Brevibacillus halotolerans and application thereof in preparing biocontrol agent

Abstract

This invention discloses a biocontrol agent of *Brevibacillus halotolerans* strain Z-9 and its application. *Brevibacillus halotolerans* Z-9, a new strain belonging to the genus *Brevibacillus*, was isolated from the rhizosphere soils of cotton and jujube in Tumushuke and Alar, Xinjiang. Strain Z-9 exhibits inhibition zone diameters of 23.32 mm and 25.68 mm against *Brevibacillus halotolerans*, the causal agent of jujube black spot, and cotton verticillium wilt, respectively. It contains catechol-type siderophores and is negative for isohydroxamic acid-type siderophores. The minimum As / Ar ratio is 0.682±0.021, indicating the highest iron production capacity. Field application of the biocontrol agent prepared using strain Z-9 reduced the disease indices of cotton verticillium wilt and jujube black spot to 7.14 and 8.34, respectively, achieving a control efficacy of 78.07%. This indicates that the strain Brevibacillus halotolerans Z-9 provided by this invention and the biocontrol agent prepared therefrom are highly effective against jujube black spot disease and cotton Verticillium wilt, and have no toxicity or pathogenicity or other side effects. They have broad application value for the biological control of jujube black spot disease and cotton Verticillium wilt.

Description

[0001] This invention application is a divisional application of the invention entitled "Brevibacillus halotolerans and its application in the preparation of biocontrol agents" filed by the applicant on October 19, 2021. The original application was filed on October 19, 2021, with application number 202111218751.7 and invention entitled "Brevibacillus halotolerans and its application in the preparation of biocontrol agents". Technical Field

[0002] This invention relates to the technical field of microbial strains and their applications, specifically to the technical field of a salt-tolerant strain of the genus *Brevibacillus halotolerans* Z-9 and the biocontrol agent prepared therefrom, and its application in the preparation of drugs for controlling cotton wilt and jujube black spot disease. Background Technology

[0003] Cotton Verticillium wilt was first reported in Virginia, USA in 1914, and subsequently spread to dozens of countries and regions, including China, causing huge losses to cotton yields and becoming a major obstacle to high and stable cotton production. Cotton Verticillium wilt is a soil-borne disease of cotton caused by *Verticillium dahliae* Kleb. It can occur throughout the entire growth cycle of cotton, but symptoms generally appear at the 3-5 true leaf stage. In the mid-to-late growth stages, after the cotton plants have budded and flowered, the disease spreads extensively in the field, often resulting in sparse bolls, premature boll cracking, and reduced yield. Xinjiang is my country's most important cotton production base, accounting for about 85% of the national output. The main control methods for cotton Verticillium wilt include breeding resistant varieties, chemical control, and biological control. However, breeding resistant varieties is hampered by a lack of effective pathogens; currently, there are no successfully cultivated highly resistant varieties. Chemical control lacks effective fungicides, and long-term use can easily cause environmental pollution. Chemical control is also limited by efficacy and application methods, making it difficult to be effective. Biological control, on the other hand, has seen many microorganisms proven to have biocontrol effects, and some are gradually being applied. Many biocontrol microorganisms can produce a variety of active substances such as antibiotics and extracellular enzymes. In addition, their spores have strong resistance to adverse conditions, making them promising for the control of soil-borne diseases.

[0004] In 2001, Lin Zhongmin et al. first reported a new disease on jujubes in Shanxi Province, which they named jujube black spot disease. Jujube black spot disease mainly occurs on leaves and flower organs, and later infects the fruit. The incubation period for the disease on jujubes is long, and symptoms begin to appear in August and September when the jujubes are ripe and turn white. The typical field symptoms of jujube black spot disease are initially the appearance of dark brown to black circular spots on the waist or body of the jujube. As the jujube grows, these spots enlarge, becoming circular or irregular black lesions. The lesions typically appear at the navel or top of the fruit. The flesh turns black and hardens, and the diseased flesh is easily separated from the fruit. The pathogens of jujube black spot disease are believed to be mainly caused by fungi of the genera *Phomasp*, *Alternaria*, and *Colletortrichum*. The disease incidence is generally around 30%, but can reach over 80% in severely affected orchards. This leads to a decline in jujube yield and quality, making the fruit unstorable and severely impacting its marketability, causing significant economic losses to jujube farmers and becoming a pressing problem in production. After invading the jujube fruit in its early stages, the disease remains latent within the fruit, reaching its peak during the fruit coloring stage. Therefore, reducing the infection of jujube flowers and fruit in the early stages is crucial for the prevention and control of this disease. However, the flowering period of Xinjiang jujubes lasts for about 100 days. Applying chemical fungicides during the flowering period can easily lead to flower and fruit drop, which poses a challenge to the control of jujube black spot disease. Screening biological pesticides that have good control efficacy against jujube black spot disease and are safe for jujube flowers has significant application value in the control of this disease.

