A cellulase-xylanase bifunctional enzyme mutant celxyn2-s343, a coding gene thereof and application thereof

Abstract

The application discloses a cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, a coding gene thereof and application of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343. The amino acid sequence of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 is shown as SEQ ID No. 3, is obtained by mutating a cysteine at the 343th position of a cellulase-xylanase bifunctional enzyme with an amino acid sequence of SEQ ID No. 1 into serine, and the mutant has good ability of hydrolyzing natural lignocellulose, and has theoretical guiding significance in improving the digestibility of feed fiber and improving animal production performance.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering, and particularly relates to a cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, a coding gene thereof and application. BACKGROUND

[0002] A large amount of crop residues such as rice straw, wheat straw and corn stalks are produced in China every year. These agricultural straws are mainly composed of cellulose (40%), hemicellulose (20-30%) and lignin (20-30%), and can be used as a feed source for ruminants. Cellulose is the main component of plant cell walls, and has a β-1, 4-glucosidic bond in its main chain skeleton. Cellulase can hydrolyze the β-1, 4-glucosidic bond of cellulose into soluble oligosaccharides, cellobiose and glucose. It is worth noting that the degree of enzyme attachment to the substrate will affect the efficiency of lignocellulose hydrolysis. However, the cross-linking of xylan and cellulose regions limits the attachment of cellulase. Xylanase decomposes the β-1, 4-xylosidic bond in the cellulose skeleton, which can improve the hydrolysis of cellulase on cellulose. Therefore, the combination of cellulase and xylanase can effectively hydrolyze lignocellulose.

[0003] The mixed use of cellulase and xylanase has been widely used in industrial applications such as wood bio-pulping, papermaking, textiles, agricultural waste treatment, biofuels and fruit juice processing. However, this combination has hardly been used as a feed additive in ruminants. In order to improve the utilization rate of agricultural straws by ruminants, some researchers have tried to use cellulase or xylanase separately to improve nutrient digestibility and growth performance. The addition of exogenous cellulase can improve the nutrient utilization of lambs and the growth of dairy cows, increase the total number of microorganisms and microbial protein synthesis. Through some in vitro studies, the addition of exogenous xylanase can also improve gas production, fiber degradation and rumen fermentation. It is worth noting that most of these exogenous enzymes are commercial enzymes, and their effects depend on enzyme activity and stability, animal feed type, enzyme addition time and amount.

[0004] However, the use of multiple enzymes increases economic costs, and therefore the use of bifunctional enzymes is expected to solve this problem. In general, the structure of plant lignocellulose is complex and difficult to degrade. However, ruminants rely on rumen microorganisms, which can efficiently degrade lignocellulose by secreting various cellulases and xylanases. It is well known that the feed source of buffaloes is grass, leaves and bark. Therefore, the mining of bifunctional enzymes in the genome of buffalo rumen microorganisms can provide new strain sources for the development of this enzyme, and the screening of efficient cellulase-xylanase for use as a feed enzyme preparation can improve feed conversion efficiency and increase production efficiency. SUMMARY

[0005] The application provides a cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, a coding gene and an application thereof.

[0006] In order to achieve the above-mentioned application purposes, the application adopts the following technical solutions:

[0007] The application provides a cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, and the amino acid sequence is shown as SEQ ID No. 3.

[0008] Further, the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 is obtained by mutating the cysteine at the 343th position of the cellulase-xylanase bifunctional enzyme with the amino acid sequence of SEQ ID No. 1 into serine.

[0009] Further, the primer sequence for the site-directed mutation of the cellulase-xylanase bifunctional enzyme is as follows:

[0010] S343-F: 5'TGGTACAGCGATATTAGCAGCGTGTT 3';

[0011] S343-R: 5'TGGTACAGCGATATTAGCAGCGTGTT 3'.

[0012] Further, the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 only comprises a glycoside hydrolase family 5 functional region.

[0013] The application further provides a coding gene of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, and the nucleotide sequence is shown as SEQ ID No. 4.

[0014] The application further provides a recombinant expression vector comprising the coding gene of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343.

[0015] The application further provides a recombinant strain comprising the coding gene of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343.

[0016] Further, the recombinant strain is Escherichia coli.

[0017] The application further provides the amplification primers of the coding gene of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343, and the nucleotide sequences are shown in SEQ ID No. 8 and SEQ ID No. 9 respectively.

