Construction method of virus vector TRVeΔ for co-expressing three non-fused foreign proteins CP
The TRVeΔCP vector addresses the challenge of simultaneous expression of multiple proteins in plants by deleting specific TRV genes and using subgenomic promoters, achieving rapid and high-level expression of three proteins without structural instability or host impact.
Patent Information
- Application Number
- CN202211022069.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-25
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2042-08-25
AI Technical Summary
Existing viral vectors are difficult to express multiple non-fusion exogenous proteins quickly and efficiently in plants at the same time, and there are problems such as unstable viral genome structure and negative impact on host plants.
The vector TRVeΔCP of tobacco fragile virus TRV was constructed using the gene deletion strategy. By deleting the CP, 2b and 2c genes in TRV genomic RNA2, and inserting multiple cloning sites at its subgenomic promoter position, the plant protein translation system was used to express three non-fusion exogenous proteins.
The rapid and high content of three non-fusion exogenous proteins are achieved in plants at the same time. The viral vectors systematically expand in host plants without affecting the structural integrity of the viral genome, avoiding negative symptoms to host plants.
Smart Images

Figure CN115948453B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, and specifically includes a construction method for simultaneously and rapidly expressing three non-fused foreign proteins in the whole plant based on tobacco rattle virus (TRV). Background Art
[0002] With the completion of a large number of plant genome sequencing, there is an urgent need for a good vector or technology to rapidly analyze new genes in the genome or predict the biological functions of proteins. Currently, to study genes or proteins with unknown functions, it is mainly through transgenic technology to express target proteins in plants to confirm their functions. However, due to constraints such as cumbersome transgenic operations, long cycles, and species limitations, currently, using plant virus expression vectors to characterize the biological functions of proteins has increasingly become a trend and played an extremely important role in the research of plant functional genomics.
[0003] High virus replication / translation efficiency produces a large amount of viral proteins in plants, and the small genome is easy to manipulate. A large number of plant viruses have been used as sources for constructing foreign protein expression vectors. Potato virus X (PVX) and tobacco mosaic virus (TMV) are the most commonly used viral expression vectors at present. Their construction strategy is to insert the subgenomic promoter (SGP) of the coat protein (CP) of the same virus or different members of the same genus of virus into the viral genome to drive the transcription of the mRNA of the foreign gene, and use the viral subgenomic translation strategy to express the target protein. However, PVX and TMV vectors can only express a single non-fused foreign protein in the whole plant. Currently, more and more basic and applied plant biology research, such as the functional identification of complexes composed of multiple proteins, the production of drug antibodies or polypeptides, requires the simultaneous overexpression of multiple genes in the same single cell, and neither TMV nor PVX expression vectors can meet this requirement. A binary expression vector constructed by inserting two CP SGPs into the genomes of PVX and TRV can express two non-fused foreign proteins simultaneously in plants. Due to sequence redundancy caused by multiple additional SGPs, it is very easy to cause instability of the viral genome structure, and the foreign inserted genes are gradually lost in plants over time. Therefore, these two viral vectors cannot stably express two foreign proteins in plants for a long time. The genome of beet necrotic yellow vein virus (BNYV) consists of 5 RNA molecules. A vector that simultaneously expresses 4 foreign proteins is constructed by using the strategy of protease cleavage of viral fusion proteins. However, this viral vector can only express foreign proteins in the inoculated leaves of plants, cannot move systemically, and there are still amino acid residues of protease at one end of the foreign target protein. Based on the polyprotein hydrolysis translation strategy of the genus Potyvirus, a single polyprotein translated from an open reading frame (ORF) is hydrolyzed into multiple viral functional proteins. Expression vectors constructed by inserting foreign genes between P1 / HC-Pro, HC-Pro / NIb, and NIb / CP of potato virus A (PVA), soybean mosaic virus (SMV), turnip mosaic virus (TuMV), etc. can express multiple foreign proteins simultaneously in the whole host plant. However, these recombinant viruses have many deficiencies, such as unexpected negative effects on the symptom development of host plants after carrying foreign genes, the insertion of foreign sequences disrupting the structural integrity of the viral genome, and the fusion co-translational processing having unexpected effects on the intrinsic activity and / or subcellular localization of the target protein.Currently, multiple expression vectors for constructing multiple foreign proteins based on negative-strand RNA viruses have been reported, which can simultaneously produce multiple non-fused foreign proteins in the whole host plant. However, these expression systems have certain disadvantages. For example, the expression of heterologous proteins requires a long time, the large viral genome is not conducive to genetic manipulation, and the virus inoculation process is complex, etc. At present, there is no good viral vector at home and abroad that can rapidly express 3 non-fused foreign proteins simultaneously in the whole plant.