[0005] Biological control has received increasing attention in recent years due to its advantages such as high specialization, high efficacy, long-lasting effects, and lack of environmental pollution. With in-depth research on salt-tolerant brevicaulis, new species of salt-tolerant brevicaulis have been reported in domestic and international literature. Currently, there are no literature or patent reports on the application of salt-tolerant brevicaulis in the control of jujube black spot disease and cotton Verticillium wilt. Summary of the Invention

[0006] In view of the current lack of documented applications of salt-tolerant *Brevibacillus halotolerans* in the control of jujube black spot and cotton Verticillium wilt, this invention aims to provide a biocontrol agent of *Brevibacillus halotolerans* Z-9 and its application. *Brevibacillus halotolerans* Z-9, isolated from the rhizosphere soils of cotton and jujube in Tumushuke and Alar, Xinjiang, is used to prepare a biocontrol agent. This agent is then applied to the preparation of drugs for the control of jujube black spot and cotton Verticillium wilt. *Brevibacillus halotolerans* Z-9 exhibits inhibition zone diameters of 23.32 mm and 25.68 mm against *Verticillium wilt* and *Brevibacillus halotolerans* Z-9, respectively. It contains catechol-type siderophores and is negative for isohydroxamic acid-type siderophores. The minimum As / Ar ratio is 0.682±0.021, and the highest iron production capacity is "++". Field trials of the Brevibacillus halotolerans Z-9 biocontrol agent showed a reduction in the disease index of cotton Verticillium wilt, with a disease index of 7.14. It exhibited the best control effect against cotton Verticillium wilt, reaching 78.07%. A 50-fold dilution of the Brevibacillus halotolerans Z-9 biocontrol agent also showed good control of jujube black spot disease, reducing the disease index to 8.34 and inhibiting the incidence rate to 9.58%. After the third application, the control effect reached as high as 78.07%. This indicates that the Brevibacillus halotolerans Z-9 and its prepared biocontrol agent provided by this invention are highly effective against both cotton Verticillium wilt and jujube black spot disease, and have no toxicity or pathogenicity or other side effects. Therefore, it has broad application value in the preparation of drugs for the control of cotton Verticillium wilt and jujube black spot disease.

[0007] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0008] This invention provides a Brevibacillus halotolerans Z-9 biocontrol agent, which is obtained by fermentation using a new strain of the genus Brevibacillus halotolerans Z-9, which is salt-tolerant, wherein the viable count of Brevibacillus halotolerans Z-9 is not less than 10. 8 CFU / mL.

[0009] This invention obtained a new strain, Brevibacillus halotolerans Z-9, which was isolated and screened from the rhizosphere soil of cotton and jujube in Tumushuke and Alar, Xinjiang. Through molecular-level identification and physiological and biochemical system testing, both well-known and recognized in the field, it was confirmed that the obtained strain belongs to a typical new strain of salt-tolerant Bacillus. This salt-tolerant Bacillus strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 15005 and deposit date of December 4, 2017.

[0010] The gene sequence of the above-mentioned strain Brevibacillus halotolerans Z-9 is shown in SEQ ID NO:1.

[0011] In this invention, the liquid fermentation medium for Brevibacillus halotolerans Z-9 is as follows: by mass ratio, soybean meal 2.0%, yeast powder 3.5%, molasses 1.0%, NaCl 0.5%, and the balance is water, with a pH of 7.0.

[0012] Meanwhile, this invention provides a method for preparing Brevibacillus halotolerans Z-9 biocontrol agent, specifically including the following steps:

[0013] (1) The low-temperature preserved strain Brevibacillus halotolerans Z-9 was activated on TSA plate medium, and a single colony was picked and cultured on TSA slant medium at 30℃ for 48h to obtain the activated strain Brevibacillus halotolerans Z-9.

[0014] (2) Using a sterile inoculation loop, scrape a loopful of the activated strain Brevibacillus halotolerans Z-9 from step (1) and inoculate it into 100 mL of TSA liquid medium. Incubate at 28-32℃ and a shaking speed of 150-180 r / min for 14-16 h to obtain a Brevibacillus halotolerans Z-9 seed culture with a viable count of not less than 1×10⁻⁶ cells / mL. 8 cfu / mL, for later use.

[0015] (3) The Brevibacillus halotolerans Z-9 seed culture obtained in step (2) is inoculated into an Erlenmeyer flask containing 100 mL of liquid fermentation medium at an inoculation rate of 0.5-1.5% by mass volume and fermented by shaking at 28-32℃ and 160-200 r / min for 48-72 h to obtain the Brevibacillus halotolerans Z-9 fermentation broth.

