A method for constructing a single-cell ChIP-seq library based on microfluidic technology
By combining microfluidic technology with the Tn5 mutant PXTn5, the problems of insufficient specific activity and cumbersome operation of tagged Tn5 in single-cell ChIP-seq technology are solved, realizing high-throughput, low-contamination single-cell ChIP-seq library construction and simplifying the operation process.
Patent Information
- Application Number
- CN202211160359.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-05-26
- Filing Date
- 2022-09-22
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2042-09-22
AI Technical Summary
Existing single-cell ChIP-seq technology suffers from problems such as insufficient specific activity of tagged Tn5, cumbersome operation, and insufficient DNA enrichment, which limit its large-scale application and ease of use.
A single-cell ChIP-seq library construction method based on microfluidics technology was adopted. By using the Tn5 mutant and the fusion protein PXTn5, combined with microfluidic chips and specific kits, a one-tube operation was achieved, which reduced the difficulty of obtaining single cells and improved the DNA fragment capture rate and ease of operation.
It enables high-throughput and simple single-cell ChIP-seq library construction with a cell contamination rate as low as 2%, improves the specific activity of ProteinX-Tn5, and simplifies the operation process.
Smart Images

Figure GDA0005352599730000121 
Figure HDA0003859555390000011 
Figure HDA0003859555390000012
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biological detection, and particularly relates to a method for constructing a single-cell ChIP-seq library based on microfluidic technology. BACKGROUND
[0002] Heterogeneity between different cells in a cell population plays an important role in the development and progression of diseases, but most traditional gene analysis methods currently mask the differences between individual cells. Single-cell sequencing can demonstrate the inherent heterogeneity of individual cells and reveal complex and rare cell populations. In the past decade, different microfluidic technologies have emerged for single-cell research, becoming a frontier in the field. The main processes of single-cell sequencing technology include: single-cell separation, single-cell lysis, nucleic acid amplification, high-throughput sequencing, data processing and data analysis.
[0003] At present, single-cell sequencing technology is very mature and can achieve high-throughput sequencing of large-scale transcriptome, methylation group, chromatin accessibility (ATAC), etc. However, the research in these fields is either the life phenomena produced by biological individuals or the coarse range and shallow level of gene regulation. In order to accurately predict and explain the biological processes such as cell fate determination, disease occurrence and cell aging, chromatin immunoprecipitation (ChIP) technology is needed. ChIP, also known as binding site analysis, is a powerful tool for studying protein-DNA interactions in vivo, and is commonly used for the study of transcription factor binding sites or histone-specific modification sites. ChIP can be used to study the interaction of a specific protein with DNA or the changes in histones within the whole genome. First, ChIP specifically enriches the DNA fragments bound by the target protein, and then purifies and constructs a library; then, high-throughput sequencing is performed on the DNA fragments obtained by enrichment. Therefore, ChIP can explain why there are differences in gene expression, and how the upstream regulatory mechanism that produces the differences is produced. At present, there are three ways to achieve single-cell resolution, based on microplate technology, combined tag strategy and droplet technology.
[0004] Microplate technology: a microplate with an inner hole diameter of microns is used, and the diameter of the microplate is close to the diameter of the cell. During cell flow, the cell can fall into the inner hole, and the purpose of distinguishing single cells is achieved by physical size.
[0005] Combined tag technology: borrowing the idea of "split and pool", different tags are introduced in the process of multiple mixing and dispersion to achieve the purpose of distinguishing single cells.
[0006] Droplet technology: based on microfluidic droplet generation, a single droplet contains a cell and a microsphere, and a primer functionalized microsphere is used to target capture RNA or DNA. Therefore, the multi-omics map of cells in the whole tissue can be drawn by microfluidic droplet technology.
[0007] The ChIP-Seq technology combining ChIP with the second generation sequencing technology can efficiently detect DNA segments interacting with histones, transcription factors and the like in the whole genome. The principle of ChIP-Seq is that: first, the DNA fragments bound by the target protein are specifically enriched by the chromatin immunoprecipitation technology (ChIP), and then purified and library constructed; then the DNA fragments enriched are subjected to high-throughput sequencing. Researchers accurately locate the obtained millions of sequence tags to the genome, thereby obtaining the DNA segment information interacting with histones, transcription factors and the like in the whole genome.
[0008] However, the current ChIP-Seq technology still has the following deficiencies:
[0009] 1. The specific activity of the tagged Tn5 (such as ProteinA-Tn5) needs to be further improved.
[0010] 2. The biggest disadvantage of the micro-well plate and the combined tag strategy is that the process is extremely complicated and requires heavy physical labor (the gun (pipette) needs to be repeatedly washed and blown, which is physical labor), which limits the large-scale application of the two.
[0011] 3. The method of single cell ChIP-seq has not been widely popularized, and the main reason is that the simplicity of library construction and the enrichment degree of DNA are insufficient.
[0012] Therefore, there is an urgent need for a new ChIP-Seq library construction method. SUMMARY
[0013] In order to solve the above technical problems, the present application provides a single cell ChIP-seq library construction method based on microfluidic technology. In the library construction method of the present application, all single cells are collected in one tube for one-tube operation, which is simple to operate, reduces physical labor, and shortens the time of library preparation; and the microfluidic technology of the present application reduces the difficulty of obtaining single cells, and can easily realize high throughput; in addition, the cell contamination rate of the present application can be as low as 2% or less; the present application is a combination of microfluidic technology and ChIP-seq technology, which adopts original tube library construction to ensure the capture rate of DNA fragments; and the present application also improves the specific activity of ProteinX-Tn5.
[0014] The first aspect of the present application provides a Tn5 mutant, and the amino acid sequence of the Tn5 mutant is shown in SEQ ID NO: 1.
[0015] Tn5 as described in the present application refers to Tn5 transposase.
[0016] The second aspect of the present application provides a fusion protein comprising the Tn5 mutant as described in the first aspect of the present application, the structure of the fusion protein being Protein X-linker 1-Tn5 mutant.
[0017] Preferably, the amino acid sequence of the linker 1 is as shown in SEQ ID NO: 2, and / or the protein X comprises an amino acid sequence as shown in SEQ ID NO: 3.
[0018] More preferably, the protein X further comprises an amino acid sequence as shown in SEQ ID NO: 4.