[0004] TRV is a typical member of the genus Tobravirus, with a wide host range and can infect more than 400 plant species, including model plants Arabidopsis thaliana, Nicotiana benthamiana, and important crops such as tomato and cotton. TRV is a positive single-stranded RNA (+single strand RNA, +ssRNA) virus, and its genome consists of RNA1 and RNA2 molecules. The 4 proteins encoded by RNA1 are involved in virus replication, movement, and symptom production; RNA2 encodes CP, 2b of 27 kDa, and 2c of 18 kDa proteins through the subgenomic strategy. Even when the 2b and 2c genes in TRV are completely deleted, the virus can still replicate and systemically move in plants. Currently, TRV is applied to construct virus-induced gene silencing (VIGS) vectors, expression vectors for 2 foreign proteins, and guide RNAs for transcriptional gene editing.
[0005] The invention "Method for constructing a vector for simultaneously expressing two foreign proteins using Tobacco rattle virus" (application number 202110836772.9) previously applied by the inventor's team informed that: the Agrobacterium tumefaciens-infectious clone pYL156 based on TRV genomic RNA2 was used to construct a vector pTRV2e containing the 2b and 2c SGP of TRV through a gene deletion strategy 3 , and a recombinant virus TRVe that simultaneously expresses 2 non-fused foreign proteins in the whole Nicotiana benthamiana was obtained through the 2 SGP of TRV itself 3 . Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a viral vector TRVeΔ for rapidly expressing 3 non-fused foreign proteins simultaneously in the whole plant CP and its construction method.
[0007] To solve the above technical problem, the present invention provides a construction method for a viral vector TRVeΔ that simultaneously expresses 3 non-fused foreign proteins CP (construction method for a vector pTRV2eΔ that simultaneously expresses 3 non-fused foreign proteins CP ): In the vector pTRV2e that simultaneously expresses 2 non-fused foreign proteins 3Based on this, a gene deletion strategy was adopted to construct vectors pTRV2eΔ containing the CP, 2b, and 2c SGP of TRV CP .
[0008] That is, in the present invention, the 3 SGPs of the TRV genomic RNA2 are used to respectively generate the mRNAs of the exogenous inserted proteins, and the protein translation system of the host plant is utilized to rapidly and highly express the 3 target proteins. The size of the genomic RNA2 in pTRV2eΔ CP is 1496 bp, and the sequence is as described in SEQ ID NO: 1
[0009] The method for constructing the vector pTRV2eΔ for co-expressing 3 non-fused exogenous proteins of the present invention CP is as follows
[0010] Using plasmid pTRV2e 3 , in the vector pTRV2e 3 , the ORF sequence of the CP gene in the TRV genomic RNA2 was deleted, and a multiple cloning site was inserted to obtain the vector pTRV2eΔ containing multiple cloning sites (multiple clone site, MCS) 1, 2, and 3 CP .
[0011] That is, using the recombinant plasmid pTRV2e 3 , in pTRV2e 3 , the ORF sequence of the CP gene of TRV is missing, and restriction enzyme sites are introduced to obtain the vector pTRV2eΔ containing cloning sites downstream of CP, 2b, and 2c SGP CP .
[0012] The present invention also simultaneously provides the preparation of recombinant TRV for expressing green fluorescent protein (GFP) in whole tomato plants through CP, 2b, and 2c SGP, and the virus TRVeΔ CP -CP-GapC-GFP that can co-express the coat protein (CP) of TMV, glyceraldehyde-3-phosphate dehydrogenase (GapC) of Arabidopsis thaliana, and GFP, including the following steps CP 1), GFP was respectively amplified by PCR using 3 pairs of primers containing different restriction enzyme sites, the target products were respectively recovered by gel cutting, and cloned into the plasmid pTRV2eΔ
[0013] through corresponding double enzyme digestion to obtain 3 vectors pTRV2eΔ CP , 3 vectors pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, and pTRV2eΔ CP -MCS1-MCS2-GFP
[0014] 2) PCR amplify the ORF of the CP of TMV, double digest and ligate it into plasmid pTRV2eΔ CP to obtain pTRV2eΔ CP -CP-MCS2-MCS3;
[0015] 3) PCR amplify Arabidopsis GapC, double digest and clone it into plasmid pTRV2eΔ CP to obtain vector pTRV2eΔ CP -MCS1-GapC-MCS3;
[0016] 4) Clone the double-digested PCR product of TMV CP obtained in step 2) into the vector pTRV2eΔ CP -MCS1-MCS2-GFP; to obtain plasmid pTRV2eΔ CP -CP-MCS2-GFP;
[0017] Ligate the double-digested PCR product of GapC obtained in step 3) into the vector pTRV2eΔ CP -CP-MCS2-GFP to obtain vector pTRV2eΔ CP -CP-GapC-GFP;
[0018] 5) Transform the pTRV2eΔ CP -CP-GapC-GFP obtained in step 4) into Agrobacterium tumefaciens GV3101, and mix it with Agrobacterium pTRV1 to obtain virus TRVeΔ CP -CP-GapC-GFP.