[0016] (4) Detect the number of cells and spores in the fermentation broth obtained in step (3). When the mature spores in the fermentation broth account for 90% of the total number of spores and cells, put the fermentation broth into a storage tank, add sodium benzoate at a mass ratio of 0.1-0.3%, adjust the pH value to 6.0, and the number of viable spores is 1×10⁻⁶. 8 -1×10 9 The cfu / mL concentration indicates the preparation of Brevibacillus halotolerans Z-9 biocontrol agent.

[0017] The present invention discloses a method for preparing a Brevibacillus halotolerans Z-9 biocontrol agent, wherein the inoculation amount of the Brevibacillus halotolerans Z-9 seed liquid is 1%, the fermentation temperature is 29℃, and the fermentation time is 56h.

[0018] The present invention discloses a method for preparing a Brevibacillus halotolerans Z-9 biocontrol agent, wherein the preservative sodium benzoate is added at a mass ratio of 0.2%.

[0019] This invention provides the application of Brevibacillus halotolerans Z-9 biocontrol agent in the preparation of drugs for controlling cotton Verticillium wilt.

[0020] This invention provides the application of Brevibacillus halotolerans Z-9 biocontrol agent in the preparation of drugs for preventing and controlling black spot disease in jujube fruit.

[0021] By implementing the specific technical solutions provided by this invention and carrying out the content of this invention, the following can be obtained:

[0022] Beneficial effects:

[0023] (1) This invention provides a new strain Brevibacillus halotolerans Z-9. After molecular-level identification and physiological and biochemical system tests of strains that are well-known and recognized in the field, it is confirmed that the obtained strain number Z-9 belongs to a typical new strain in the category of salt-tolerant Bacillus, and therefore it is necessary to preserve it in accordance with legal requirements.

[0024] (2) The provided Brevibacillus halotolerans Z-9 and its prepared biocontrol agent are used in the preparation of drugs for controlling cotton Verticillium wilt and jujube black spot disease. The inhibition zone diameters of the Brevibacillus halotolerans Z-9 cotton Verticillium wilt and jujube black spot disease provided by this invention are 23.32 mm and 25.68 mm, respectively. It contains catechol-type siderophores and is negative for isohydroxamic acid-type siderophores. The minimum As / Ar ratio is 0.682±0.021, and the highest iron production capacity is "++". Field trials of Brevibacillus halotolerans Z-9 biocontrol agent showed a reduction in the disease index of cotton Verticillium wilt, with a disease index of 7.14. It exhibited the best control effect against cotton Verticillium wilt, reaching 78.07%. A 50-fold dilution of Brevibacillus halotolerans Z-9 biocontrol agent also showed good control effect against jujube black spot disease, reducing the disease index to 8.34 and inhibiting the incidence rate to 9.58%. After the third application, the control effect reached as high as 78.07%. This demonstrates its broad application value in the preparation of drugs for controlling cotton Verticillium wilt and jujube black spot disease. Attached Figure Description

[0025] Figure 1 A phylogenetic tree diagram of strain Z-9 was constructed based on the 16S rDNA sequence.

[0026] Figure 2 This is a colony morphology diagram of strain Z-9. Detailed Implementation

[0027] The present invention will now be illustrated with examples; however, the present invention is not limited to the examples described below. All raw and auxiliary materials used in the present invention, as well as the selected microbial culture methods, are well known in the art. All percentages mentioned in the present invention are weight percentages unless otherwise specified.

[0028] The pathogens of cotton Verticillium wilt and jujube black spot disease used in this invention are common strains that are readily available to the public and can be purchased through other public channels such as the China General Microbiological Culture Collection Center (CGMCC). The culture methods used for the selected strains are well-known in the field.

[0029] The liquid fermentation medium of Brevibacillus halotolerans Z-9 used in this invention is as follows: by mass ratio, soybean meal 2.0%, yeast powder 3.5%, molasses 1.0%, NaCl 0.5%, and the balance is water, with a pH of 7.0.

[0030] Example 1: Isolation, screening and identification of Brevibacillus halotolerans Z-9

[0031] (I) Separation and purification

[0032] Pear blossoms were collected in 2016 from the rhizosphere soil of cotton and jujube trees in Tumushuke and Alar, Xinjiang. 10g of the cotton and jujube rhizosphere soil was placed in 90mL of sterile water and incubated with shaking at 150rpm for 32min to prepare a suspension. Then, 1mL of the suspension was placed in a 9mL sterile Erlenmeyer flask and sterile water was used to prepare 10... 5 10 6 Dilute the solution by 200 μL and spread it onto TSA agar plates. Repeat each treatment 3 times. Incubate the above agar plates at 30°C for 2 days. Pick single colonies and transfer them to LB agar plates for streaking purification. Store the purified strains in glycerol at -70°C for later use.

