[0008] Compared with the prior art, the present invention has at least the following advantages and positive effects:

[0009] The present invention provides an aptamer sensor for detecting sirtuin 2 in living cells, a preparation method thereof and an application thereof. The aptamer sensor can be endocytosed by RSC96 cells, so as to perform in-situ imaging on sirtuin 2 in cells, and is not easily enzymatically hydrolyzed by enzymes in cells, and has excellent in-situ imaging effect, providing an economical and highly feasible method for rapid in-situ detection of cellular sirtuin 2; while realizing rapid screening of sirtuin 2 regulators by using the aptamer sensor, it can also reduce the screening cost and has good application prospects. Description of the Drawings

[0010] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0011] Figure 1 For the transmission electron microscope image of MnO 2 nanorods in the embodiments of the present invention;

[0012] Figure 2 For the selection of the concentration of the nanomaterial and the investigation of the fluorescence quenching time in the test example 1 of the present invention, wherein A is the quenching effect of different concentrations of MnO 2 on the fluorescence of the aptamer, and B is the quenching effect of different incubation times on the fluorescence of the aptamer;

[0013] Figure 3 For the detection specificity diagram of the aptamer sensor prepared in the test example 1 of the present invention for SIRT2 protein;

[0014] Figure 4For the investigation of the stability of the aptamer sensor (Lane ①: fluorescent aptamer; Lane ②: MnO2 nanomaterial + DNase I enzyme; Lane ③: fluorescent aptamer + DNase I enzyme; Lane ④: fluorescent aptamer + MnO2 nanomaterial + DNase I enzyme; DNase I digestion for 20 min);

[0015] Figure 5 This is the imaging detection result graph of the influence of each monomer on SIRT2 in RSC96 cells damaged by high glucose and high fat in Experimental Example 2 of the present invention. Among them, A is the imaging graph of SIRT2 in living cells, and B is the fluorescence intensity of each monomer (scale: 50 μm);

[0016] Figure 6 This is the graph of verifying the regulatory expression of 6 monomers on SIRT2 by Western blot method in Experimental Example 2 of the present invention. Detailed implementation manners

[0017] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer can all be obtained as conventional products through commercial purchase.

[0018] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to specific embodiments.

[0019] The present invention provides an aptamer sensor for detecting sirtuin 2 in living cells, which includes an aptamer of sirtuin 2. The nucleotide sequence of the aptamer is shown in SEQ ID NO.1, specifically as follows: CACGCATAGGGGAGCGAAACCGCCAATCACGG TCTAGAGGGCCAATTCTGCCTATGCGT.

[0020] Secondly, the present invention also provides a preparation method of an aptamer sensor, which includes the following steps: preparing MnO 2 nanorods, mixing and incubating the MnO 2 nanorods with the aptamer of sirtuin 2 to obtain an aptamer-MnO 2 nanorods complex solution, that is, obtaining the aptamer sensor.

[0021] The concentration of the above-mentioned MnO 2 nanorods is 40-80 μg / ml, the concentration of the aptamer of sirtuin 2 is 90-110 nM, and the incubation time is not less than 10 min.

[0022] The above-mentioned MnO 2 nanorods have a particle size of less than 200 nm.

[0023] The preparation of the above-mentioned MnO 2 nanorods includes the following steps: Take 2 - 4 mL of 30% wt H 2 O 2 and add 4 - 6 mL of tetramethylammonium hydroxide solution and 13 - 15 mL of ultrapure water to obtain 3% wt H 2 O 2 and 0.6 M tetramethylammonium hydroxide solution; Take 593 - 595 mg of MnCl 2 ·4H 2 O and dissolve and mix it evenly in 9 - 11 mL of ultrapure water to obtain 0.3 M MnCl 2 solution. Add the 3% wt H 2 O 2 and 0.6 M tetramethylammonium hydroxide solution quickly into the 0.3 M MnCl 2 solution and stir at room temperature for 10 - 14 h to obtain the crude MnO 2 product. Transfer the crude MnO 2 product to a centrifuge tube, centrifuge at 1800 - 2200 rpm for 18 - 22 min, then aspirate the supernatant, add water equal to the volume of the supernatant, vortex and mix evenly, and continue centrifuging until the pH is neutral and then dry to obtain MnO 2 powder; Take 8 - 12 mg of MnO 2 powder and add 18 - 22 mL of ultrapure water, sonicate for 30 - 40 h, then centrifuge the dispersion at 2000 rpm for 25 - 35 min, and take the supernatant to obtain MnO 2 nanorods.

[0024] Finally, the present invention provides an application of an aptamer sensor in the screening of silent regulator protein 2 regulators.