[0019] Note:
[0020] In the above step 5), the present invention transforms pTRV2eΔ CP , pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, pTRV2eΔ CP -MCS1-MCS2-GFP, pTRV2eΔ CP -CP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GapC-MCS3 and pTRV2eΔ CP -CP-GapC-GFP into Agrobacterium tumefaciens GV3101 respectively, and mix them with Agrobacterium pTRV1 at a ratio of 1:1, and then infiltrate and inoculate two cotyledons of tomato respectively;
[0021] In virus TRVeΔ CP-GFP-MCS2-MCS3, TRVeΔ CP -MCS1-GFP-MCS3 and TRVeΔ CP -MCS1-MCS2-GFP infiltration inoculation of the upper systemic leaves of tomatoes can observe the green fluorescence phenotype, and GFP can be specifically detected by protein hybridization.
[0022] Virus TRVeΔ CP -CP-GapC-GFP-infected upper systemic leaves of tomatoes can observe the green fluorescence phenotype, and CP, GapC, and GFP can be detected simultaneously by protein hybridization.
[0023] That is, the Agrobacterium transformation of the pTRV2-related vector was set, and each was mixed with Agrobacterium pTRV1 and infiltrated and inoculated into tomatoes; the recombinant virus TRVeΔ lacking CP was recorded CP Infection activity in tomatoes, recombinant virus TRVeΔ CP The molecular detection results of the expression of GFP by each SGP in TRVeΔ, and the simultaneous expression of non-fused CP, GapC, and GFP in the host systemic leaves.
[0024] In the present invention:
[0025] Extract total protein from the systemic leaves of plants infected with TRVeΔ CP -CP-GapC-GFP for Western blot analysis, and CP, GapC, and GFP can be specifically detected simultaneously in virus-infected tomatoes.
[0026] The present invention also simultaneously provides the use of the exogenous protein expression vector TRVeΔ constructed by the above method: TRVeΔ CP : TRVeΔ CP Causes a mild mosaic symptom reaction in host plants, and TRVeΔ carrying 3 foreign genes CP -CP-RFP-GFP simultaneously expresses CP, GapC, and GFP in the whole plant;
[0027] The said TRVeΔ CP Consists of pTRV1 and pTRV2eΔ CP ;
[0028] The said TRVeΔ CP -GFP-MCS2-MCS3 consists of pTRV1 and pTRV2eΔ CP -GFP-MCS2-MCS3;
[0029] The said TRVeΔ CP -MCS1-GFP-MCS3 consists of pTRV1 and pTRV2eΔ CP- Composed of -MCS1-GFP-MCS3;
[0030] The said TRVeΔ CP -MCS1-MCS2-GFP is composed of pTRV1 and pTRV2eΔ CP -MCS1-MCS2-GFP;
[0031] The said TRVeΔ CP -CP-MCS2-MCS3 is composed of pTRV1 and pTRV2eΔ CP -CP-MCS2-MCS3;
[0032] The said TRVeΔ CP -MCS1-GapC-MCS3 is composed of pTRV1 and pTRV2eΔ CP -MCS1-GapC-MCS3;
[0033] The said TRVeΔ CP -CP-GapC-GFP is composed of pTRV1 and pTRV2eΔ CP -CP-GapC-GFP.
[0034] The present invention uses the vector pTRV2e in the patent with the application number 202110836772.9 3 as the material, constructs the vector pTRV2eΔ containing CP, 2b and 2c SGP by deleting the ORF of the CP gene CP ; After the recombinant virus TRVeΔ CP is inoculated into the host plant, different non-fused foreign proteins are systematically expressed through 3 subgenomic promoters respectively.
