Primer probe set, kit and application thereof for dual RT-RAP detection of norovirus and rotavirus

Abstract

The present invention provides primer probe sets, kits, and applications for dual RT-RAP detection of norovirus and rotavirus, belonging to the field of molecular biology detection technology. The primer probe sets include a primer probe set for norovirus detection and a primer probe set for rotavirus detection. The primer probe set for norovirus detection includes GII-RAA-F, GII-RAA-R, GII-F, GII-R, and GII-P; and the primer probe set for rotavirus detection includes RV-RAA-F, RV-RAA-R, RV-F, RV-R, and RV-P. The primer probe sets of the present invention can simultaneously and rapidly detect norovirus GII type and rotavirus group A, with higher sensitivity than conventional qPCR, significantly shortened reaction time, and good specificity.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological detection, and in particular relates to a primer probe set, a kit and applications thereof for dual RT-RAP detection of norovirus and rotavirus. Background Art

[0002] Norovirus (NOV) is a common cause of acute gastrointestinal illness worldwide, accounting for approximately one-fifth of acute gastroenteritis cases worldwide each year. Noroviruses from genotype II are responsible for the majority of diarrheal outbreaks. Human rotavirus (HRV) is the most common cause of severe gastroenteritis in infants and children under five years of age worldwide, with rotavirus group A accounting for over 90% of all cases. Rapid detection and early diagnosis of these two diarrheal viruses, along with timely and effective measures, are crucial for reducing the incidence of dehydration and acidosis, and even mortality, caused by diarrhea in patients.

[0003] Currently, antigen detection kits (such as enzyme-linked immunosorbent assay, colloidal gold assay, and immunochromatographic assay) are commonly used for the detection of norovirus and rotavirus. However, these methods have high false-positive rates and low detection rates, making them unsuitable as optimal screening methods. The commonly used quantitative PCR (qPCR) method, with its high specificity and sensitivity, is the preferred biological method for detecting norovirus and rotavirus.

[0004] However, there are currently no reports on the simultaneous high-sensitivity detection of norovirus and rotavirus. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a primer probe set, a kit and its application for dual RT-RAP detection of norovirus and rotavirus, which can achieve high-sensitivity detection of norovirus GII type and rotavirus group A simultaneously.

[0006] The present invention provides a primer probe set for dual RT-RAP detection of norovirus and rotavirus, including a primer probe set for norovirus detection and a primer probe set for rotavirus detection;

[0007] Therefore, the primer-probe set for norovirus detection includes: GII-RAA-F, GII-RAA-R, GII-F, GII-R, and GII-P;

[0008] The nucleotide sequences of GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively;

[0009] The primer probe set for rotavirus detection includes: RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P;

[0010] The RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P are shown in SEQ ID NO. 6 to SEQ ID NO. 10, respectively;

[0011] The GII-P and RV-P are respectively labeled with different fluorescent groups.

[0012] Preferably, the fluorescent group includes FAM, HEX, ROX, TET, JOE, CY3, CY5, TAMRA or VIC.

[0013] The present invention also provides a kit for dual RT-RAP detection of norovirus and rotavirus, comprising the primer probe set described in the above scheme, RT-RAA reaction reagents and qPCR reaction reagents.

[0014] Preferably, the kit further comprises n-docosane.

[0015] Preferably, the reagents for the qPCR reaction include nuclease-free water, buffer, Taq hot start enzyme and dNTP; the reagents for the RT-RAA reaction include reaction buffer, magnesium acetate and double-distilled water.

[0016] The present invention also provides the use of the primer probe set for RT-RAP detection or the kit described in the above scheme in the simultaneous detection of norovirus and rotavirus for non-diagnostic purposes.

[0017] The present invention also provides a method for simultaneous detection of norovirus and rotavirus for non-diagnostic purposes, comprising the following steps:

[0018] 1) Extracting nucleic acid from the sample to be tested;

[0019] 2) using the nucleic acid as a template and the primer-probe set described in the above scheme, sequentially performing RT-PCR amplification and qPCR amplification, and collecting the fluorescent signal;

[0020] 3) If the amplification curve corresponding to norovirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains norovirus. If the amplification curve corresponding to norovirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain norovirus. If the amplification curve corresponding to rotavirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains rotavirus. If the amplification curve corresponding to rotavirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain rotavirus.