[0019] In a certain preferred embodiment, the SEQ ID NO: 3 and the SEQ ID NO: 4 are connected by a linker 2, and the amino acid sequence of the linker 2 is as shown in SEQ ID NO: 5.
[0020] In a certain preferred embodiment, the N-terminal of the fusion protein further contains 6 histidines, i.e. the structure of the fusion protein is His6-Protein X-linker 1-Tn5.
[0021] The third aspect of the present application provides a linker combination for transposase assembly, the linker combination comprising: ME-A as shown in SEQ ID NO: 6, ME-B as shown in SEQ ID NO: 7, and ME-reverse as shown in SEQ ID NO: 8.
[0022] Preferably, the transposase is the fusion protein as described in the second aspect of the present application.
[0023] The fourth aspect of the present application provides a kit for sequencing library construction, the kit comprising the Tn5 mutant as described in the first aspect of the present application or the fusion protein as described in the first aspect of the present application, and / or the kit comprising the linker combination as described in the first aspect of the present application.
[0024] Preferably, the kit further comprises one or more of the following reagents:
[0025] (1) assembly buffer: 50 mM HEPES pH 7.2, 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100, 60% glycerol, solvent is water;
[0026] (2) Buffer 1: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1x cocktail, 2 mM EDTA, 0.01% Digitonin and 10 mM sodium butyrate;
[0027] (3) Buffer 2: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1x cocktail, 0.01% Digitonin and 10 mM sodium butyrate;
[0028] (4) Lysis buffer: 10 mM Tris-HCl pH 8.5, 0.05% SDS and 0.1 mg / ml Proteinase K;
[0029] (5) Enzyme reaction buffer: 2x KAPA master mix;
[0030] (6) Buffer 3: 10 mM TAPS-NaOH, pH 8.3, 10 mM MgCl2;
[0031] (7) P5 and P7 amplification primers, or P5 and P7 amplification primers containing index tags.
[0032] (8) One or more of Triton X-100, EDTA, BSA, H3K27ac antibody, Proteinase K, dNTP, DNA polymerase, microspheres, XP magnetic beads and microfluidic chip.
[0033] Preferably, the nucleotide sequences of the P5 and P7 amplification primers are as set forth in SEQ ID NO: 9 and SEQ ID NO: 10, respectively, and the nucleotide sequences of the P5 and P7 amplification primers containing index tags are as set forth in SEQ ID NO: 11 and SEQ ID NO: 12, respectively;
[0034] The fifth aspect of the present application provides a method for constructing a single-cell ChIP-seq library based on microfluidic technology, which uses the Tn5 mutant of the first aspect of the present application or the fusion protein of the second aspect of the present application, the linker combination of the third aspect of the present application, and / or the kit of the fourth aspect of the present application to construct a single-cell ChIP-seq library.
[0035] In a preferred embodiment, the preparation method comprises the following steps:
[0036] I. Preparation of droplets containing single cells:
[0037] (1) Preparation of cell phase:
[0038] i) mixing the fusion protein as described in the second aspect of the present application with the linker combination as described in the third aspect of the present application, so that the fusion protein is assembled with the linker;
[0039] ii) mixing the antibody against DNA binding protein and the fusion protein assembled with the linker to obtain a mixture;
[0040] iii) after mixing the mixture with single cells and incubation, sequentially using Buffer 3 and EDTA for treatment;
[0041] (2) Preparation of reaction phase: DNA polymerase, DNA polymerase buffer and dNTP;
[0042] (3) Preparation of microspheres containing barcode sequence;
[0043] (4) adding the cell phase obtained in step (1), the reaction phase obtained in step (2), the microspheres obtained in step (3) and droplet generation oil into a microfluidic chip, and running to obtain single cell microdroplets;
[0044] II. ChIP-seq library preparation:
[0045] i) performing amplification reaction on the single cell microdroplets obtained in step (4) above,
[0046] ii) subsequently destroying the single cell microdroplets to obtain target DNA in aqueous phase, and removing microsphere particles;
[0047] iii) adding P5 and P7 amplification primers containing index tags, and performing library amplification.
[0048] Preferably, one or more of the following conditions are met in step I:
[0049] i) the molar ratio of the fusion protein to the linker combination in step i) is (0.8-1.2):1, for example 1:1;
[0050] ii) the antibody in step ii) is H3K27ac antibody or control IgG (or other antibodies, including antibodies against other histone modifications, DNA binding proteins, transcription factors, etc.); preferably the solvent is buffer 1;
[0051] ii) the ratio of the antibody to the fusion protein assembled with the linker in step ii) is 1:(20-30) μg / μM, for example 1:25 μg / μM;
[0052] ii) further comprising the step of incubating the mixture, for example 4-12 h at 4°C;
[0053] iii) the ratio of antibody to single cell in the mixture is 1 μg: (0.8-1.2) x 10 5 cells, for example 1 μg: 1 x 10 5 cells;
[0054] The DNA polymerase is Q5 DNA polymerase.
[0055] The total number of cells in the cell suspension is 20-30k.
[0056] Preferably, in step II, before the amplification reaction in i), the single cell droplet is further subjected to UV treatment.
[0057] Preferably, in step II, the single cell droplet is disrupted using a recovery reagent, for example 1% PFO.
[0058] Preferably, in step II, after the library amplification, the target DNA is further purified.
[0059] For example, the purification is performed using 0.5*XP magnetic beads.
[0060] In a preferred embodiment, in step I, the treatment step iii) in (1) is:
[0061] 1) after mixing the mixture with the single cell, incubate at low temperature for 2-4 hours;
[0062] 2) centrifuge at 300g at low temperature for 3 min, wash twice with buffer 2;
[0063] 3) after adding Buffer 3 and incubating at low temperature for 1-2 hours, add an equal volume of EDTA and incubate at low temperature for 10 min;
[0064] 4) centrifuge at 300g at low temperature for 3 min, resuspend with buffer 2 and add 1x DAPI staining.
[0065] Preferably, the low temperature is 0-10°C, for example 4°C
[0066] In the construction method of the present application, preferably, the single cell is isolated from a non-crosslinked or fixed cell line or tissue cell cultured in vitro, or a crosslinked or fixed cell line or tissue cell cultured in vitro.