[0035] The present invention uses the plasmid pTRV2e 3 as the material, adopts the gene deletion strategy to construct the vector pTRV2eΔ containing the CP, 2b and 2c subgenomic promoters of TRV CP ; 3 different foreign genes are respectively inserted downstream of each SGP of the vector pTRV2eΔ CP and the virus vector TRVeΔ that simultaneously expresses 3 non-fused proteins in the whole tomato plant is constructed CP .
[0036] The present invention uses the vectors pYL156, Ppk20, pTRV2e 1 and TRV2e 2The TRV genomic RNA2 was used as a control, and the detailed information can be found at https: / / www.ncbi.nlm.nih.gov / nuccore / AF406991, https: / / www.ncbi.nlm.nih.gov / nuccore / Z36974 and the patent with the application number 202110836772.9 respectively.
[0037] The CP, 2b, and 2c encoded by the TRV genomic RNA2 are translated from 3 viral subgenomic RNA molecules. Even though 2b and 2c are deleted from RNA2, the virus can still systemically infect many host plants. In the present invention, the ORF of CP in the vector pTRV2e 3 was deleted, and a multiple cloning site was introduced to obtain the plasmid pTRV2eΔ CP . In the vector pTRV2eΔ CP , the ORFs of CP, 2b, and CP in the TRV genomic RNA2 were completely deleted, and only the respective subgenomic promoters were retained. After the recombinant virus TRVeΔ CP infected the plant, 4 RNA molecules were generated after the replication of genomic RNA2, namely genomic RNA2, the subgenomic RNA generated by the CP SGP, the subgenomic RNA generated by the 2b SGP, and the 2c SGP subgenomic RNA. In the present invention, the 3 SGPs in the RNA2 of the virus TRVeΔ CP were used to generate the mRNA of the foreign protein, and the plant protein translation system was utilized to express 3 target non-fused proteins.
[0038] The technical solution of the present invention is as follows:
[0039] 1. In the pTRV2e 3 vector, the ORF of CP was deleted, and a multiple cloning site was introduced to obtain the pTRV2eΔ CP vector;
[0040] Note: The preparation methods of pTRV2e 1 and pTRV2e 3 are clearly described in the patent 202110836772.9.
[0041] 2. After the plasmid pTRV2eΔ CP was transferred into Agrobacterium tumefaciens GV3101, it was mixed with Agrobacterium pTRV1 in a ratio of 1:1 and co-infiltrated and inoculated into 2 cotyledon-stage tomatoes. TRVeΔ CP did not cause obvious symptoms in the host plant; using TRV, TRVe 1 , and TRVe 3 as controls, the phenotypic changes of the host plant after inoculation were observed.
[0042] 3. Insert GFP into the MCS1, MCS2, and MCS3 sites in the vector pTRV2eΔ CP to obtain the vectors pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, and pTRV2eΔ CP -MCS1-MCS2-GFP.
[0043] 4. Construct the vectors pTRV2eΔ CP -CP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GapC-MCS3, and pTRV2eΔ CP -CP-GapC-GFP, where CP is the TMV coat protein gene and GapC is the Arabidopsis glyceraldehyde-3-phosphate dehydrogenase gene.
[0044] 5. Agrobacterium transformation of the pTRV2-related plasmids, and co-infiltration with TRV1 into tomatoes respectively; 10 days after inoculation, observe and record the symptom responses, GFP fluorescence phenotypes of tomatoes, and RNA hybridization detection of the viral genomes. The results show that: the recombinant virus TRVeΔ CP systemically infects tomatoes, and CP, 2b, and 2c SGP can all drive the expression of GFP in the whole tomato plant.
[0045] 6. Extraction of total tomato proteins, protein electrophoresis, membrane transfer, and hybridization detection. For the expression of foreign proteins in plants by the recombinant virus TRVeΔ CP , protein hybridization shows that: TRVeΔ CP vector can simultaneously express CP, GapC, and GFP in the whole tomato plant.
[0046] The present invention constructs a viral vector TRVeΔ CP that can simultaneously and rapidly express three non-fused foreign proteins in the whole tomato plant based on TRV. CP In the genomic RNA2 of the recombinant virus TRVeΔ CP , the ORFs of CP, 2b, and 2c are completely deleted, and three SGP cis-acting element sequences are retained. The deleted regions are replaced with different foreign genes without affecting its structural integrity. The technical advantages are: based on the characteristics of high virus reproduction efficiency and systemic movement ability, TRVeΔ
[0047] can rapidly and highly express three non-fused foreign proteins in the whole host plant.