[0021] Preferably, the reaction system of the RT-RAA amplification comprises a 280 mM magnesium acetate aqueous solution, a template and an RT-RAA reaction mixture; the volume ratio of the magnesium acetate aqueous solution, the template and the RT-RAA reaction mixture is 0.5:1:9;

[0022] The RT-RAA reaction mixture, calculated as 40 μl, includes the following components: 25 μl of reaction buffer, 11 μl of nuclease-free water, 1 μl of GII-RAA-F, 1 μl of GII-RAA-R, 1 μl of RV-RAA-F, and 1 μl of RV-RAA-R;

[0023] The reaction procedure of the RT-RAA amplification includes 39-42° C., 10-12 min;

[0024] The qPCR amplification reaction system was 40 μl and included the following components: Buffer 12.5 μl, nuclease-free water 21.7 μl, Taq hot start enzyme 0.5 μl, dNTP 0.6 μl, MgCl2 1.2 μl, GII-F 0.5 μl, GII-R 0.5 μl, GII-P 0.5 μl, RV-F 0.5 μl, RV-R 0.5 μl, and RV-P 0.5 μl;

[0025] The reaction program of the qPCR amplification includes: 95°C, 3 min; 95°C, 15 s, 55°C, 30 s, 72°C, 30 s, 30 cycles.

[0026] Preferably, the amplification system of RT-RAA amplification and qPCR amplification uses n-docosane for spacing, which includes: adding molten n-docosane to the amplification system of qPCR amplification and letting it stand, the n-docosane floating on the amplification system of qPCR amplification, and after the n-docosane solidifies, adding the amplification system of RT-RAA amplification on the solidified n-docosane.

[0027] Preferably, the RT-RAA amplification and qPCR amplification are performed in a tube with a cap; adding the amplification system for RT-RAA amplification to solidified n-dodecane includes adding the amplification system for RT-RAA amplification except magnesium acetate to solidified n-dodecane, adding magnesium acetate to the cap, and using magnesium acetate to initiate the RT-RAA reaction.

[0028] The present invention provides a primer probe set for dual RT-RAP detection of norovirus and rotavirus, comprising a primer probe set for norovirus detection and a primer probe set for rotavirus detection; the primer probe set for norovirus detection comprises: GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P; the primer probe set for rotavirus detection comprises: RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P; the present invention can utilize GII-RAA-F, GII-RAA-R, RV-RAA-F and RV-RAA-R to achieve dual RT-RAA amplification of norovirus GII type and rotavirus group A, and can utilize GII-F, GII-R, GII-P, RV-F, RV-R and RV-P to achieve dual qPCR amplification of norovirus GII type and rotavirus group A. The primer probe set of the present invention can simultaneously and rapidly detect norovirus GII type and rotavirus group A, has higher sensitivity than conventional qPCR, greatly shortens the reaction time, and has good specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of RAP principle;

[0030] Figure 2 Schematic diagram of the RT-RAP detection principle;

[0031] Figure 3 This is the sensitivity graph of single-plex NOV-GII RT-RAP (Reverse transcription recombinase aided PCR);

[0032] Figure 4 is the NOV-GII qPCR sensitivity graph;

[0033] Figure 5 is the sensitivity map of single RVART-RAP;

[0034] Figure 6 is the single-plex RVAqPCR sensitivity graph;

[0035] Figure 7 Double RAP sensitivity. DETAILED DESCRIPTION

[0036] The present invention provides a primer probe set for dual RT-RAP detection of norovirus and rotavirus, comprising a primer probe set for norovirus detection and a primer probe set for rotavirus detection; the primer probe set for norovirus detection comprises: GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P; the nucleotide sequences of GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P are shown as SEQ ID NO.1 to SEQ ID NO.5, respectively; the primer probe set for rotavirus detection comprises: RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P; the RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P are shown as SEQ ID NO.6 to SEQ ID NO.10, respectively; and the GII-P and RV-P are labeled with different fluorescent groups, respectively.