[0018] The application further provides the use of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 in the preparation of an enzyme preparation for degrading cellulose.

[0019] Further, the cellulose is natural lignocellulose; the natural lignocellulose is rice straw, wheat straw, Chinese wildrye or sugar beet residue.

[0020] Further, in the enzyme preparation, the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 enzyme solution concentration is 0.2 mg / mL-0.8 mg / mL.

[0021] The application further provides the use of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 in the preparation of an animal feed additive.

[0022] Compared with the prior art, the application has the following advantages and beneficial technical effects:

[0023] 1. The application utilizes genomics technology to successfully screen a cellulase-xylanase bifunctional enzyme from a buffalo rumen microbial metagenome, then according to the preference of codon usage in a prokaryotic system and the GC content and secondary structure of mRNA of the cellulase-xylanase bifunctional enzyme gene, the cellulase-xylanase bifunctional enzyme gene is subjected to codon optimization, and a cellulase-xylanase bifunctional enzyme optimized gene sequence is obtained. The cellulase-xylanase bifunctional enzyme is subjected to mutation in a substrate binding pocket, and is expressed in E. coli, and a cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 is obtained, and is successfully expressed in E. coli, and the cellulase-xylanase bifunctional enzyme mutant encoded has good activity.

[0024] 2. The cellulase-xylanase bifunctional enzyme mutant of the application enriches the strain source of cellulase-xylanase bifunctional enzymes, has good natural lignocellulose degradation, and has theoretical guiding significance in improving the digestibility of feed fiber and improving animal production performance. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 It is an SDS-PAGE result graph of the cellulase-xylanase bifunctional enzyme mutant;

[0026] Figure 2Graphs of the results of routine enzymatic properties of cellulase-xylanase bifunctional enzyme mutants;

[0027] Figure 3 Graphs of the results of the release of reducing sugars by cellulase-xylanase bifunctional enzyme mutants degrading four natural substrates. DETAILED DESCRIPTION

[0028] The concept, specific structure and resulting technical effects of the present application will be described below in conjunction with the embodiments so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0029] Example 1: Obtaining cellulase-xylanase

[0030] The present application utilizes genomics technology to screen a cellulase-xylanase bifunctional enzyme CelXyn2 from the buffalo rumen microorganism metagenome, the amino acid sequence of which is shown as SEQ ID No. 1, the enzyme only has a glycoside hydrolase family 5 functional region, the nucleotide sequence of the coding gene of which is shown as SEQ ID No. 2.

[0031] The screening steps are specifically as follows:

[0032] 1) Thoroughly rinse the wheat straw with deionized water for 3 times to remove the soluble polysaccharides attached to the surface of the wheat straw;

[0033] 2) Dry the wheat straw at 65℃ for 24h, then crush it into 0.5mm in length with a crusher, and then weigh and load into individual nylon bags (2.5g / bag);

[0034] 3) Put the nylon bag into the rumen of the buffalo through the rumen fistula;

[0035] 4) After 24h, take out the nylon bag and gently wash the surface of the nylon bag with phosphate buffer (pH 7.4) to remove the rumen contents attached to the surface of the bag;

[0036] 5) Open the nylon bag and weigh about 1g of sample on a balance in a 5mL centrifuge tube, add 3mL of phosphate buffer, shake up and down for 30 seconds, centrifuge at 350rpm for 15min, remove the suspension, stand the gauze upside down for about 1min to obtain the tightly connected microorganisms;

[0037] 6) Extract the total DNA of the microorganisms and perform metagenome sequencing;

[0038] 7) After quality control using FastQC software, the components are assembled using MEGAHIT software, and contigs with a length of ≥300bp are selected as the final assembly result.

[0039] 8) ORF prediction of contigs was performed using MetaGene to obtain prokaryotic gene sequences. These sequences were further validated using the NCBI online tool ORF Finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorg.html). Genes with sequences greater than or equal to 100 bp were selected and translated into amino acid sequences.

[0040] 9) Use CD-HIT ( http: / / www.bioinformatics.org / cd-hit / Version 4.6.1) clusters the predicted gene nucleic acid sequences (with parameters of 90% identity and coverage), selects the longest gene as the representative sequence, and constructs a non-redundant gene set;

[0041] 10) Use hmmscan( http: / / hmmer.janelia.org / search / hmmscan The amino acid sequences of the non-redundant gene set were compared with the CAZy database, and the e-value threshold was set to 1e-5 to obtain the functional annotations of the carbohydrate active enzymes (CAZymes) corresponding to the genes, and gene sequences belonging to the glycoside hydrolase family 5 (GH5) were screened.