[0033] (II) Classification and Identification

[0034] Sequence determination and analysis of the 16S rDNA gene of Brevibacillus halotolerans Z-9 (hereinafter referred to as "strain Z-9"):

[0035] (1) Extraction of PCR template DNA

[0036] Strain Z-9 was inoculated into TSA medium and cultured at 180 r / min and 30℃ for 10 h with shaking. The bacterial cells were collected by centrifugation, and genomic DNA was extracted using a novel plant genomic DNA rapid extraction kit.

[0037] (2) PCR amplification

[0038] PCR amplification primers for 16S rDNA:

[0039] Forward primer 27F: AGAGTTTGATCCTGGCTCAG;

[0040] Reverse primer 1492R: TACGGYTACCTTGTTACGACTT.

[0041] The reaction system is shown in Table 1:

[0042] Table 1: Reaction System

[0043] composition Volume / μL 2XMix 25 27F 1 1492R 1 Fungal template 1 <![CDATA[ddH2O]]> 22

[0044] (3) Sequencing

[0045] PCR amplification products were sequenced after electrophoresis and purification. The 16S rDNA of strain Z-9 was sequenced, and a partial ordered sequence of its 16S rDNA was obtained using DNAstar software. The sequence is shown in SEQ ID NO:1. BLAST homology searches were performed in GenBank (accession number KP100051). A phylogenetic tree was constructed using the Neighbor-Joining method (100 replicates) with MEGA 5.0 software, a commonly used technique in this field. The results are shown in the appendix. Figure 1 Comparative analysis revealed that the 16S rDNA gene sequence of strain Z-9 showed the highest homology (98.79%) with Brevibacillus halotolerans LAM0312(T) (accession number: KJ627768). In the phylogenetic tree constructed based on the 16S rDNA gene sequence, the 16S rDNA sequence of strain Z-9 was most closely related to Brevibacillus halotolerans strain LAM0313 (accession number: KT346371), with a confidence level of 98%. This indicates that strain Z-9 has extremely high support as a new species and exhibits excellent stability in the phylogenetic tree. Through comprehensive assessment of similarity and homology, and following molecular-level identification using well-known and recognized bacterial systems in the field, the obtained strain number Z-9 was confirmed as a typical new species within the genus *Bacillus*, specifically the halophilic *Bacillus*.

[0046] Based on the above biological characteristics, strain Z-9 was identified as a new species in the Brevibacillus halotolerans clade. This strain has been deposited at the Budapest Treaty International Collection Unit for Microbial Cultures: China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postcode: 100101, China, deposited on December 4, 2017, with accession number CGMCC No. 15005.

[0047] Example 2: Determination of physiological and biochemical characteristics of Brevibacillus halotolerans Z-9

[0048] Strain Z-9 grew well on TSA medium. The morphology of Z-9 after 2 days of culture on TSA medium is shown in the appendix. Figure 2As shown, the colonies have rounded edges, are smooth, and light brown in color. The optimal growth temperature is 28-34℃. After culturing on TSA medium at 30℃ for 2 days, the diameter is 0.5-3.5 mm. The cells are Gram-positive, and the spores are rod-shaped, 0.2-0.8 μm wide and 1.5-4.0 μm long, with peripheral flagellar motility. The optimal growth temperature is 30℃, and the pH is 7.0-8.0.

[0049] The physiological and biochemical characteristics of strain Z-9 are shown in Table 2.

[0050] Table 2: Comparison of physiological and biochemical properties between strain Z-9 and its related type strains

[0051]

[0052]

[0053] Strain Z-9 is a Gram-positive, rod-shaped bacterium that utilizes arabinose but not cellobiose. It can grow in the absence of sodium chloride and tolerates up to 12% (w / v) of sodium chloride. It is catalase-positive, oxidase-positive, and reduces nitrate to nitrite. The Voges-Proscalar test is positive, but the methyl red test, egg yolk reaction, and hydrogen sulfide production are negative. Hydrolysis of casein and starch are both positive. The VP test and catalase physiological and biochemical tests are positive, while the gelatin hydrolysis test and urease physiological and biochemical tests are negative. Salt requirement and salt tolerance tests indicate a pH range of 7–8. Based on the morphological characteristics and physiological and biochemical properties of strain Z-9, analyzed according to the *Bacillus* genus, *Microbial Taxonomy*, and *Manual of Systematic Identification of Common Bacteria*, these physiological and biochemical characteristics show significant similarity to Gram-positive Bacillus species, leading to the identification of strain Z-9 as a new species of *Brevibacillus halotolerans*.

[0054] Based on the results of homology analysis of the 16S rDNA gene and physiological and chemical tests, the strain Z-9 provided by this invention is distinctly different from common species within the same genus as Brevibacillus halotolerans, and possesses the characteristics of a new species within the same genus as Brevibacillus halotolerans.