[0037] In the present invention, the fluorescent group preferably includes FAM, HEX, ROX, TET, JOE, CY3, CY5, TAMRA or VIC, more preferably FAM or HEX.

[0038] In the present invention, the norovirus is preferably norovirus type GII (NOV-GII); the rotavirus is preferably rotavirus group A.

[0039] In the present invention, the nucleotide sequence of the GII-RAA-F is shown in SEQ ID NO.1, specifically: TTTACGTGCCCAGRCAAGARCCAATGTTCA; the nucleotide sequence of the GII-RAA-R is shown in SEQ ID NO.2, specifically: GTCACTCGACGCCATCTTCATTCACAAAAC; the nucleotide sequence of the GII-F is shown in SEQ ID NO.3, specifically: CARGARBCNATGTTYAGRTGGATGAG; the nucleotide sequence of the GII-R is shown in SEQ ID NO.4, specifically: TCGACGCCATCTTCATTCACA; the nucleotide sequence of the GII-P is shown in SEQ ID NO.5, specifically: TGGGAGGGCGATCGCAATCT; the nucleotide sequence of the RV-RAA-F is shown in SEQ ID NO.6, specifically: TATTAACCATCTWCACRTRACCCTCTATGA; the nucleotide sequence of the RV-RAA-R is shown in SEQ ID NO.7, specifically: GGTCACATAACGCCCCTATAGCCATTTAGG; the nucleotide sequence of the RV-F is shown in SEQ ID NO.8, specifically: ACCATCTWCACRTRACCCTC; the nucleotide sequence of the RV-R is shown in SEQ ID NO.9, specifically: GGTCACATAACGCCCCTATA; the nucleotide sequence of the RV-P is shown in SEQ ID NO.10, specifically: ATGAGCACAATAGTTAAAAGCTAACACTGTCAA.

[0040] In the present invention, the primers used for RAA amplification are based on existing qPCR primers and are extended to between 30 and 35 bp according to the design principles of RAA primers; the qPCR probe is a TaqMan probe.

[0041] In the present invention, the concentration of each primer or probe in the primer-probe set is preferably 10 μmol / L.

[0042] The present invention also provides a kit for dual RT-RAP detection of norovirus and rotavirus, comprising the primer probe set described in the above scheme, RT-RAA reaction reagents and qPCR reaction reagents.

[0043] In the present invention, the kit preferably also includes n-docosane. N-Docosane is a white crystal with a melting point of 44°C. It is solid at room temperature and has a density of 0.7944 g / mL. It can be disassembled with temperature changes and will not affect the nucleic acid amplification reaction. Since the temperatures required for RT-RAA and qPCR reactions are different, the present invention uses n-docosane to separate the two reaction systems of RT-RAA and qPCR. The present invention achieves rapid, accurate and highly sensitive detection of norovirus GII type and rotavirus group A in a single-tube closed-tube two-stage one-step by adding n-docosane as a special material to separate the two systems.

[0044] In the present invention, the qPCR reaction reagents preferably include nuclease-free water, buffer, Taq hot start enzyme and dNTP; the RT-RAA reaction reagents include reaction buffer, magnesium acetate and double-distilled water.

[0045] The present invention also provides the use of the primer probe set for RT-RAP detection or the kit described in the above scheme in the simultaneous detection of norovirus and rotavirus for non-diagnostic purposes.

[0046] The present invention also provides a method for simultaneous detection of norovirus and rotavirus for non-diagnostic purposes, comprising the following steps:

[0047] 1) Extracting nucleic acid from the sample to be tested;

[0048] 2) using the nucleic acid as a template and the primer-probe set described in the above scheme, sequentially performing RT-PCR amplification and qPCR amplification, and collecting the fluorescent signal;

[0049] 3) If the amplification curve corresponding to norovirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains norovirus. If the amplification curve corresponding to norovirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain norovirus. If the amplification curve corresponding to rotavirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains rotavirus. If the amplification curve corresponding to rotavirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain rotavirus.