[0048] The present invention discloses a construction method of a viral vector TRVeΔ that utilizes three SGP in the genomic RNA2 of TRV to drive the simultaneous expression of three exogenous genes in the whole plant. CP TRVeΔ CP does not produce obvious symptom reactions in tomatoes. TRVeΔ carrying three exogenous genes CP systemically infects the host plant and simultaneously expresses the target protein. The present invention constructs a plant viral vector TRVeΔ that can simultaneously and rapidly express three non-fused proteins with high content in the whole host plant for the first time by using the strategies of deletion replacement and viral subgenomic translation. CP .
[0049] The present invention has the following beneficial effects: 1) The present invention adopts a construction strategy of deletion replacement of a plant viral expression vector; the ORFs of the CP, 2b, and 2c genes in the genomic RNA2 of TRV are completely deleted and replaced with three exogenous genes, thus not affecting the structural integrity of the viral genome; 2) TRVeΔ CP does not cause obvious symptoms in tomatoes, can systemically expand to the whole plant after carrying three exogenous genes, and has the characteristics of high expression level and fast expression time of expressing exogenous proteins in the host plant. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] The following further describes the specific embodiments of the present invention in detail with reference to the drawings.
[0051] Figure 1 is a schematic diagram of the structure of the genomic RNA2 of TRV in the pTRV2-related vector;
[0052] Figure 2 is a comparative diagram of the symptom reactions caused by infiltration inoculation of tomatoes with TRV, TRVe 1 , TRVe 3 and TRVeΔ CP for 10 days;
[0053] Figure 3 is a Northern blot photograph of the genomic RNA2 of TRV, TRVe 1 , TRVe 3 and TRVeΔ CP ; in
[0054] Figure 3 , rRNA is 28s RNA, which is used to determine the loading amount of total RNA;
[0055] Figure 4 is a schematic diagram of the expression of GFP driven by each SGP of TRVeΔ CP ;
[0056] Figure 5At 10 days post infiltration inoculation, using TRVeΔ CP Fluorescence photographs of tomato plants after expressing GFP with CP, 2b, and 2c SGP respectively in CP ;
[0057] Figure 6 At 10 days post infiltration inoculation, protein hybridization was used to detect TRVeΔ CP Photographs of GFP expression driven by each SGP;
[0058] Figure 6 In , Rubisco is the large subunit of ribulose bisphosphate carboxylase oxygenase (Ribulose bisphosphate carboxylase oxygenase, Rubisco), which is used to determine the loading amount of total plant protein;
[0059] Figure 7 For the recombinant virus TRVeΔ CP Schematic diagram of the vector for co-expressing CP, GapC, and GFP in host plants;
[0060] Figure 8 For Western blot detection of TRVeΔ CP Photographs of co-expressing CP, GapC, and GFP in whole tomatoes;
[0061] Figure 8 In , Rubisco is the large subunit of ribulose bisphosphate carboxylase oxygenase (Ribulose bisphosphate carboxylase oxygenase, Rubisco), which is used to determine the loading amount of total plant protein. Detailed implementation methods
[0062] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:
[0063] Example 1, pTRV2eΔ CP Vector construction
[0064] Using plasmid pTRV2e 3 as the material, the preparation method of which is clearly described in Patent 202110836772.9. By PCR, the CP of RNA2 in plasmid pTRV2e 3 was deleted to obtain pTRV2eΔ CP vector.
[0065] Using plasmid pTRV2e 3Using [template] as a template, f1 was obtained by PCR amplification with primer pair P1 / P2, and f2 was obtained by PCR amplification with primer pair P3 / P4. The two PCR amplification fragments were recovered by gel cutting, and the vector pTRV2e was double digested with HindⅢ / XbaⅠ 3 and gel cut. According to the product instruction manual, PCR products 1, 2 and HindⅢ / XbaⅠ-digested pTRV2e 3 vector were ligated together by Ultra One Step Cloning Kit (Vazyme) and transformed into Escherichia coli to obtain the vector pTRV2eΔ CP .