[0067] More preferably, the non-crosslinked or fixed cell line or tissue cell is a fresh tissue sample, and the crosslinked or fixed cell line or tissue cell is a formaldehyde-fixed cell line or tissue cell.
[0068] Further preferably, when the single cell is isolated from a formaldehyde-fixed cell line or tissue cell, the step of adding proteinase K treatment is further included after the step of removing the microsphere particles.
[0069] The sixth aspect of the present application further provides a sequencing method of a sample, which uses the single cell ChIP-seq library obtained by the construction method according to the fifth aspect of the present application.
[0070] The seventh aspect of the present application further provides the use of the Tn5 mutant according to the first aspect of the present application, the fusion protein according to the second aspect of the present application, the linker combination according to the third aspect of the present application or the kit according to the fourth aspect of the present application in the construction of a single cell ChIP-seq library based on microfluidic technology.
[0071] The cocktail according to the present application refers to a proteinase inhibitor.
[0072] The ME according to the present application refers to Mosaic End.
[0073] The PFO according to the present application refers to 1H, 1H, 2H, 2H-perfluorooctanol.
[0074] The microsphere used in the present application can be conventional in the art, for example, a polyacrylamide microsphere with a specific oligonucleotide sequence (see patent PCT / CN2021 / 129694) or a double-layer microsphere with an oligonucleotide sequence for single cell sequencing (see patent PCT / CN2021 / 12970).
[0075] The barcode sequence according to the present application can be the sequence of a barcode in the art.
[0076] The microfluidic chip used in the present application can be conventional in the art.
[0077] On the basis of common sense in the art, the above-mentioned preferred conditions can be combined at will, i.e. to obtain each preferred example of the present application.
[0078] The reagents and raw materials used in the present application are commercially available.
[0079] The positive progress effect of the application is that in the library construction method of the application, all single cells are collected in one tube for one-tube operation, the operation is simple, the physical labor is reduced, and the time for library preparation is shortened; and the microfluidic technology reduces the difficulty of single cell acquisition, and high throughput can be easily achieved; in addition, the cell contamination rate of the application can be as low as 2% or less; the application is a combination of microfluidic technology and ChIP-seq technology, and the original tube library construction is adopted to ensure the capture rate of DNA fragments; and the application also improves the specific activity of ProteinX-Tn5. BRIEF DESCRIPTION OF DRAWINGS
[0080] Figure 1 It is a schematic diagram of single cell ChIP-seq, which is divided into four parts: cell pretreatment, droplet encapsulation, template amplification, and library preparation.
[0081] Figure 2 It is the purification result of PXTn5 (i.e. ProteinX-Tn5 fusion protein): BSA standard product is used as a reference.
[0082] Figure 3 It is the activity detection result of PXTn5.
[0083] Figure 4 It is the result of PXTn5 linker conversion.
[0084] Figure 5 It is a double-species contamination rate evaluation diagram: one point or one triangle represents one cell, and the total number of cells is 529, in which the black points (points near the vertical coordinate) represent 3T3 cells, the gray points (points near the horizontal coordinate) represent HEK293T cells, and the triangles represent contaminated double-species cells.
[0085] Figure 6 Comparison of ChIP-seq (H3K27ac) results of living cells and formaldehyde-fixed cells: all single cells of each sample are mixed for analysis. DETAILED DESCRIPTION
[0086] The application will be further described below by way of examples, but the application is not limited in the scope of the examples. The experimental methods in the following examples without specific conditions are selected according to conventional methods and conditions, or according to the instructions of the commodity.
[0087] The application relates to a single cell ChIP-seq library preparation method, which integrates DNA site-directed mutation, genetic engineering, protein engineering, microfluidic technology and ChIP technology. The schematic diagram of single cell ChIP-seq is as follows: Figure 1First, the resolution at single cell level is achieved by microfluidics, then the target site is recognized by antibody, further the target site is cut by mutant high-activity Protein A-Tn5 fusion protein (referred to as PXTn5), and finally the DNA information of the target site is enriched by PCR. For specific details, see the following examples.
[0088] The reagents used in the following examples are as follows:
[0089] Assembly buffer: 50 mM HEPES pH 7.2, 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100, 60% glycerol, solvent is ultrapure water.
[0090] Buffer 1: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1X cocktail, 2 mM EDTA, 0.01% Digitonin and 10 mM sodium butyrate.
[0091] Buffer 2: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1X cocktail, 0.01% Digitonin and 10 mM sodium butyrate.
[0092] Lysis solution: 10 mM Tris-HCl pH 8.5, 0.05% SDS and 0.1 mg / ml Proteinase K.
[0093] Enzyme reaction solution: 2x KAPAmaster mix.
[0094] Buffer 3: 10 mM TAPS-NaOH, pH 8.3, 10 mM MgCl2.
[0095] Example 1
[0096] 1. Expression gene of PXTn5 fusion protein was obtained by DNA site-directed mutation technology.
[0097] The yield of conventional Tn5 transposase is limited, mainly due to the structure of the target gene. There are two translation initiation sites in the coding gene of Tn5, which are Met at the first and 56th positions, respectively. The amino acid translation initiation of the two sites has a certain randomness. However, the truncated encoded peptide chain not only does not have catalytic activity, but also acts as an inhibitor. After binding with the full-length peptide chain, it forms a heterodimer, which hinders the full-length Tn5 protein to exert catalytic activity. Therefore, the present application makes site-directed mutation to the coding gene of Tn5. In addition to the M56L mutation on the wild type sequence, the Tn5 transposase of the present application also includes P214R / G251R / A338V mutations.
[0098] The Tn5 original gene sequence (SEQ ID NO: 13) is mutated at the following sites (underlined) to form the Tn5 mutant gene sequence (SEQ ID NO: 14), which encodes the amino acid sequence shown in SEQ ID NO: 1.