[0025] Example

[0026] Construction and performance verification of the aptamer sensor:

[0027] Nucleic acid aptamers are difficult to enter cells due to the negatively charged phosphate groups. Therefore, a carrier that can carry the aptamer into cells and protect it from enzymatic degradation is needed to construct an aptamer sensor for live cell imaging. In this example, an aptamer-MnO 2 nanorods sensor was constructed, and its recognition specificity, detection performance for different concentrations of SIRT2, and anti-enzymatic degradation stability were investigated.

[0028] Preparation of MnO 2 nanorods:

[0029] Measure 2 mL of 30% H 2 O 2 , add 4 mL of tetramethylammonium hydroxide solution and 14 mL of ultrapure water to prepare 3% H 2 O 2 and 0.6 M tetramethylammonium hydroxide solution. Weigh 594 mg of MnCl 2 ·4H 2 O, add 10 mL of ultrapure water to dissolve and mix evenly to obtain 0.3 M MnCl 2 solution. Add 3% H 2 O 2 and 0.6 M tetramethylammonium hydroxide solution to 0.3 M MnCl 2 solution within 15 s. At this time, the solution turns dark brown, and stir at room temperature for 12 h. Transfer the reacted MnO 2 to 2 50-mL centrifuge tubes, centrifuge at 2000 rpm for 20 min, aspirate the supernatant, add an equal amount of water, vortex and mix evenly, then continue to centrifuge, repeat the washing process multiple times until the pH is neutral. Freeze-dry the obtained MnO 2 in a freeze dryer to obtain a solid powder. Weigh 10 mg of MnO 2 solid powder, add 20 mL of ultrapure water, sonicate for 36 h, centrifuge the dispersion at 2000 rpm for 30 min, and store the supernatant in a 4°C refrigerator for subsequent experiments.

[0030] MnO 2 Structural characterization of MnO nanorods:

[0031] The structure of MnO 2 nanorods was observed by transmission electron microscopy, and the results are as Figure 1 shown. The synthesized MnO 2 nanorods have a small particle size (<200 nm) and can easily carry aptamers to enter cells by endocytosis. Therefore, MnO 2 nanomaterials were used for the construction of subsequent aptamer sensors.

[0032] Construction of aptamer-MnO 2 nanorod sensors:

[0033] Solutions of MnO 2 nanomaterials with final concentrations of 10, 20, 30, 40, 50, 60, 70, and 80 μg / mL were prepared in the experiment and incubated with 100 nM aptamer to form aptamer-MnO 2 nanorods complex solution to investigate the quenching efficiency of different concentrations of MnO 2 nanorods on aptamer fluorescence. The experimental results are as Figure 2 shown. From Figure 2It can be seen from A that the MnO solution with a final concentration of 50 μg / mL can already quench the aptamer fluorescence well. Further, the quenching effect of MnO nanomaterials on aptamer fluorescence at different incubation times was investigated. The fluorescence intensity of the aptamer-MnO nanorods system was measured every 3 min. The results are shown in 2 B. It can be seen that the fluorescence can be completely quenched after co-incubation of this system for 10 min. Further extending the incubation time, the quenching effect of MnO nanorods on fluorescence is not obvious. Therefore, the aptamer-MnO nanorods system formed by incubating 100 nM aptamer with 50 μg / mL MnO nanorods for 10 min was used as the aptamer sensor for subsequent experiments. 2 2 Figure 2 2 2 2

[0034] Test Example 1

[0035] Investigation of the performance of the aptamer sensor:

[0036] To investigate the specificity of the aptamer sensor, this sensor was used to detect SIRT2 and 9 other proteins, and the fluorescence recovery was observed. The results are shown in Figure 3 : A strong fluorescence signal will be generated when detecting SIRT2, while the fluorescence signals when detecting SIRT1, SIRT5, bovine serum albumin, human serum albumin, trypsin, lipase, thrombin, proteinase K, and α-glycosidase are very weak, indicating that the aptamer sensor can specifically recognize SIRT2, and other proteins basically do not interfere with the detection of SIRT2.

[0037] To explore the anti-DNase I digestion ability of the aptamer sensor, MnO2 nanosheet-aptamer and aptamer were incubated at 37 °C for 20 min in the presence of DNase I (1 U / μL). The collected samples were subjected to agarose gel electrophoresis. The results are shown in Figure 4 . When there is only aptamer in the sample system and no DNase I enzyme (lane ①), the aptamer DNA band can be observed at 60 nt; when there is aptamer and DNase I enzyme in the sample system but no MnO 2 nanomaterials (lane ③), the aptamer will be enzymatically digested, so no aptamer fluorescence band is seen near 60 nt; while when MnO 2 nanomaterials are added to the sample system (lane ④), the aptamer can be adsorbed on MnO 2 ​​​​​​On the surface of the nanomaterial, the aptamer can be effectively protected from enzymatic digestion by DNase I. Therefore, an aptamer fluorescence band can be observed near 60 nt, indicating that this aptamer sensor can be used for subsequent live cell imaging experiments.