[0055] Example 3: Preparation of Brevibacillus halotolerans Z-9 biocontrol agent

[0056] This embodiment, based on Examples 1-2, describes the preparation method of Brevibacillus halotolerans Z-9 biocontrol agent, specifically including the following steps:

[0057] (1) The low-temperature preserved Brevibacillus halotolerans Z-9 was activated on TSA plate medium, and a single colony was picked and placed on TSA slant medium and cultured in an incubator at 30℃ for 48h to obtain the activated Brevibacillus halotolerans Z-9 strain.

[0058] (2) Using a sterile inoculation loop, scrape a loopful of the activated strain Brevibacillus halotolerans Z-9 from step (1) and inoculate it into 100 mL of TSA liquid medium. Incubate at 28-32℃ and a shaking speed of 150-180 r / min for 14-16 h to obtain a Brevibacillus halotolerans Z-9 seed culture with a viable count of not less than 1×10⁻⁶ cells / mL. 8 cfu / mL, for later use.

[0059] (3) The Brevibacillus halotolerans Z-9 seed culture obtained in step (2) is inoculated into an Erlenmeyer flask containing 100 mL of liquid fermentation medium at an inoculation rate of 0.5-1.5% by mass volume and fermented by shaking at 28-32℃ and 160-200 r / min for 48-72 h to obtain the Brevibacillus halotolerans Z-9 fermentation broth.

[0060] (4) Detect the number of cells and spores in the fermentation broth obtained in step (3). When the mature spores in the fermentation broth account for 90% of the total number of spores and cells, put the fermentation broth into a storage tank, add sodium benzoate at a mass ratio of 0.1-0.3%, adjust the pH value to 6.0, and the number of viable spores is 1×10⁻⁶. 8 -1×10 9 The cfu / mL concentration indicates the preparation of Brevibacillus halotolerans Z-9 biocontrol agent.

[0061] Example 4: Preparation of Brevibacillus halotolerans Z-9 biocontrol agent

[0062] Based on Examples 1-3, this embodiment provides a method for preparing Brevibacillus halotolerans Z-9 biocontrol agent, wherein the inoculation amount of Brevibacillus halotolerans Z-9 seed liquid is 1%, the fermentation temperature is 29℃, the fermentation time is 56h, and the preservative sodium benzoate is added at a mass ratio of 0.2%.

[0063] Example 5: Preparation of Brevibacillus halotolerans Z-9 biocontrol agent

[0064] Based on Examples 1-3, this embodiment provides a method for preparing Brevibacillus halotolerans Z-9 biocontrol agent, wherein the inoculum amount of Brevibacillus halotolerans Z-9 seed liquid is 0.5%, the fermentation temperature is 28℃, the fermentation time is 48h, and the preservative sodium benzoate is added at a mass ratio of 0.1%.

[0065] Example 6: Preparation of Brevibacillus halotolerans Z-9 biocontrol agent

[0066] Based on Examples 1-3, this embodiment provides a method for preparing Brevibacillus halotolerans Z-9 biocontrol agent, wherein the inoculum amount of Brevibacillus halotolerans Z-9 seed liquid is 1.5%, the fermentation temperature is 32℃, the fermentation time is 72h, and the preservative sodium benzoate is added at a mass ratio of 0.3%.

[0067] Example 7: Preparation of Brevibacillus halotolerans Z-9 biocontrol agent

[0068] Based on Examples 1-3, this embodiment provides a method for preparing Brevibacillus halotolerans Z-9 biocontrol agent, wherein the inoculum amount of Brevibacillus halotolerans Z-9 seed liquid is 1.2%, the fermentation temperature is 30℃, the fermentation time is 64h, and the preservative sodium benzoate is added at a mass ratio of 0.2%.

[0069] Example 8: Inhibitory effect of Brevibacillus halotolerans Z-9 on Verticillium wilt of cotton and black spot of jujube fruit.

[0070] (1) Plate antagonism test of strain Z-9 against Verticillium wilt of cotton and black spot of jujube fruit

[0071] Brevibacillus halotolerans Z-9 was activated on TSA medium using the plate inhibition method, then transferred to 50 mL of TSA culture medium and incubated at 28°C with shaking at 180 rpm for 2 days for later use. The bacterial count was not less than 5.5 × 10⁻⁶. 8 cfu / mL.