[0099] SEQ ID NO: 13:
[0100] atgattaccagtgcactgcatcgtgcggcggattgggcgaaaagcgtgttttctagtgctgcgctgggtgatccgcgtcgtaccgcgcgtctggtgaatgttgcggcgcaactggccaaatatagcggcaaaagcattaccattagcagcgaaggcagcaaagcc atgcaggaaggcgcgtatcgttttattcgtaatccgaacgtgagcgcggaagcgattcgtaaagcgggtgccatgcagaccgtgaaactggcccaggaatttccggaactgctggcaattgaagataccacctctctgagctatcgtcatcaggtggcggaagaactgggcaaactgggtagcattcaggataaaagccgtggttggtgggtgcatagcgtgctgctgctggaagcgaccacctttcgtaccgtgggcctgctgcatcaagaatggtggatgcgtccggatgatccggcggatgcggatgaaaaagaaagcggcaaatggctggccgctgctgcaacttcgcgtctgagaatgggcagcatgatgagcaacgtgattgcggtgtgcgatcgtgaagcggatattcatgcgtatctgcaagataaactggcccataacgaacgttttgtggtgcgtagcaaacatc cg cgtaaagatgtggaaagcggcctgtatctgtatgatcacctgaaaaaccagccggaactgggcggctatcagattagcattccgcagaaaggcgtggtggataaacgt g g c aaacgtaaaaaccgtccggcgcgtaaagcgagcctgagcctgcgtagcggccgtattaccctgaaacagggcaacattaccctgaacgcggtgctggccgaagaaattaatccgccgaaaggcgaaaccccgctgaaatggctgctgctgaccagcgagccggtggaaagtctggcccaagcgctgcgtgtgattgatatttatacccatcgttggcgcattgaagaatttcacaaagcgtggaaaacgggtgcgggtg cggaacgtcagcgtatggaagaaccggataacctggaacgtatggtgagcattctgagctttgtggcggtgcgtctgctgcaactgcgtgaatcttttactccgccgcaagcactgcgtgcgcagggcctgctgaaagaagcggaacacgttgaaagccagagcgcggaaaccgtgctgaccccggatgaatgccaactgctgggctatctggataaaggcaaacgcaaacgcaaagaaaaagcgggcagcctgcaatgggcgtatatggcgattgcgcgtctgggcggctttatggatagcaaacgtaccggcattgcgagctggggtgcgctgtgggaaggttgggaagcgctgcaaagcaaactggatggctttctggccgcgaaagacctgatggcgcagggcattaaaatctga
[0101] SEQ ID NO: 14:
[0102] atgattaccagtgcactgcatcgtgcggcggattgggcgaaaagcgtgttttctagtgctgcgctgggtgatccgcgtcgtaccgcgcgtctggtgaatgttgcggcgcaactggccaaatatagcggcaaaagcattaccattagcagcgaaggcagcaaagcc ctgcaggaaggcgcgtatcgttttattcgtaatccgaacgtgagcgcggaagcgattcgtaaagcgggtgccatgcagaccgtgaaactggcccaggaatttccggaactgctggcaattgaagataccacctctctgagctatcgtcatcaggtggcggaagaactgggcaaactgggtagcattcaggataaaagccgtggttggtgggtgcatagcgtgctgctgctggaagcgaccacctttcgtaccgtgggcctgctgcatcaagaatggtggatgcgtccggatgatccggcggatgcggatgaaaaagaaagcggcaaatggctggccgctgctgcaacttcgcgtctgagaatgggcagcatgatgagcaacgtgattgcggtgtgcgatcgtgaagcggatattcatgcgtatctgcaagataaactggcccataacgaacgttttgtggtgcgtagcaaacatc gt cgtaaagatgtggaaagcggcctgtatctgtatgatcacctgaaaaaccagccggaactgggcggctatcagattagcattccgcagaaaggcgtggtggataaacgt cgtaaacgtaaaaaccgtccggcgcgtaaagcgagcctgagcctgcgtagcggccgtattaccctgaaacagggcaacattaccctgaacgcggtgctggccgaagaaattaatccgccgaaaggcgaaaccccgctgaaatggctgctgctgaccagcgagccggtggaaagtctggcccaagcgctgcgtgtgattgatatttatacccatcgttggcgcattgaagaatttcacaaagcgtggaaaacgggtgcgggtgtggaacgtcagcgtatggaagaaccggataacctggaacgtatggtgagcattctgagctttgtggcggtgcgtctgctgcaactgcgtgaatcttttactccgccgcaagcactgcgtgcgcagggcctgctgaaagaagcggaacacgttgaaagccagagcgcggaaaccgtgctgaccccggatgaatgccaactgctgggctatctggataaaggcaaacgcaaacgcaaagaaaaagcgggcagcctgcaatgggcgtatatggcgattgcgcgtctgggcggctttatggatagcaaacgtaccggcattgcgagctggggtgcgctgtgggaaggttgggaagcgctgcaaagcaaactggatggctttctggccgcgaaagacctgatggcgcagggcattaaaatctga
[0103] The sequence of Protein A is optimized to the sequence of Protein X (amino acid sequence of SEQ ID NO: 28), and the specific base sequence (SEQ ID NO: 15) is as follows:
[0104] atgaccatgattacgccaagcttaaaagatgacccaagccaaagtgctaacctattgtcagaagctaa aaagttaaatgaatctcaagcaccgaaagcggataacaaattcaacaaagaacaacaaaatgctttctatgaaatc ttacatttacctaacttaaacgaagaacaacgcaatggtttcatccaaagcctaaaagatgacccaagccaaagcg ctaaccttttagcagaagctaaaaagctaaatgatgctcaagcaccaaaagctgacaacaaattcaacaaagaaca acaaaatgctttctatgaaattttacatttacctaacttaactgaagaacaacgtaacggcttcatccaaagcctt aaagacgatccttcagtgagcaaagaaattttagcagaagctaaaaagctaaacgatgctcaagcaccaaaa ggaggatccggaggatccggaggatccacaact tataaattagtcatcaacgggaaaacgctgaagggtgaaaccacgac agaggccgtagatgcggagacagcggagcgccactttaagcaatacgcgaatgataacggtgtagacggcgagtgg acctacgacgacgcgacaaagacctttaccgtcacggagaaacctgaggttatcgacgcgtctgagttgacgccag cc .
[0105] wherein, the underlined part is original protein A (amino acid sequence is SEQ ID NO: 3), the italic and underlined part is protein G (amino acid sequence is SEQ ID NO: 4), the bold part (without underlining) is linker2 (amino acid sequence is GGSGGSGGSTT (SEQ ID NO: 5))
[0106] The mutated Tn5 and the optimized Protein X form a PXTn5 fusion protein through His6-Protein X-linker1-Tn5 structure, wherein linker1 corresponds to the amino acid sequence of GGSGGSGGS (SEQ ID NO: 2), and His6 corresponds to the amino acid sequence of HHHHHH.