[0050] The present invention first extracts nucleic acid from the sample to be tested. The present invention does not particularly limit the method for extracting nucleic acid from the sample to be tested. In the present invention, the sample to be tested is preferably feces. In the specific implementation of the present invention, nucleic acid from the sample to be tested is preferably extracted using a Qiagen feces nucleic acid extraction kit.

[0051] The nucleic acid of the sample to be tested is obtained. The present invention uses the nucleic acid as a template and the primer probe set described in the above scheme to sequentially perform RT-RAA amplification and qPCR amplification, and collect the fluorescent signal.

[0052] In the present invention, the reaction system for RT-RAA amplification includes a 280 mM magnesium acetate aqueous solution, a template, and an RT-RAA reaction mixture; the volume ratio of the magnesium acetate aqueous solution, the template, and the RT-RAA reaction mixture is 0.5:1:9, and the RT-RAA reaction mixture, measured in 40 μl, preferably includes the following components: 25 μl of reaction buffer, 11 μl of nuclease-free water, 1 μl of GII-RAA-F, 1 μl of GII-RAA-R, 1 μl of RV-RAA-F, and 1 μl of RV-RAA-R; the amount of RT-RAA reaction mixture used for a single RT-RAA reaction is preferably 9 μl; the reaction procedure for the RT-RAA amplification preferably includes 39-42° C. and 10-12 min. In the present invention, the reaction buffer uses Tris buffer as a solvent, and preferably includes the following components in the following concentrations: Tris buffer 45mM, potassium acetate 80mM, dithiothreitol 4mM, polyethylene glycol with a mass volume concentration of 7.28%, ATP 5mM, dNTPs 0.24mM, creatine phosphate 30μg / U, single-stranded binding protein 500ng / μL, recombinase 400ng / μL, UvsY protein 70ng / μL, DNA polymerase 90ng / μL and nuclease exonuclease 85ng / μL.

[0053] In the present invention, the reaction system for qPCR amplification is calculated in 40 μl, and preferably includes the following components: 12.5 μl of buffer, 22.2 μl of nuclease-free water, 0.5 μl of Taq hot start enzyme, 0.6 μl of dNTP, 1.2 μl of MgCl2, 0.5 μl of GII-F, 0.5 μl of GII-R, 0.5 μl of GII-P, 0.5 μl of RV-F, 0.5 μl of RV-R, and 0.5 μl of RV-P; the reaction program for the qPCR amplification preferably includes: 95°C, 3 min; 95°C, 15 s, 55°C, 30 s, and 72°C, 30 s, for 30 cycles.

[0054] In the present invention, the amplification system for RT-RAA amplification and qPCR amplification using n-docosane for separation preferably includes: adding molten n-docosane to the amplification system for qPCR amplification and allowing the n-docosane to stand, so that the n-docosane floats on the amplification system for qPCR amplification; after the n-docosane solidifies, adding the amplification system for RT-RAA amplification to the solidified n-docosane. In the present invention, the standing temperature preferably includes: 60°C for 1 minute, and 4°C for 30 seconds.

[0055] In the present invention, the RT-RAA amplification and qPCR amplification are preferably performed in a tube with a lid; adding the amplification system for RT-RAA amplification to solidified n-dodecane preferably includes adding the amplification system for RT-RAA amplification other than magnesium acetate to solidified n-dodecane, adding magnesium acetate to the lid, and using magnesium acetate to initiate the RT-RAA reaction.

[0056] In one embodiment of the present invention, the amplification system for qPCR amplification is divided into eight tube strips. After adding liquid n-docosane, it is rapidly cooled and solidified at room temperature, floating on the PCR system. After treatment at 60°C for 1 minute and at 4°C for 30 seconds, the n-docosane is remelted and evenly solidified on the PCR system. The amplification system for RT-RAA amplification is divided into the upper layer of the solidified n-docosane, allowing the RT-RAA reaction to occur in the same tube first. Subsequently, in the second stage, the recombinase is inactivated by heating to 95°C, and the n-docosane melts and floats to the top layer. The large amount of target product from the RT-RAA reaction in the first stage is then mixed with the qPCR system for the next PCR reaction and detection. In the first stage, the template can be enriched in a large amount in a short time (within 12 minutes), and then the second stage qPCR is performed. The entire amplification process can be completed in less than 60 minutes, achieving rapid amplification. This method has ultra-high sensitivity, reaching a single copy per reaction, which is superior to traditional qPCR. The primer probe set of the present invention also has the advantage of high specificity.