[0072] Using a sterile inoculation loop, pick colonies of *Verticillium dahliae* Kleb and *Alternaria alternata*, the causal agent of jujube black spot, preserved on test tube slant agar plates and spot-inoculate them in the center of PDA plates. Incubate for 7-10 days in a constant temperature incubator. Then, using a 5mm inner diameter punch, make holes in the *Verticillium dahliae* and *Alternaria alternata* plates. Pick 15-20 of these punched mycelial discs and inoculate them into a 500mL Erlenmeyer flask containing 200mL of sterilized and cooled Czapek's liquid medium. Incubate at 25℃ and 150rpm for 7 days with shaking. This is the yeast culture for *Verticillium dahliae* and *Alternaria alternata*. Pipette 0.5mL of the yeast culture into a test tube containing 4.5mL of sterile water, and mix thoroughly by pipetting several times. This is the final product. -1 Diluent; take 10 -1 Transfer 0.5 mL of the diluent to a test tube containing 4.5 mL of sterile water, and mix thoroughly by blowing and aspirating several times to obtain a 10-fold dilution. -2 Diluent. Take 10 μL. -2 Spread 0.1 mL of the diluted solution onto a PDA culture medium plate to create a pathogen plate.

[0073] Antagonistic bacteria were initially screened using the plate confrontation method. Brevibacillus halotolerans Z-9 was spot-inoculated onto pathogen plates, with 5 plates per plate and 3 replicates per treatment. After standing for 20-30 minutes, the plates were incubated at 25°C for 5-7 days. The presence of inhibition zones was observed, and the strains that produced inhibition zones were recorded and their diameters were measured. The results are shown in Table 3.

[0074] Table 3: Results of antibacterial test of strain Z-9

[0075]

[0076] As shown in Table 3, the inhibition zone diameters of Brevibacillus halotolerans Z-9 provided by this invention against Verticillium wilt of cotton and jujube black spot fungus were 23.32 mm and 25.68 mm, respectively, indicating that Brevibacillus halotolerans Z-9 has a significant inhibitory effect on the growth of Verticillium wilt of cotton and jujube black spot fungus, and has very good biocontrol potential in the preparation of drugs for the prevention and control of Verticillium wilt of cotton and jujube black spot fungus.

[0077] (2) Plate tests related to cell wall degrading enzymes of strain Z-9

[0078] Cell wall degrading enzyme plate detection: Prepare the detection medium according to the culture, pour the plates and let them stand for 2 days. Make 6 mm diameter wells on the chitinase, dextranase, cellulase and protease detection medium. Use a pipette to put 100 μL of antagonistic bacterial fermentation broth into the well. Use NB medium instead of fermentation broth as a control. Incubate at 30℃ for 48 h. The cellulose and dextran detection medium and the medium are stained with 10-15 mL of 0.1% Congo red solution for 20 min. Wash repeatedly with NaCl 3 times. Measure the diameter of the enzyme digestion zone with vernier calipers. See Table 4 for specific results.

[0079] Table 4: Outer diameter and variance analysis of the transparent zone after enzymatic hydrolysis

[0080]

[0081] Note: Different letters represent the same enzyme, but significant differences exist between different bacterial species (p<0.05).

[0082] As shown in Table 4, the clear zone sizes of chitinase, protease, dextranase, and cellulase were 15.23 mm, 29.12 mm, 23.97 mm, and 6.32 mm, respectively.

[0083] (3) Enzyme activity test of cell wall degrading enzymes of strain Z-9

[0084] Weigh appropriate amounts of anhydrous glucose, N-acetylglucosamine, and L-tyrosine and dry them in an oven at 105℃ until constant weight. Accurately weigh 1.000g of each and prepare 1mg / mL glucose standard solution, 1mg / mL N-acetylglucosamine standard solution, and 0.1mg / mL L-tyrosine standard solution to establish a standard curve for the activity of cell wall degrading enzymes.

[0085] The glucose standard solution was added starting at 0 mL, gradually increasing to 0.6 mL in increments of 0.1 mL for 7 samples. 3.0 mL of DNS solution was added, and the volume was brought to 10 mL with distilled water to establish a glucose standard curve. The N-acetylglucosamine standard curve was established similarly, with the N-acetylglucosamine standard solution initially added at 0.25 mL, gradually increasing to 0.05 mL for 7 samples. Distilled water was added to bring the volume to 1.5 mL, and 1.5 mL of DNS solution was added to bring the volume to 7.5 mL to establish an L-tyrosine standard curve.

[0086] Under specific reaction conditions (dextran, chitin, and cellulose in a water bath at 50°C for 30 min; casein in a water bath at 37°C for 20 min), the substrate reacted with crude enzyme solution for 30 min to generate 1 μg of glucose / tyrosine, which was defined as one enzyme activity unit. 0.5% colloidal chitin, 0.5% CMC-Na, and 1% dextran were dissolved in 0.1 mol / L acetate-sodium acetate buffer (pH 4.5), and 0.5% casein was dissolved in 0.02 mol / L phosphate buffer (pH 7.5). The dextran content after reaction was measured using the DNS method, adjusted to a wavelength of 540 nm, and the OD value of the sample was recorded. The amount of casein after reaction was determined using the Folin-phenol method, adjusted to a wavelength of 680 nm, and the OD value was recorded. Inactivated crude enzyme solution was used as a control in both cases. The fermentation stock broth was diluted to 10... -5 10 -6 10 -7 After coating, the samples were incubated at 30℃ for 24 hours. The bacterial colony count was statistically analyzed, and the activities of glucanase, chitinase, protease, and cellulase were determined.