[0042] Based on the codon usage preferences of the prokaryotic system and the GC content and mRNA secondary structure of the cellulase-xylanase bifunctional enzyme gene, codon optimization was performed on the cellulase-xylanase bifunctional enzyme gene to obtain the cellulase-xylanase bifunctional enzyme gene sequence (SEQ ID No. 5).

[0043] Example 2: Obtaining the cellulase-xylanase mutant

[0044] To predict the protein domains of the cellulase-xylanase bifunctional enzyme, the substrate-binding pocket site determining the cellulase-xylanase bifunctional enzyme was identified through homology comparison. Corresponding primers were designed to mutate the amino acids at the active site. Point mutation was performed using the TransGold (Beijing) point mutation kit. The primer sequences for site-directed mutagenesis are as follows:

[0045] S343-F: 5'TGGTACAGCGATATTAGCAGCGTGTT 3' (SEQ ID No. 6);

[0046] S343-R: 5'TGGTACAGCGATATTAGCAGCGTGTT 3' (SEQ ID No. 7).

[0047] Reaction conditions: 94°C 5 min, 94°C 20 s, 56°C 20 s, 72°C 30 s, 72°C 10 min.

[0048] Reaction system: plasmid DNA 1 uL (0.5-1 ng), upstream primer 0.5 uL, downstream primer 0.5 uL, 2x SuperMix (full formula, Beijing) 25 uL, sterile water 23 uL.

[0049] A cellulase-xylanase bifunctional enzyme mutant (cysteine at position 343 mutated to serine) was obtained and named CelXyn2-S343, the amino acid sequence of which is shown in SEQ ID No. 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID No. 4.

[0050] Example 3: Study on the degradation of four natural lignocellulose substrates to release reducing sugars by cellulase-xylanase bifunctional enzyme mutants

[0051] I. Recombinant bacteria

[0052] The recombinant bacteria were constructed using pET28a(+) as the expression vector and Escherichia coli BL21(DE3) as the expression host. The steps are as follows:

[0053] 1) The linearized pET28a(+) vector was obtained by reverse PCR primers pET-F (5-tgagatccggctgctaacaaag-3) and pET-R (5-gctttgttagcagccggat-3);

[0054] 2) The linearized vector was incubated with DpnI to remove the original plasmid template;

[0055] 3) The purified CelXyn2 PCR fragment and linearized pET28a(+) vector were treated with T5 exonuclease, the mixture was transformed into Escherichia coli DH5α, and then coated on LB medium containing 50 μg / mL kanamycin;

[0056] 4) The positive clone strain was verified by colony PCR and further sequenced;

[0057] 5) The correctly sequenced plasmid was transformed into Escherichia coli BL21(DE3) cells.

[0058] The primers used to amplify the cellulase-xylanase bifunctional enzyme mutant gene are: Forward: ctggtggacagcaaatgggtATGAGAAAAAAAATTTTAGGTTCAGCCTTG (SEQ ID No. 8);

[0059] Revers:

[0060] ATCTAGACTGCAGGTCGACATTATTTTCCGCTAAGAATAGCAGGCAA (SEQ ID No. 9).

[0061] II. Purification of enzyme solution

[0062] The activated E. coli (DE3) containing the cellulase-xylanase bifunctional enzyme mutant gene was inoculated into 6 mL of LB liquid medium containing 50 ug / mL kanamycin and cultured overnight at 37°C and 200 rpm / min. Then, 6 mL of the bacterial solution was transferred into a flask containing 600 mL of LB liquid medium containing 50 ug / mL kanamycin, and the flask was shaken and cultured at 37°C and 200 rpm / min. When the OD 600 value of the liquid medium in the flask reached 0.5-0.6, IPTG was added (final concentration 0.5 mM), and the induction culture was continued at 15°C and 150 rpm / min for 24 h. The cells were collected by centrifugation at 8000 rpm / min and 4°C for 20 min, and the supernatant was removed and resuspended in a specific buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to obtain activated recombinant bacteria containing the cellulase-xylanase bifunctional enzyme mutant gene. The cell wall of the recombinant bacteria was broken, and the supernatant was collected by centrifugation at 12000 g and 4°C for 30 min. The obtained supernatant was purified by His purification using an AKTA Pure protein purification instrument through a nickel column to obtain an enzyme solution containing the cellulase-xylanase bifunctional enzyme mutant.