[0107] 1) Twelve primers for cloning were designed: PX-1 and PX-2 for cloning of Protein X gene, MUT1-4-A and MUT1-4-B for site-directed mutagenesis of Tn5, Tn5-F and Tn5-R for cloning of Tn5 gene.
[0108] PX-1: 5'-TGGACAGCAAATGGGTCGCGGATCCaccatgattacgccaagcttaa (SEQ ID NO: 16);
[0109] PX-2: 5'-ggctggcgtcaactcagacg (SEQ ID NO: 17);
[0110] Tn5-F: 5'-cgtctgagttgacgccagccggaggatccggaggatccattaccagtgcactgcatcg (SEQ ID NO: 18);
[0111] MUT1-A: 5'-gccttcctgc ag ggctttgctgccttcgctgc (SEQ ID NO: 19);
[0112] MUT1-B: 5'-gcaaagcc ct gcaggaaggcgcgtatcgttttattc (SEQ ID NO: 20);
[0113] MUT2-A: 5'-ctttacg ac gatgacggctacgcaccacaaaacgttcg (SEQ ID NO: 21);
[0114] MUT2-B: 5'-cgtagccgtcatc gt cgtaaagatgtggaaagcggcctg (SEQ ID NO: 22);
[0115] MUT3-A: 5' tttacgttt a c g acgtttatccaccacgcctt (SEQ ID NO: 23);
[0116] MUT3-B: 5'-ataaacgt c g t aaacgtaaaaaccgtccggcgcg (SEQ ID NO: 24);
[0117] MUT4-A: 5'-ctgacgttcc a cacccgcacccgttttccacgctt (SEQ ID NO: 25);
[0118] MUT4-B: 5'-gtgcgggtg t ggaacgtcagcgtatggaagaacc (SEQ ID NO: 26);
[0119] Tn5-R: 5'-GGTGCTCGAGTGCGGCCGCAAGCTT tcagattttaatgccctgcgcc (SEQ ID NO: 27).
[0120] The expression vector PET28a was digested by restriction enzymes BamH I and Hind III.
[0121] 1) Mutated target gene was cloned into the expression vector by multi-fragment recombination.
[0122] 2) Whether the inserted gene was mutated was determined by Sanger sequencing (first-generation sequencing).
[0123] 2. Expression and activity identification of PXTn5 fusion protein.
[0124] 1) The expression host Escherichia coli BL21 (DE3) was transformed.
[0125] 2) Induced expression was performed in an environment at 18°C.
[0126] 3) The bacterial cells were collected by centrifugation.
[0127] 4) Resuspend the bacterial pellet with protein purification buffer (20 mM Hepes, pH 7.2, 0.8 M NaCl, 10% glycerol, 0.2% Triton X-100), add protease inhibitor cocktail (Roch, Cat No. 04693132001) and PMSF (VWR, Cat No. 97064-898).
[0128] 5) Break the bacterial pellet by sonication, and then purify the protein by affinity chromatography.
[0129] 6) Identify the purity of the protein by SDS-PAGE (the purity should be greater than 90%), using a known concentration of BSA standard as a reference, and the results are shown in Figure 2
[0130] Example 2
[0131] 3. Assembly of PXTn5 and activity determination
[0132] 1) The assembled adapters have the following advantages over the redesigned adapters: the current conventional ME-reverse sequence is 19 bp, which is shortened to 15 bp (deletion of the 5' end of the conventional ME-reverse "ATCT" four bases) and 9 bp (obtained by deleting the 5' end of the conventional ME-reverse "ATACACATCT" ten bases).
[0133] ME-reverse is annealed with ME-A and ME-B respectively to form A and B adapters called local double-stranded, which are used together.
[0134] PXTn5 assembled adapter sequence:
[0135] ME-A: 5'-TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAG -3'(SEQ ID NO: 6);
[0136] ME-B: 5'-GTCTCGTGGGCTCGGAGATGTGTAT AAGAGACAG -3'(SEQ ID NO: 7);
[0137] ME-reverse: 5'-Phos / CTGTCTCTTATACAC-3'(SEQ ID NO: 8).
[0138] ME-reverse-9: 5'-Phos / CTGTCTCTT-3'.
[0139] Bold indicates the forward sequence of ME, which is 19 bp, and the italicized portion is the region that can be complementary to ME-reverse, and the italicized underlined portion is the region that can be complementary to ME-reverse-9.
[0140] 2) PXTn5, linker and assembly buffer were mixed in certain amounts (PXTn5 was 25 μΜ, linker was 25 μΜ, and the rest was made up to 50 μΐ with assembly buffer).
[0141] 3) Incubate at 25 °C for 60 min.
[0142] 4) PXTn5 assembled with 19 bp reverse linker is denoted as PXTn5-a / b, PXTn5 assembled with 15 bp reverse linker is denoted as PXTn5-A / B, and PXTn5 assembled with 9 bp reverse linker is denoted as PXTn5-9bp.
[0143] 5) The assembled PXTn5 can be stored at -20 °C.
[0144] Example 3
[0145] Activity determination of PXTn5-a / b
[0146] 1) Take 200 ng of conventional mouse genomic DNA.
[0147] 2) Add 2 μΐ of 5x Tn5 reaction buffer (50 mM TAPS-NaOH, pH 8.3, 50 mM MgCl2), add 0.5 μΐ and 1 μΐ of PXTn5-a / b respectively (no addition as a control), and add water to make up to 10 μΐ.
[0148] 3) 55 °C, react for 10 min, add 2 μΐ of termination buffer (250 mM EDTA, 0.2% SDS) to terminate the reaction, and react at 55 °C for 10 min.
[0149] 4) Detect by 2% agarose gel, 120 V, 40 min.
[0150] 5) The results show that the peak of DNA cut by PXTn5-a / b is about 350 bp (the control group is not cut), which proves that the mutant PXTn5 has high activity, as shown in Figure 3 .
[0151] Activity determination of PXTn5-A / B
[0152] 1) Take 200 ng of conventional mouse genomic DNA.