[0057] After collecting the fluorescence signal, if the amplification curve corresponding to norovirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains norovirus; if the amplification curve corresponding to norovirus does not peak or there is no obvious S-shaped amplification, it is determined that the sample to be tested does not contain norovirus; if the amplification curve corresponding to rotavirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains rotavirus; if the amplification curve corresponding to rotavirus does not peak or there is no obvious S-shaped amplification, it is determined that the sample to be tested does not contain rotavirus.

[0058] Unless otherwise specified, the present invention has no special requirements on the sources of the raw materials used, and commercially available products known to those skilled in the art can be used.

[0059] The technical solutions of the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention.

[0060] Example 1 Detection of Norovirus GII and Rotavirus Group A

[0061] 1. Sample source and nucleic acid extraction:

[0062] A total of 120 stool samples from Hebei Children's Hospital and 15 stool samples from Hebei Provincial People's Hospital from August 2021 to March 2022 were collected, as well as 26 norovirus GII type positive nucleic acids and 50 rotavirus A positive nucleic acids retained in this laboratory.

[0063] The collected fecal samples were used to extract nucleic acids using the Qiagen fecal nucleic acid extraction kit and stored at −80°C until use.

[0064] A total of 135 stool samples were tested in parallel for nucleic acid using the Zhuocheng Huisheng Norovirus GII Type Nucleic Acid Detection Kit and the Shuoshi Rotavirus Group A Nucleic Acid Detection Kit (fluorescence PCR method).

[0065] 2. Perform RT-RAP detection using the primers and probes for norovirus GII and rotavirus group A in Table 1.

[0066] The RAA kit used was the basic RT-RAA amplification kit from Jiangsu Qitian Co., Ltd., the PCR kit used was the Entrans qPCR Probe Set V2 kit from ABclonal, and the amplification instrument used was the Kunpeng Archimed X6 fluorescent quantitative PCR instrument. The amplification system was configured according to Table 3. The qPCR system was aliquoted into eight tube strips, 25 μl of n-docosane was added, and the tubes were placed in a LongGene A300 (60°C for 1 minute, 4°C for 30 seconds) to ensure that the n-docosane was evenly suspended on the surface of the qPCR system. The RT-RAA reaction system was configured according to Table 2. 40 μl of the reaction system was added to each RT-RAA (basic method) reaction tube to dissolve the dry powder. The tubes were mixed twice in a Qitian B6100 mixer. 8 μl of the RT-RAA system was aliquoted onto the solidified n-docosane, and 1 μl of the sample nucleic acid was added. 0.5 μl of magnesium acetate was added to the caps of the eight tube strips and the tubes were sealed. Centrifuge briefly in an Eastwin handheld centrifuge to allow the magnesium acetate to fall into the RT-RAA system, initiating the RT-RAA reaction. Place the sample in a PCR instrument and follow the reaction schedule according to Table 4.

[0067] Table 1. Primer and probe information

[0068]

[0069]

[0070] 1. Probe modification: FAM, 6-carboxyfluorescein; 2. BHQ, black hole quencher;

[0071] 3. Probe modification: HEX, 6-carboxyfluorescein; 4. BHQ, black hole quencher; (BHQ is added to the internal T residue to reduce the distance between the fluorescent molecule and the quencher.)

[0072] Degenerate bases: R or R a =A or G, B b =G or C or T, N c =A or G or C or T, W d =A or T, Y=C or T.

