Magnaporthe grisea VAD1 gene and its application in creating disease-resistant rice

Abstract

The application relates to the field of biotechnology, in particular to application of HIGS technology for rice blast resistance, namely, to creation of a rice blast resistant transgenic rice taking a rice blast fungus lethal gene VAD1 as a target. The application discloses a use of a VAD1 gene: improving the rice blast resistance of rice; and a nucleotide sequence of the VAD1 gene is shown in SEQ ID NO:1. The application can realize cultivation of a transgenic rice variety which can resist rice blast for a long time.

Claims

1. VAD1 The uses of genes are characterized by: Improving rice resistance to rice blast by silencing the VAD1 gene of rice blast fungus using HIGS technology; The VAD1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. As described in claim 1 VAD1 The uses of genes are characterized by: To develop transgenic rice varieties that can resist rice blast disease for a long time.

3. As described in claim 1 or 2 VAD1 The uses of genes are characterized by: Two HIGS vectors, pCV-VAD1234 and pCV-VAD5678, with opposite orientations were constructed and transformed into rice CO39 to obtain transgenic rice VAD1234 and VAD5678. Using wild-type rice blast fungus strain Guy11 mycelial and spore cDNA as templates, primers VADi1-XbaI / VADi2-BamHI and VADi3-BamHI / VADi4-SacI were used to amplify cDNA containing... Xba I and BamH I, BamH Between I and Sac I restriction sites VAD1 Gene fragments were ligated into the T3 vector and then processed using restriction enzymes. Xba I / BamH I, BamH The target fragment was digested with I / Sac I enzyme and ligated into the vector p1300BAR MPG1-Trpc in sequence to obtain the vector p1300BMVADi1234. Using primers VADi5-XbaI / VADi6-XbaI and VADi7-BamHI / VADi8-SacI, respectively, amplification of cells carrying the following characteristics was performed. Xba I and Xba I, BamH I and Sac I restriction site VAD1 Gene fragments, then used with endonucleases Xba I / Xba I, BamH The target fragment was digested with I / Sac I enzyme and ligated into the vector p1300BARMPG1-GFP-Trpc in sequence to obtain the vector p1300BMVADi5678. VAD1 interference frames on p1300BMVADi1234 and p1300BMVADi5678 were digested using Xba I / Sac I double enzyme and Kpn I single enzyme, respectively, and then ligated into vector pCV to obtain VAD1-HIGS vectors pCV-VAD1234 and pCV-VAD5678 with pCV as the vector backbone. VADi1-XbaI:TCTAGATTCTTGGCAAGAAGTTCGACTCGG VADi2-BamHI:GGATCCGAGGCAGGATTCGAGAAGCCTTCA VADi3-BamHI: GGATCCGCCGACGTGTTAGCAGACCAACTC VADi4-SacI:GAGCTCGGTGATCTTCTTGGCAAG VADi5-XbaI:TCTAGACACCCATCCAGGAGGAGAGCATCC VADi6-XbaI:TCTAGAGATTGGTTGATCTGCAATTTGGAG VADi7-BamH:GGATCCTTCGTGGAATTGCAGAAGATGATG VADi8-SacI: GAGCTCCCGTCGCCCTCACCGGACGCGACA.

4. The lethal gene of rice blast fungus VAD1 The method for constructing transgenic rice resistant to rice blast, with the following characteristics: This includes transforming rice cells with a gene containing the nucleotide sequence shown in SEQ ID No: 1, and then cultivating the transformed rice cells into plants; Specifically: The VAD1 gene, with a nucleotide sequence as shown in SEQ ID NO: 1, was amplified by PCR. The HIGS expression vectors pCV-VAD1234 and pCV-VAD5678 as described in claim 3 were constructed. These vectors were then introduced into rice using Agrobacterium-mediated transformation to obtain transgenic rice materials.

5. The rice blast fungus lethal gene as described in claim 4 VAD1 The method for constructing transgenic rice resistant to rice blast, with the following characteristics: The transgenic positive strains showed resistance to rice blast.

6. The rice blast fungus lethal gene as described in claim 4 VAD1 The method for constructing transgenic rice resistant to rice blast, with the following characteristics: The expression of interfering fragments in transgenic rice significantly inhibited the expression of pathogen target genes, thereby inhibiting the spread of pathogens in leaf cells and reducing the severity of disease.

Images