[0153] 2) Add 2 μΐ 5x Tn5 reaction buffer (50 mM TAPS-NaOH pH 8.3, 50 mM MgCl2), add 1 μΐ PXTn5-A / B (1 μΐ PXTn5-a / b as control) respectively, add water to 10 μΐ.
[0154] 3) 55 °C, 10 min, add 2 μΐ stop buffer (250 mM EDTA, 0.2% SDS) to stop the reaction, 55 °C, 10 min.
[0155] 4) Check by 2% agarose gel, 120 V, 40 min.
[0156] 5) The results show that the peak of DNA cleavage by PXTn5-A / B and PXTn5-a / b is around 350 bp, which proves that changing the reverse sequence of the linker does not affect the activity of the enzyme, as shown in Figure 4
[0157] Example 4
[0158] 4. Verification of the ChlP-seq library preparation method.
[0159] In order to verify whether the prepared PXTn5 has biological activity and whether the designed library construction method is feasible, a small amount of cell ChlP-seq experiment is carried out to illustrate.
[0160] A Preparation of antibody and PXTn5 mixture
[0161] 1) Take 0.5 μg of H3K27ac antibody (abcam, ab4729) or control IgG (abcam, ab172730) and dilute with 100 μΐ buffer 1.
[0162] 2) Add 0.3 μΐ, 12.5 μΜ PXTn5 (with PXTn5-A / B or PXTn5-a / b assembled on it) and incubate at 4 °C for 4 hours or overnight.
[0163] B Cell preparation
[0164] a) The cultured K562 cells (Pronova, item number CL-0130) are trypsinized, centrifuged at 300 g at room temperature for 3 min, and washed with PBS three times.
[0165] b) Count the number of cells and the viability.
[0166] c) Take 50 k cells and resuspend them with buffer 2 (containing 0.01% digitonin).
[0167] d) Add the mixture of antibody and PXTn5 prepared in advance to the cells (12.5 μM of PXTn5 and 0.5 μg of antibody are added to 50 k of cells), and incubate at 4°C for 2-4 hours.
[0168] e) 4°C, 300g, centrifuge for 3 min, wash twice with 200 μl buffer 2.
[0169] f) Add 10 μl Buffer 3 (10 mM TAPS-NaOH, pH 8.3, 10 mM MgCl2), 37°C, 60 min.
[0170] g) Add an equal volume of 40 mM EDTA, and place on ice for 10 min.
[0171] h) 4°C, 300g, centrifuge for 3 min, resuspend with 200 μl buffer 2, and add 1x DAPI staining.
[0172] i) Count under a fluorescence microscope, and transfer 5,000 nuclei to a 200 μl centrifuge tube, 300g, centrifuge for 3 min, and discard the supernatant.
[0173] j) Add 6 μl lysis solution, and lyse at 55°C for 2 hours, and inactivate the proteinase K at 85°C for 15 min.
[0174] k) Add 1.5 μl reducing agent (1.8% Triton X-100), and incubate at 37°C for 30 min
[0175] l) Add the enzyme reaction solution and primers (P5: 5'-AATGATACGGCGACCACCGAGATCTTCGTCGGCAGCGTC-3'; P7: 5' CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG-3') for amplification, and amplify for 16-18 cycles.
[0176] m) Add 0.5x XP magnetic beads (Beckman, AMPure XP, A63881), discard the magnetic beads, and retain the supernatant.
[0177] n) Add 0.5x XP magnetic beads to the supernatant again, discard the supernatant, retain the magnetic beads, and wash twice with 200 μl 80% ethanol.
[0178] o) The target DNA is adsorbed on the magnetic beads, and the DNA is finally eluted with water.
[0179] The library concentration is determined by Qubit, and the results show that the concentration of PXTn5-A / B is the highest, which represents that the use of PXTn5-A / B of the application increases the enrichment of library DNA, as shown in Table 1.
[0180] Table 1 Library concentration assay
[0181]
[0182] Example 5
[0183] 5. Preparation of microfluidic-based single cell ChIP-seq library (live cell lines or tissue cells).
[0184] A Preparation of mixture of antibody and PXTn5
[0185] 1) Take 0.5 pg of H3K27ac antibody or control IgG (or other antibodies, including antibodies against other histone modifications, DNA binding proteins, transcription factors, etc.), and dilute with 100 mΐ buffer 1.
[0186] 2) Add 0.3 mΐ, 12.5 mM of PXTn5 (with upper linker assembled), incubate at 4 °C for 4 hours, or until overnight.
[0187] B Cell preparation
[0188] a) Obtain K562 (Promocell, Cat# CL-0130), HEK293T and 3T3 single cell suspension (routine in the art), 300g, 3 min, room temperature, and wash with PBS three times.
[0189] b) Count the number of cells and the viability.
[0190] c) The following test is divided into two groups: one group takes 100k live K562 cells, and the other group takes 50k live HEK293T and 50k live 3T3 cells mixed, and resuspend them with buffer 2 (containing 0.01% digitonin, and if tissue cells, it should contain 0.05% Triton X-100).
[0191] d) Add the mixture of antibody and PXTn5 prepared in advance to the cells, and incubate at 4 °C for 2-4 hours.
[0192] e) 4 °C, 300g, 3 min, and wash with 200 mΐ buffer 2 twice.
[0193] f) Add 10 mΐ Buffer 3, 37 °C, 60 min.
[0194] g) Add equal volume of 40 mM EDTA, and place on ice for 10 min.
[0195] h) 4°C, 300g, 3min, resuspended in 200ul buffer 2, add 1x DAPI stain.
[0196] i) Count under fluorescent microscope.
[0197] C Droplet preparation
[0198] 1) Set up cell phase: resuspend cells in PBS, add 0.1% BSA (SIGMA, cat# A1933-25G), total cell number 20-30k.
[0199] 2) Set up reaction phase: add Q5 DNA polymerase (NEB, cat# M0491L), DNA polymerase buffer (NEB, B9027S) and dNTPs (Thermofisher, cat# R0192).
[0200] 3) Prepare microspheres: contain barcode sequences.
[0201] 4) Add 1), 2), 3) and droplet generation oil (bioRad, cat# 1863005) to chip.
[0202] 5) Start run, form single cell containing droplets.
[0203] D Library preparation
[0204] 6) After UV treatment of droplets for 5min, split into 200ul centrifuge tubes for amplification reaction.