[0073] Table 2. RT-RAA (basic method) kit reaction system

[0074] Components Dosage (μL) Reaction buffer 25 Double distilled water 11 F 2 R 2 Total 40

[0075] Table 3. qPCR kit reaction system

[0076]

[0077]

[0078] Table 4. Reaction procedure

[0079]

[0080] Example 2 Establishment of Diarrhea Virus Dual RT-RAP

[0081] Prepare the RT-RAA reaction system and qPCR reaction system according to Table 5. After the qPCR system was dispensed into eight tube strips, 25 μl of n-docosane was added. The tubes were placed in a LongGene A300 fast gradient PCR instrument (60°C for 1 min, 4°C for 30 s) to allow the n-docosane to float evenly on the qPCR system. Dissolve the dry powder in each RT-RAA (basic method) reaction tube by adding 40 μl of the reaction system. Mix the tubes twice in a Qitian B6100 mixer. Dispense 8 μl of the RT-RAA system onto the solidified n-docosane and add 2 μl of the template. Add 0.5 μl of magnesium acetate to the caps of the eight tube strips and seal the caps. Centrifuge briefly in an Eastwin handheld centrifuge to allow the magnesium acetate to fall into the RT-RAA system, initiating the RT-RAA reaction. Place the tubes in the PCR instrument and proceed with the reaction according to Table 6.

[0082] Table 5: Dual RT-RAP reaction system

[0083]

[0084]

[0085] Table 6 Reaction procedure

[0086]

[0087] Example 3 Sensitivity evaluation of the kit of the present invention

[0088] Table 7 Positive plasmid sequences

[0089]

[0090]

[0091] The target gene sequence was synthesized using pUC57 as a vector to synthesize the Norovirus GII type positive plasmid DNA and the Rotavirus A type positive plasmid DNA containing the target gene (synthesized by Beijing Qingke Biological Co., Ltd.). The positive plasmid was diluted in a 10-fold continuous concentration gradient, with a concentration range of 10 0 ~10 5 RAP experiments were performed using positive plasmid DNA at various concentrations as templates (reverse transcription is required when the amplification template is RNA). The RAA reaction system used a basic RAA amplification kit. The system was configured according to Tables 2 and 3, with a final RAA primer concentration of 0.4 μM / L. Figure 3 and Figure 4 is the analytical sensitivity (LOD) of the RAP method and conventional qPCR method for detecting norovirus GII type, where Figure 3 is the RAP sensitivity map; Figure 4 This is the sensitivity diagram of qPCR. Figure 3 and Figure 4 As shown in the figure, the sensitivity of RAP for detecting norovirus GII type is 10 0 copies / reaction, the sensitivity of conventional qPCR method is 10 2 Copy / React. Figure 5 and Figure 6 is the analytical sensitivity (LOD) of the RAP method and conventional qPCR method for detecting rotavirus group A, where Figure 5 is the RAP sensitivity map; Figure 6 This is the sensitivity diagram of qPCR. Figure 5 and Figure 6 As shown, the sensitivity of RAP for detecting rotavirus group A is 10 0 copies / reaction, the sensitivity of conventional qPCR method is 10 2 Copy / React.

[0092] Double RT-RAP sensitivity evaluation: The positive plasmid was diluted in 10-fold continuous concentration gradient, with a concentration range of 10 0 ~10 5Copies / μL, using different concentrations of positive plasmid DNA as template. Prepare the reaction system according to Table 5 and conduct the RAP experiment. Use the basic RAA amplification kit for the RAA reaction system. Prepare the system according to Tables 2 and 3, using the basic RAA amplification kit for the isothermal amplification stage. Figure 7 This is a dual RAP positive plasmid sensitivity amplification signal diagram, where the FAM channel fluorescence signal is used to detect norovirus GII type, and the HEX fluorescence channel is used to detect rotavirus group A. Figure 7 As shown, the sensitivity of double RAP for detecting norovirus GII is 10 2 Copies / reaction, the sensitivity of detecting rotavirus A is 10 1 Copy / React.

[0093] Example 4 Specificity evaluation of the kit of the present invention

[0094] Samples of eight diarrhea-related pathogens were collected, including norovirus GI, astrovirus, calicivirus, enteroadenovirus, bocavirus, zaruvirus, Salmonella, and enterotoxigenic Escherichia coli. The RT-RAP method established in Example 1 was used for parallel identification. The results are shown in Table 8:

[0095] Table 8

[0096]

[0097] N or N a Indicates a negative result.