[0066] The reaction system for PCR amplification fragment 1 was: 8 μL of 5×Q5 reaction buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL each of P1 / P2 (10 μmol / L), 10 ng of pTRV2e 3 template, 0.4 μL of Q5 polymerase (1 U / μL), and made up to 40 μL with ddH2O; The PCR reaction program was: 98℃ for 3 min, 98℃ for 10 s, 58℃ for 45 s, 72℃ for 45 s, 35 cycles, 72℃ for 5 min.
[0067] The reaction system for PCR amplification fragment 2 was: 8 μL of 5×Q5 reaction buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL each of P3 / P4 (10 μmol / L), 10 ng of pTRV2e 3 template, 0.4 μL of Q5 polymerase (1 U / μL), and made up to 40 μL with ddH2O; The PCR reaction program was: 98℃ for 3 min, 98℃ for 10 s, 60℃ for 45 s, 72℃ for 10 s, 35 cycles, 72℃ for 5 min.
[0068] Primer P1: TTGGGCCCGGCGCGCCAAGCTTG
[0069] Primer P2: TGATTGATCGTACAAATCTCCCTTGTTGATTAGCGCAAGTGATTCAGTAAC
[0070] Primer P3:
[0071] GATAGGTACGATGAATCA actagtCTCGAGgagctc GGTCCGATACGTCCTAATCCCTAG
[0072] The underlined parts in primer P3 are the restriction sites of SpeⅠ, Xho I and SacⅠ in turn;
[0073] Primer P4: TAACGCGTGAATTCTCTAGAAAGC;
[0074] pTRV2eΔ CP Vectors pYL156 and pTRV2e involved in the preparation process 1 and pTRV2e 3 It is clearly stated in Patent 202110836772.9 that the schematic diagram of the TRV genomic RNA2 structure in the obtained pTRV2eΔ CP and related vectors can be seen in Figure 1 .
[0075] Example 2. Construction of related vectors of pTRV2eΔ for expressing foreign proteins CP Related vector construction
[0076] 2.1 Construction of vectors expressing GFP with CP, 2b, and 2c SGP respectively
[0077] GFP was amplified by PCR with 3 pairs of primers containing different restriction sites. The target fragments were recovered by gel cutting and cloned into vector pTRV2eΔ CP respectively through SpeⅠ / SacⅠ, XbaⅠ / MluⅠ, and BamHⅠ / SmaⅠ to obtain vectors pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, and pTRV2eΔ CP -MCS1-MCS2-GFP (see vector schematic Figure 4 ). The size of GFP is 717bp, and the sequence is as shown in SEQ ID NO:2.
[0078] The reaction system for PCR amplification of GFP is: 8 μL of 5×Q5 reaction buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL each of primer pairs P5 / P6, P7 / P8, or P9 / P10 (10 μmol / L), 10 ng of GFP template, 0.4 μL of Q5 polymerase (1 U / μL), and made up to 40 μL with ddH2O; The PCR reaction program is: 3 min at 98°C, 10 s at 98°C, 25 s at 58°C, 30 s at 72°C, 35 cycles, and 5 min at 72°C.
[0079] The primers corresponding to vector pTRV2eΔ CP -GFP-MCS2-MCS3 are:
[0080] Primer P5: GactagtATGAGTAAAGGAGAAGAACTTTTCACTG
[0081] Primer P6: GCgagctcCTATTTGTATAGTTCATCCATGCCAT;
[0082] pTRV2eΔ CP Primers corresponding to -MCS1-GFP-MCS3:
[0083] Primer P7: GCtctagaATGAGTAAAGGAGAAGAACTTTTCACTG
[0084] Primer P8: CGacgcgtCTATTTGTATAGTTCATCCATGCCAT
[0085] pTRV2eΔ CP Primers corresponding to -MCS1-MCS2-GFP:
[0086] Primer P9: CGggatccATGAGTAAAGGAGAAGAACTTTTCACTG
[0087] Primer P10: TCCcccgggCTATTTGTATAGTTCATCCATGCCAT
[0088] The lowercase letters in the above primers represent restriction enzyme sites, and the same applies hereinafter.
[0089] 2.2 Construction of vectors for co-expressing three foreign proteins
[0090] Construct the vector pTRV2eΔ for the cloned expression of the CP of TMV driven by CP SGP CP -CP-MCS2-MCS3, the vector pTRV2eΔ for the expression of glyceraldehyde-3-phosphate dehydrogenase gene (GapC) driven by 2b SGP CP -MCS1-GapC-MCS3 and the vector pTRV2eΔ for co-expressing three foreign proteins CP -CP-GapC-GFP, see the vector schematic diagram in Figure 7 .