[0205] 7) Add recovery reagent (1% PFO, Sigma-370533) to break droplets, obtain aqueous phase, DNA in aqueous phase.
[0206] 8) Filter, remove microsphere particles.
[0207] 9) Add P5 and P7 amplification primers containing index tags (P5: 5'-AATGATACGGCGACC ACCGAGATCT[8nt i5 index]TCGTCGGCAGCGTC; P7: CAAGCAGAAGACGGCAT ACGAGAT[8nt i7 index]GTGACTGGAGTTCAGACGTGTGCTC, Q5 DNA polymerase, dNTPs, to perform library amplification, 12-13 cycles of amplification.
[0208] j) After amplification is complete, add 0.5x XP magnetic beads, discard magnetic beads, retain supernatant.
[0209] k) Add 0.5x XP magnetic beads to the supernatant, discard the supernatant, keep the magnetic beads, and wash twice with 200 μl 80% ethanol.
[0210] l) The target DNA is adsorbed on the magnetic beads, and finally the DNA is eluted with water and sent for second-generation sequencing.
[0211] m) The results of the HEK293T and 3T3 double-species experiment show that the single-cell distinguishing accuracy of the application is high, and the contamination rate is only 1.13%, as shown in Figure 5 .
[0212] Example 6
[0213] 6. Preparation of microfluidic-based single-cell ChIP-seq library (formaldehyde-fixed cell lines or tissue cells).
[0214] A Preparation of mixture of antibody and PXTn5
[0215] 3) Take 0.5 μg of H3K27ac antibody or control IgG (or other antibodies, including antibodies against other histone modifications, DNA-binding proteins, transcription factors, etc.), and dilute with 100 μl buffer 1.
[0216] 4) Add 0.3 μl of 12.5 μM PXTn5 (which has been assembled with an upper linker), and incubate at 4°C for 4 hours, or until overnight.
[0217] B Cell preparation
[0218] a) Obtain a single-cell suspension of K562 cells, centrifuge at 300g for 3 min, and wash three times with PBS.
[0219] b) Count the number of cells and the viability.
[0220] c) Take 100k formaldehyde-fixed K562 cells, and resuspend them with buffer 2 (containing 0.01% digitonin, and if tissue cells, containing 0.05% Triton X-100).
[0221] d) Add the mixture of pre-prepared antibody and PXTn5 to the cells, and incubate at 4°C for 2-4 hours.
[0222] e) Centrifuge at 300g for 3 min at 4°C, and wash twice with 200 μl buffer 2.
[0223] f) Add 10 μl Buffer 3, and incubate at 37°C for 60 min.
[0224] g) Add an equal volume of 40 mM EDTA, and place on ice for 10 min.
[0225] h) 4°C, 300g, 3min, resuspended in 200μl buffer 2, and add 1x DAPI staining.
[0226] i) Count under fluorescent microscope.
[0227] C Droplet preparation
[0228] 1) Prepare cell phase: resuspend cells in PBS, add 0.1% BSA (SIGMA, Cat# A1933-25G), total cell number is 20-30k.
[0229] 2) Prepare reaction phase: add Q5 DNA polymerase (NEB, Cat# M0491L), DNA polymerase buffer (NEB, B9027S), and dNTP (Thermofisher, Cat# R0192).
[0230] 3) Prepare microspheres: contain barcode sequence.
[0231] 4) Add 1), 2), 3), and droplet generation oil (bioRad, Cat# 1863005) to the chip.
[0232] 5) Start running, form single cell containing droplets.
[0233] D Library preparation
[0234] 1) After UV treatment of the droplets for 5min, split them into 200μl centrifuge tubes, and perform amplification reaction.
[0235] 2) Add recovery reagent (1% PFO, Sigma, 370533) to break the droplets, and obtain aqueous phase, DNA is in the aqueous phase.
[0236] 3) Filter, remove microsphere particles.
[0237] 4) Add proteinase K, treat at 55°C for 30min, and deactivate at 85°C for 15min.
[0238] 5) Add P5 and P7 amplification primers containing index tags (P5: 5'-AATGATACGGCGACCAGCAGATCT[8nt i5 index]TCGTCGGCAGCGTC-3'; P7: 5'-CAAGCAGAAGACGGC ATACGAGAT[8nt i7 index]GTGACTGGAGTTCAGACGTGTGCTC3'), Q5 DNA polymerase, dNTP, to perform library amplification, amplify for 12-13 cycles.
[0239] 6) After amplification is complete, add 0.5×XP magnetic beads, discard the magnetic beads, and keep the supernatant.
[0240] 7) Add 0.5×XP magnetic beads to the supernatant, discard the supernatant, keep the magnetic beads, and wash twice with 200μl of 80% ethanol.
[0241] 8) The target DNA is adsorbed onto the magnetic beads, and finally the DNA is washed off with water and sent for next-generation sequencing.
[0242] 9) Results are as follows Figure 6 As shown, "live" represents the result of library amplification using live K562 cells in Example 5, and "fixed" represents the result of library amplification using formaldehyde-fixed K562 cells in this example. The results show that the library construction process of the present invention is qualified, and the results of live cells and formaldehyde-fixed cells are similar. Both treatment methods can be used for single-cell ChIP-seq experiments, and the capture depth of the library construction method of the present invention is greater than that of ENCODE (H3K27ac ChIP-seq).
Claims
1. A fusion protein, characterized in that, The fusion protein comprises a Tn5 mutant with an amino acid sequence as shown in SEQ ID NO: 1, and its structure is Protein X-linker 1-Tn5 mutant; the amino acid sequence of the linker 1 is as shown in SEQ ID NO: 2, the protein X comprises amino acid sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; and SEQ ID NO: 3 and SEQ ID NO: 4 are connected by a linker 2, and the amino acid sequence of the linker 2 is as shown in SEQ ID NO:
5.
2. A kit for sequencing library construction, characterized in that, The kit comprises the fusion protein as claimed in claim 1, and a linker combination; The linker combination comprises: ME-A as shown in SEQ ID NO: 6, ME-B as shown in SEQ ID NO: 7, and ME-reverse as shown in SEQ ID NO:
8.