[0038] Experimental Example 2

[0039] Screening of SIRT2 agonists by an aptamer live cell imaging method:

[0040] In the experiment, six monomers with different concentrations (1 μM - 25 μM) were incubated with RSC96 cells to investigate their effects on protecting RSC96 cells from high glucose (150 mM glucose) and high fat (200 μM palmitic acid) damage. After the different monomers acted on RSC96 cells, live cell SIRT2 imaging was performed. The imaging results are as shown in Figure 5 Figure A, and the statistical results of fluorescence intensity are as shown in Figure 5 Figure B. Compared with the model group, after administration of astragaloside II and chlorogenic acid at a concentration of 25 μM, the expression level of cellular SIRT2 was significantly up-regulated, indicating that astragaloside II and chlorogenic acid can play a role in protecting cells from high glucose and high fat damage by up-regulating the expression of SIRT2 in RSC96 cells.

[0041] In addition, the Western blot method was used to verify the regulatory effects of the six monomers on SIRT2. The experimental results are as shown in Figure 6 Figure, compared with the model group, both astragaloside II and chlorogenic acid could up-regulate the expression level of SIRT2, which was consistent with the results of live cell imaging, indicating the reliability of the aptamer-based live cell imaging method for screening SIRT2 agonists.

[0042] In summary, the present invention provides an aptamer sensor for detecting silent information regulator 2 in live cells, a preparation method thereof, and an application thereof:

[0043] This aptamer sensor can be endocytosed by RSC96 cells, H9c2 cells, and HUVECs cells, thereby performing in-situ imaging of silent information regulator 2 in cells. It is not easily enzymatically digested by intracellular enzymes and has excellent in-situ imaging effects, providing an economical and highly feasible method for rapid in-situ detection of cellular silent information regulator 2. When using this aptamer sensor to screen regulators of silent information regulator 2, the screening cost can be reduced while achieving rapid screening, and it has good application prospects.

[0044] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.

Claims

1. An aptamer sensor for detecting silent information regulator 2 in living cells, characterized in that, An aptamer including sirtuin 2 and MnO 2 nanorods, and the nucleotide sequence of the aptamer of sirtuin 2 is as shown in SEQ ID NO.

1.

2. A preparation method of the aptamer sensor according to claim 1, characterized in that, It includes the following steps: preparing MnO 2 nanorods, mixing and incubating the MnO 2 nanorods with the aptamer of the silent regulator protein 2 to obtain an aptamer-MnO 2 nanorods complex solution, thus obtaining the aptamer sensor.

3. The preparation method of the aptamer sensor according to claim 2, characterized in that, The MnO 2 The concentration of the nanorods is 40-80 μg / ml, the concentration of the aptamer of the silent regulatory protein 2 is 90-110 nM, and the incubation time is not less than 5 min.

4. The preparation method of the aptamer sensor according to claim 2, characterized in that, The described MnO 2 nanorods have a particle size of less than 200 nm.

5. The preparation method of the aptamer sensor according to claim 2, characterized in that, The described MnO 2 The preparation of the nanorods comprises the following steps: Take 2 - 4 mL of 30% wt H 2 O 2 and add 4 - 6 mL of tetramethylammonium hydroxide solution and 13 - 15 mL of ultrapure water to obtain 3% wt H 2 O 2 and 0.6 M tetramethylammonium hydroxide solution; Take 593 - 595 mg of MnCl 2 ·4H 2 O and dissolve and mix well with 9 - 11 mL of ultrapure water to obtain a 0.3 M MnCl 2 solution. Add the 3% wt H 2 O 2 and the 0.6 M tetramethylammonium hydroxide solution quickly into the 0.3 M MnCl 2 solution and stir at room temperature for 10 - 14 h to obtain crude MnO 2 . Transfer the crude MnO 2 to a centrifuge tube, centrifuge at 1800 - 2200 rpm for 18 - 22 min, then aspirate the supernatant, add an equal amount of water as the supernatant, vortex and mix well, continue to centrifuge until the pH is neutral, and then dry to obtain MnO 2 powder; Take 8 - 12 mg of MnO 2 powder and add 18 - 22 mL of ultrapure water. After ultrasonic treatment for 30 - 40 h, centrifuge the dispersion at 2000 rpm for 25 - 35 min, and take the supernatant to obtain the 2 MnO nanorod solution.

6. Application of the aptamer sensor according to claim 1 in screening regulators of silent information regulator 2.

Images