[0091] 2.2.1 Vector pTRV2eΔ CP Construction of the -CP-MCS2-MCS3 vector
[0092] The CP of TMV is 480 bp in size, and the sequence is as shown in SEQ ID NO:3.
[0093] The PCR amplification reaction system for the CP of TMV is as follows: 8 μL of 5×Q5 reaction buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL each of primer pair P11 / 12 (10 μmol / L), 10 ng of the CP template of TMV, 0.4 μL of Q5 polymerase (1 U / μL), and made up to 40 μL with ddH2O; The PCR reaction program is: 98 °C for 3 min, 98 °C for 10 s, 60 °C for 15 s, 72 °C for 30 s, 35 cycles, and 72 °C for 5 min. The PCR product is recovered by gel cutting and cloned into the vector pTRV2eΔ CP , to obtain the vector pTRV2eΔ CP -CP-MCS2-MCS3.
[0094] Primer P11: GactagtATGCCTTATACAATCAACTCTCCGAG;
[0095] Primer P12: GCgagctcCTAAGTAGCCGGAGTTGTGGTCC.
[0096] 2.2.2 Construction of the vector pTRV2eΔ CP -MCS2-GapC-MCS3
[0097] The sequence size of the glyceraldehyde-3-phosphate dehydrogenase gene (GapC) of Arabidopsis thaliana is 1017 bp, and the sequence is as shown in SEQ ID NO:4.
[0098] The PCR amplification reaction system for GapC of Arabidopsis thaliana is as follows: 8 μL of 5×Q5 reaction buffer, 3.2 μL of dNTP (2.5 mmol / L), 2 μL each of primer pair P13 / 14 (10 μmol / L), 10 ng of the GapC template of Arabidopsis thaliana, 0.4 μL of Q5 polymerase (1 U / μL), and made up to 40 μL with ddH2O; The PCR reaction program is: 98 °C for 3 min, 98 °C for 10 s, 56 °C for 30 s, 72 °C for 30 s, 35 cycles, and 72 °C for 5 min. The PCR product is recovered by gel cutting and cloned into the vector pTRV2eΔ CP , to obtain the vector pTRV2eΔ CP -MCS1-GapC-MCS3.
[0099] Primer P13: GCtctagaATGGCTGACAAGAAGATCAGAATC
[0100] Primer P14: cgACGCGT ctaagcgtaatctggaacatcgtatgggta"GGCCTTTGACATGTGAACG",
[0101] The underlined part in primer P14 is the HA tag sequence.
[0102] 2.2.3 pTRV2eΔ CP -CP-GapC-GFP vector construction
[0103] The PCR product of TMV CP digested with SpeⅠ / SacⅠ obtained in 2.2.1 was ligated to the plasmid pTRV2eΔ CP -MCS1-MCS2-GFP obtained to get the vector pTRV2eΔ CP -CP-MCS2-GFP;
[0104] The PCR product of Arabidopsis thaliana GapC digested with XbaⅠ / MluⅠ in 2.2.2 was cloned into pTRV2eΔ CP -CP-MCS2-GFP to obtain pTRV2eΔ CP -CP-GapC-GFP vector.
[0105] Example 3, Agrobacterium transformation and culture of pTRV2-related vectors
[0106] Plasmid pTRV2eΔ CP 、pTRV2eΔ CP -GFP-MCS2-MCS3、pTRV2eΔ CP -MCS1-GFP-MCS3、pTRV2eΔ CP -MCS1-MCS2-GFP、pTRV2eΔ CP -CP-MCS2-MCS3、pTRV2eΔ CP -MCS1-GapC-MCS3 and pTRV2eΔ CP -CP-GapC-GFP were transformed into Agrobacterium tumefaciens GV3101 to obtain Agrobacterium pTRV2eΔ CP 、pTRV2eΔ CP -GFP-MCS2-MCS3、pTRV2eΔ CP -MCS1-GFP-MCS3、pTRV2eΔ CP -MCS1-MCS2-GFP、pTRV2eΔ CP -CP-MCS2-MCS3、pTRV2eΔ CP -MCS1-GapC-MCS3 and pTRV2eΔ CP -CP-GapC-GFP. Among them, Agrobacterium pTRV1, pYL156, pTRV2e 1and pTRV2e 3 For the specific methods of its activation, subculture, and cell collection, please refer to the invention patent 201810261990.2. All overnight subcultured Agrobacterium cultures were centrifuged at 5000 r / min for 5 min to collect cells; the cells were resuspended in 5 mL of infiltration inoculation buffer (10 mmol / L MgCl2, 10 mmol / L MES, and 200 mmol / L acetosyringone), centrifuged at 5000 r / min for 5 min, and the supernatant was discarded; finally, the cell concentration of each was adjusted to OD 600 to 0.2. Therefore, the final products obtained in this Example 3 were Agrobacterium pTRV2eΔ CP , pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, pTRV2eΔ CP -MCS1-MCS2-GFP, pTRV2eΔ CP -CP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GapC-MCS3, and pTRV2eΔ CP -CP-GapC-GFP.