[0098] The test results showed that the single-plex RT-RAP established in Example 1 for detecting norovirus GII and rotavirus group A, respectively, could only specifically detect norovirus GII and rotavirus group A, and did not cross-react with other pathogens.

[0099] The RT-RAP for dual simultaneous detection of norovirus GII and rotavirus group A established in Example 2 can only specifically detect norovirus GII and rotavirus group A, and does not cross-react with other pathogens.

[0100] The results of the above examples show that the kit prepared from the primer-probe combination provided by the present invention can quickly detect norovirus GII type and / or rotavirus group A with higher sensitivity than conventional qPCR, greatly shortened reaction time and good specificity.

[0101] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention rather than all the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for simultaneous detection of norovirus and rotavirus for non-diagnostic purposes, comprising the following steps: 1) Extracting nucleic acid from the sample to be tested; 2) using the nucleic acid as a template, sequentially performing RT-RAA amplification and qPCR amplification using a primer probe set, and collecting fluorescent signals; 3) If the amplification curve corresponding to norovirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains norovirus. If the amplification curve corresponding to norovirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain norovirus. If the amplification curve corresponding to rotavirus peaks and shows S-shaped amplification, it is determined that the sample to be tested contains rotavirus. If the amplification curve corresponding to rotavirus does not peak or has no obvious S-shaped amplification, it is determined that the sample to be tested does not contain rotavirus. The primer probe set includes a primer probe set for norovirus detection and a primer probe set for rotavirus detection; The primer probe set for norovirus detection includes: GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P; The nucleotide sequences of GII-RAA-F, GII-RAA-R, GII-F, GII-R and GII-P are shown in SEQ ID NO.1 to SEQ ID NO.5, respectively; The primer probe set for rotavirus detection includes: RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P; The RV-RAA-F, RV-RAA-R, RV-F, RV-R and RV-P are shown in SEQ ID NO. 6 to SEQ ID NO. 10, respectively; The GII-P and RV-P are respectively labeled with different fluorescent groups; The RT-RAA amplification reaction system includes a 280 mM magnesium acetate aqueous solution, a template, and an RT-RAA reaction mixture; the volume ratio of the magnesium acetate aqueous solution, the template, and the RT-RAA reaction mixture is 0.5:1:9; The RT-RAA reaction mixture, in 40 μL, includes the following components: 25 μL of reaction buffer, 11 μL of nuclease-free water, 1 μL of GII-RAA-F, 1 μL of GII-RAA-R, 1 μL of RV-RAA-F, and 1 μL of RV-RAA-R; The reaction procedure of the RT-RAA amplification is: 39-42°C, 10-12 min; The qPCR amplification reaction system, in 40 μL, included the following components: Buffer 12.5 μL, nuclease-free water 22.2 μL, Taq hot start enzyme 0.5 μL, dNTP 0.6 μL, MgCl2 1.2 μL, GII-F 0.5 μL, GII-R 0.5 μL, GII-P 0.5 μL, RV-F 0.5 μL, RV-R 0.5 μL, and RV-P 0.5 μL; The reaction program of the qPCR amplification was as follows: 95°C, 3 min; 95°C, 15 s, 55°C, 30 s, 72°C, 30 s, 30 cycles; The amplification systems of RT-RAA amplification and qPCR amplification are separated by n-docosane, specifically: molten n-docosane is added to the amplification system of qPCR amplification and allowed to stand, the n-docosane floats on the amplification system of qPCR amplification, and after the n-docosane solidifies, the amplification system of RT-RAA amplification is added to the solidified n-docosane; The RT-RAA amplification and qPCR amplification are performed in a tube with a cap; the RT-RAA amplification system excluding magnesium acetate is added to solidified n-dodecane, magnesium acetate is added to the cap, and the RT-RAA reaction is initiated using magnesium acetate.

2. The method according to claim 1, characterized in that The fluorescent group is selected from FAM, HEX, ROX, TET, JOE, CY3, CY5, TAMRA or VIC.

Images