[0063] SDS-PAGE experiment was performed on the above enzyme solution, and the steps were as follows:

[0064] 1) Dissolve the SDS-PAGE loading buffer (5X) in a water bath at room temperature or not more than 37°C. After dissolving in the water bath, store at room temperature immediately to avoid long-term storage in the water bath;

[0065] 2) Mix the protein sample and the protein loading buffer (5X) according to the ratio of 1 micro liter of protein loading buffer (5X) per 4 micro liters of protein sample;

[0066] 3) Heat at 100°C or in a boiling water bath for 3-5 minutes to denature the protein completely;

[0067] 4) After cooling to room temperature, directly load into the sample well of the SDS-PAGE gel;

[0068] 5) Usually stop electrophoresis when the blue dye reaches near the bottom end of the gel;

[0069] 6) After the electrophoresis, take the gel and put it into the appropriate amount of coomassie brilliant blue staining solution, make sure the staining solution can fully cover the gel;

[0070] 7) Place it on a horizontal or side-to-side shaker and slowly shake it, stain it at room temperature for 1 hour or more;

[0071] 8) Pour out the staining solution. The staining solution can be recycled and reused at least 2-3 times;

[0072] 9) Add the appropriate amount of decolorizing solution, make sure the decolorizing solution can fully cover the gel;

[0073] 10) Place it on a horizontal or side-to-side shaker and slowly shake it, decolorize it at room temperature for 4-24 hours. Change the decolorizing solution 2-4 times during this period until the blue background is basically all removed and the protein band staining effect reaches the expected. Usually the protein band appears after 1-2 hours of decolorization.

[0074] The results of SDS-PAGE are shown in Figure 1 , and the cellulase-xylanase bifunctional enzyme mutant can be successfully expressed in E. coli.

[0075] As shown in Figure 2 , the cellulase-xylanase bifunctional enzyme mutant has cellulase and xylanase bifunctional effects, and has good and stable enzyme activity, and good stability at pH 4.0-7.0.

[0076] III. Degradation experiment

[0077] Four natural lignocellulose substrates (rice straw, wheat straw, grass and sugar beet residue) were used as substrates to study the cellulase-xylanase bifunctional enzyme mutant's degradation of these substrates to release reducing sugar concentration.

[0078] 1. The four substrates were thoroughly washed with deionized water three times to remove the soluble sugar adhering to the surface of the substrate, and were dried in a 55°C oven to remove the water;

[0079] 2. The rice straw, wheat straw and grass were cut to 2-3 mm, and the sugar beet residue was crushed and passed through a 50 mesh sieve;

[0080] 3. According to the proportion of 2% (w / v), the substrate was added to a 20 mL centrifuge tube, 50 uL (0.5 mg / mL) of enzyme was added to the treatment group, and an equal amount of inactivated enzyme was added to the control group, and the reaction was carried out at 45°C for 168 h, and the substrate degradation was observed.

[0081] The results of degrading natural lignocellulose substrates are shown in Figure 3As shown, the cellulase-xylanase bifunctional enzyme mutant can hydrolyze four different natural lignocellulose substrates, and the yield of reducing sugar generated by degrading sugar beet residue is higher than that of rice straw, wheat straw and grass, indicating that the difference of substrates can affect the yield of reducing sugar. Therefore, the mutant can be used for animal breeding, thereby improving the digestibility of animal feed fiber.

[0082] The above examples are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, the technical solutions recorded in the foregoing examples can still be modified or some technical features thereof can be replaced by equivalents for those of ordinary skill in the art; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.

Claims

1. The application of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 in the preparation of enzyme preparations for degrading natural lignocellulose, characterized in that, The amino acid sequence of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 is shown in SEQ ID No. 3, and the natural lignocellulose is rice straw, wheat straw, sheep grass or beet pulp.

2. The application according to claim 1, characterized in that, In the enzyme preparation, the concentration of the cellulase-xylanase bifunctional enzyme mutant CelXyn2-S343 is 0.2 mg / mL to 0.8 mg / mL.

Images