3. The kit of claim 2, wherein The kit further comprises one or more of the following reagents: (1) Assembly buffer: 50 mM HEPES pH7.2, 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100, 60% glycerol, solvent is water; (2) Buffer 1: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1x cocktail, 2 mM EDTA, 0.01% Digitonin and 10 mM sodium butyrate; (3) Buffer 2: 20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1x cocktail, 0.01% Digitonin and 10 mM sodium butyrate; (4) Lysis solution: 10 mM Tris-HCl pH 8.5, 0.05% SDS and 0.1 mg / ml Proteinase K; (5) Enzyme reaction solution: 2x KAPA master mix; (6) Buffer 3: 10 mM TAPS-NaOH, pH 8.3, 10 mM MgCl2; (7) P5 and P7 amplification primers, or P5 and P7 amplification primers containing index labels; and, (8) One or more of Triton X-100, EDTA, BSA, H3K27ac antibody, proteinase K, dNTP, DNA polymerase, microspheres and microfluidic chip.
4. The kit of claim 3, wherein The nucleotide sequences of the P5 and P7 amplification primers are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively, and the nucleotide sequences of the P5 and P7 amplification primers containing index tags are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively; and / or, the microspheres are XP magnetic beads.
5. A method for constructing a single-cell ChIP-seq library based on microfluidic technology, characterized by, It uses the fusion protein of claim 1, and / or the kit of any one of claims 2-4 to construct a single-cell ChIP-seq library.
6. The construction method of claim 5, wherein, It comprises the following steps: I. Preparation of cell droplets: (1) Preparation of cell phase: i) Mix the fusion protein of claim 1 with the linker combination so that the fusion protein is assembled with the linker; the linker combination comprises: ME-A as shown in SEQ ID NO: 6, ME-B as shown in SEQ ID NO: 7, and ME-reverse as shown in SEQ ID NO: 8; ii) Mix the antibody against the DNA binding protein and the fusion protein assembled with the linker to obtain a mixture; iii) After mixing the mixture with single cells and incubating, sequentially use Buffer 3 and EDTA for treatment; (2) Preparation of reaction phase: DNA polymerase, DNA polymerase buffer and dNTP; (3) Preparation of microspheres containing barcode sequences; (4) Mix the cell phase obtained in step (1), the reaction phase obtained in step (2), the microspheres obtained in step (3), and the droplet generation oil together in a microfluidic chip to obtain single-cell microdroplets; II. ChIP-seq library preparation: i) Perform amplification reaction on the single-cell microdroplets obtained in step (4) above, ii) Then destroy the single-cell microdroplets to obtain target DNA in the aqueous phase, and remove the microsphere particles; iii) Add P5 and P7 amplification primers containing index tags to perform library amplification.
7. The construction method of claim 6, wherein, It meets one or more of the following conditions: In step I, the molar ratio of the fusion protein to the linker combination in i) is (0.8-1.2):1; In step I, the antibody in ii) is an H3K27ac antibody; In step I, the ratio of the antibody to the fusion protein assembled with the linker in ii) is 1:(20-30) μg / μM; In step I, ii) further comprises the step of incubating the mixture; In step I, the ratio of antibody to single cell in the mixture described in iii) is 1 μg : (0.8-1.2) x 10 5 cells; In step I, the DNA polymerase is Q5 DNA polymerase; In step I, the total number of cells in the cell phase is 20-30k; In step II, i) further comprises the step of treating the single-cell microdroplets with ultraviolet light before the amplification reaction; In step II, the single-cell microdroplets are destroyed using a recovery reagent; and, In step II, the library amplification further comprises a purification step.
8. The construction method of claim 7, wherein, It meets one or more of the following conditions: In step I, the molar ratio of the fusion protein to the linker combination in i) is 1:1; In step I, the antibody in ii) is an H3K27ac antibody; the solvent is Buffer 1; In step I, the ratio of the antibody to the fusion protein of the assembly linker in ii) is 1:25 μg / μM; In step I, ii) further comprises a step of incubating the mixture, 4 °C for 4-12 h; In step I, the ratio of antibody to single cells in the mixture described in iii) is 1 pg : 1 x 10 5 cells; In step II, the single-cell microdroplets are destroyed using recovery reagent 1% PFO; and, In step II, after the library amplification, further comprises a step of purification using 0.5*XP magnetic beads.
9. The construction method of claim 6, wherein, In (1) of step I, iii) comprises the following processing steps: 1) After mixing the mixture with single cells, incubate at low temperature for 2-4 hours; 2) Centrifuge at 300 g at low temperature, and wash with Buffer 2; 3) After adding Buffer 3 and treating at low temperature, add an equal volume of EDTA and place at low temperature; 4) Centrifuge at 300 g at low temperature, resuspend with buffer 2, and add 1× DAPI staining.
10. The construction of claim 9, wherein, It meets one or more of the following conditions: In processing step 2), centrifuge for 3 min, and / or wash twice with Buffer 2; In processing step 3), Buffer 3 is treated at low temperature for 1-2 h, and / or placed at low temperature for 10 min; In processing step 4), centrifuge for 3 min; and, The low temperature is 0-10 °C.
11. The construction method of claim 10, wherein, The low temperature is 4 °C.
12. A construction according to any one of claims 5 to 11, wherein, The single cells are isolated from uncrosslinked or fixed cultured cell lines or tissue cells, or crosslinked or fixed cultured cell lines or tissue cells.
13. The construction of claim 12, wherein, The uncrosslinked or fixed cultured cell lines or tissue cells are fresh tissue samples, and the crosslinked or fixed cell lines or tissue cells are formaldehyde-fixed cell lines or tissue cells; when the single cells are isolated from formaldehyde-fixed cell lines or tissue cells, the step of adding protease K treatment is further included after removing the microsphere particles.
14. A method of sequencing a sample, comprising: It uses the single-cell ChIP-seq library obtained by the construction method of any one of claims 5-13 for sequencing.
15. The fusion protein of claim 1 or the kit of any one of claims 2-4 for use in the construction of a single-cell ChIP-seq library based on microfluidic technology.
Citation Information
Patent Citations
Fusion protein and preparation method thereof
CN104804100A
Fusion protein used for single-cell ChIP-seq library preparation and application thereof
CN110372799A
Coded gel particles and preparation method and application thereof
CN111172257A
Modified transposases for improved insertion sequence bias and increased DNA input tolerance
CN113005108A
Oligonucleotide replacement for di-tagged and directional libraries
US20140031261A1