[0087] Based on the standard curve of cell wall degrading enzyme activity, the enzyme activities of Brevibacillus halotolerans Z-9 were measured to be 3.25 IU / ml for chitinase, 16.82 IU / ml for protease, 9.58 IU / ml for dextranase, and 6.23 IU / ml for cellulase.

[0088] (3) Test on siderogenic type of strain Z-9

[0089] Take 4 mL of MKB fermentation broth from strain Z-9 fermented for 4 days, centrifuge at 10000 r / min for 10 min, and retain the supernatant for later use. Identify siderophore types using the Arnow method and the ferric perchlorate method.

[0090] Take 1 mL of the supernatant of the antagonistic bacteria and add 1 mL of 0.5 mol / L HCl and 1 mL of molybdate solution (10 g NaNO2, 10 g Na2MoO4, and distilled water to a final volume of 100 mL). The solution turns yellow. Then add 1 mL of 0.5 mol / L NaOH. The solution turns from yellow to red and remains unchanged for 15 min, which proves the presence of catechol-type siderophores.

[0091] The ferric perchlorate test was used to detect isohydroxamic acid siderophores. 0.5 mL of Z-9 supernatant was taken and 2.5 mL of 5 mmol / L ferric perchlorate solution was added. A red color indicated the presence of isohydroxamic acid siderophores, while a yellow color indicated their absence. Sterile MKB liquid culture medium was used as the control.

[0092] Siderophore production capacity determination: For every 0.2 decrease in the absorbance ratio As / Ar, a "+" is added to classify the siderophore production capacity of the strain. Generally, bacteria with high siderophore production capacity (+++) have an absorbance ratio As / Ar below 0.5.

[0093] The results of the siderophore type identification were as follows: strain Z-9 turned red and the color did not change within 15 minutes, while the control showed no color change, indicating that strain Z-9 contains catechol-type siderophores. The ferric perchlorate test results showed that strain Z-9 was negative for isohydroxamic acid-type siderophores.

[0094] Based on the determination of the siderogen, this experiment further tested the siderogen production capacity of strain Z-9. As shown in Table 5, the minimum As / Ar ratio of strain Z-9 was 0.682±0.021, and the highest siderogen production capacity was "++".

[0095] Table 5: Visual representation of siderophore production capacity of strain Z-9

[0096]

[0097] Example 9: Application of Brevibacillus halotolerans Z-9 biocontrol agent in the control of blossom rot fungus in fragrant pear.

[0098] (1) Test on the control efficacy against cotton Verticillium wilt

[0099] Experiment time and location: Shaya County, Xinjiang, 2020.

[0100] Test variety: Xinluzhong 84 cotton. In the field trial, 75 L·hm² of fertilizer was applied with the seedling irrigation after cotton sowing. -2 Brevibacillus halotolerans Z-9 biocontrol agent was applied at 75 L·hm⁻² with water for the second and third applications. -2 The treatment used was Brevibacillus halotolerans Z-9 biocontrol agent. Adjacent cotton plants without agent application served as controls; all other field management practices were identical across treatments. Drip irrigation was applied using a mobile pressurized drip irrigation system, approximately 2 hours before the end of the drip cycle. The agent was added to the dosing tank of the drip irrigation system and dripped in with the water. Control groups included a clean water control group (CK) and a commonly used agent control group. The clean water control group received drip irrigation with clean water.

[0101] The disease grading criteria are as follows:

[0102] Grade 0: Good growth with no symptoms; Grade 1: Slight yellowing of leaves; Grade 2: Moderate or severe yellowing of leaves, wilting; Grade 3: Wilting of the plant, severe curling of leaves; Grade 4: Severe wilting of the plant, browning of the vascular bundles in the stem; Grade 5: The entire plant withers, the vascular bundles in the stem turn yellowish-brown, and the plant dies. The experimental results are shown in Table 6.

[0103] Prevention and control efficacy (%) = [(Disease index of control - Disease index of prevention and control) / Disease index of control] × 100%

[0104] Table 6: Field control efficacy of Brevibacillus halotolerans Z-9 biocontrol agent against Verticillium wilt in cotton.

[0105] deal with Incidence rate (%) Disease index Relative prevention and control effect (%) Z-9 8.23 7.14 78.07 Comparison 39.56 32.56 --

[0106] As shown in Table 6, the incidence index of cotton Verticillium wilt in the water (control) treatment was 32.56. After the biocontrol agent drip irrigation treatment, the incidence index of cotton Verticillium wilt decreased. Among them, the incidence index of cotton field after the application of biocontrol agent was 7.14, which showed the best control effect on Verticillium wilt, reaching 78.07%.

[0107] (2) Test on the efficacy of jujube black spot disease prevention

[0108] Experimental methods, time and location: 2020, in Shaya County, Xinjiang.

[0109] Experimental variety: Jujube; The experiment included a biocontrol agent treatment and a water control, with each treatment replicated three times, for a total of six plots. Two mature trees were fixed in each plot. In this experiment, a 50-fold dilution of Brevibacillus shalotolerans Z-9 biocontrol agent was sprayed once in mid-August, followed by two more applications in early and late September, for a total of three applications. The entire plant was sprayed evenly during application, ensuring no dripping. Water and fertilizer management and other agricultural operations were carried out normally during the experiment. The average daily temperature during the experiment was 31℃, and the relative humidity was 68%. The soil was sandy loam, fertile, and adequately fertilized.

[0110] Surveys were conducted three times in early, mid, and late October, for a total of three surveys throughout the experiment. Two trees were surveyed in each plot, and all fruits on two branches of each tree were surveyed from both left and right sides. The total number of fruits, the number of diseased fruits, and the number of lesions were recorded. The control effect of each treatment plot was calculated. During the application period, the presence of phytotoxicity on the jujube fruit was observed; specific results are shown in Table 7.

[0111] Disease grading method: Grade 0: No lesions; Grade 1: Lesions cover less than 5% of the total fruit area; Grade 3: Lesions cover 6% to 10% of the total fruit area; Grade 5: Lesions cover 11% to 20% of the total fruit area; Grade 7: Lesions cover more than 20% of the total fruit area.

[0112] The calculation method for disease index and prevention and control effect is as follows: Disease index = [∑(number of diseased fruits at each level × relative level value) / (total number of fruits surveyed × 9)] × 100

[0113] Control efficacy (%) = [∑(Blank control disease index - Drug-treated disease index) / Blank control disease index] × 100 Table 7: Field control efficacy of Brevibacillus halotolerans Z-9 biocontrol agent against jujube black spot disease

[0114] deal with Incidence rate (%) Disease index Relative prevention and control effect (%) Z-9 9.58 8.34 78.07 Comparison 43.61 37.46 --

[0115] As shown in Table 7, the Brevibacillus halotolerans Z-9 biocontrol agent provided by this invention, diluted 50 times and sprayed on jujube trees in the field, has a good control effect on jujube black spot disease, which is significantly higher than that of the control. After the third application, the control effect of Brevibacillus halotolerans Z-9 biocontrol agent reached 78.07%.

[0116] The above experiments show that Brevibacillus halotolerans Z-9, isolated from the rhizosphere soil of cotton and jujube in Tumushuke and Alar, Xinjiang, and the biocontrol agents prepared using Brevibacillus halotolerans Z-9, exhibit inhibition zone diameters of 23.32 mm and 25.68 mm against Verticillium wilt of cotton and black spot of jujube, respectively. It contains catechol-type siderophores and is negative for isohydroxamic acid-type siderophores. The minimum As / Ar ratio is 0.682±0.021, and the highest iron production capacity is "++". Field trials of the Brevibacillus halotolerans Z-9 biocontrol agent showed a reduction in the disease index of cotton Verticillium wilt, with a disease index of 7.14. It exhibited the best control effect against Verticillium wilt, reaching 78.07%. A 50-fold dilution of the Brevibacillus halotolerans Z-9 biocontrol agent also showed good control of jujube black spot disease, reducing the disease index to 8.34 and inhibiting the incidence rate to 9.58%. After the third application, the control effect reached as high as 78.07%. This indicates that the Brevibacillus halotolerans Z-9 and its prepared biocontrol agent provided by this invention have high efficacy against both cotton Verticillium wilt and jujube black spot disease, and are non-toxic and non-pathogenic with no side effects. They have broad application value in the preparation of drugs for the control of cotton Verticillium wilt and jujube black spot disease.

[0117] The above embodiments are merely examples to clearly illustrate the present invention and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The use of a biocontrol agent in the preparation of a medicine for preventing and treating jujube fruit black spot, characterized in that, The biocontrol agent is Brevibacillus halotolerans Z-9, which is prepared by fermentation of a new species of the genus Brevibacillus, salt-tolerant Brevibacillus halotolerans Z-9; the preservation number of the salt-tolerant Brevibacillus halotolerans Z-9 is CGMCC No. 15005.

Images