[0107] Example 4. Agrobacterium infiltration inoculation
[0108] 5 mL of the Agrobacterium suspensions of pYL156, pTRV2e 600 with an OD of 0.2 obtained in Example 3, pTRV2e 1 , pTRV2e 3 , pTRV2eΔ CP , pTRV2eΔ CP -GFP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GFP-MCS3, pTRV2eΔ CP -MCS1-MCS2-GFP, pTRV2eΔ CP -CP-MCS2-MCS3, pTRV2eΔ CP -MCS1-GapC-MCS3, and pTRV2eΔ CP -CP-GapC-GFP were each mixed with 5 mL of Agrobacterium pTRV1 with a concentration of 0.2 OD 600 ; the Agrobacterium mixture was pre-treated at room temperature in the dark for 4 h, and the back of the leaves of 2 cotyledon tomatoes was infiltrated with a 1 mL sterile syringe without a needle. All inoculated plants were cultured in a plant growth chamber at 25 °C with a 16 h light period and 8 h dark period.
[0109] Among them,
[0110] The Agrobacterium mixture of pTRV1 and pYL156 is virus TRV,
[0111] The Agrobacterium mixture of pTRV1 and pTRV2e 1 is virus TRVe 1 ,
[0112] The Agrobacterium mixture of pTRV1 and pTRV2e 3 is TRVe 3 ,
[0113] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP is virus TRVeΔ CP ,
[0114] The naming of other viruses follows this analogy; that is:
[0115] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -GFP-MCS2-MCS3 is TRVeΔ CP -GFP-MCS2-MCS3;
[0116] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -MCS1-GFP-MCS3 is TRVeΔ CP -MCS1-GFP-MCS3;
[0117] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -MCS1-MCS2-GFP is TRVeΔ CP -MCS1-MCS2-GFP;
[0118] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -CP-MCS2-MCS3 is TRVeΔ CP -CP-MCS2-MCS3;
[0119] The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -MCS1-GapC-MCS3 is TRVeΔ CP -MCS1-GapC-MCS3; The Agrobacterium mixture of pTRV1 and pTRV2eΔ CP -CP-GapC-GFP is TRVeΔ CP -CP-GapC-GFP.
[0120] Example 5, Symptom Response of Recombinant TRV in Tomato
[0121] Viruses TRV, TRVe 1 , TRVe 3 and TRVeΔ CP were infiltrated and inoculated into the cotyledons of tomato at the two-cotyledon stage respectively, and the infiltration buffer was used as the control Mock; the symptom responses of the host plants after 10 days were as follows: in TRVe 1 , TRVe 3 and TRVeΔ CP induced a mild mosaic phenotype, while TRV induced necrotic symptoms in the systemic leaves at the top of tomato (see Figure 2 ), and the recombinant virus TRVeΔ CP constructed in the present invention did not cause obvious symptoms in tomato, which was beneficial to its efficient expression of foreign target proteins in plants.
[0122] Example 6, Northern blot detection of TRV genomic RNA in the host
[0123] At 10 days after infiltration inoculation with Agrobacterium, 0.1 g of the upper systemic leaves of tomato infected with viruses TRV, TRVe 1 , TRVe 3 and TRVeΔ CP were taken, and the total plant RNA was extracted with Trizol, and the method was referred to the Trizol product instruction manual. The method of transferring and hybridizing the TRV genome was referred to the product instruction manual of the digoxigenin labeling detection kit II (Roche, Switzerland). The hybridization probe was a section of nucleotides complementary to the 3'-end of RNA2 (5'-CTTCAGACACGGATCTACTTAAAGAACCGTAGTTTAATGTCTTCGGGAC-DIG-3'), which was synthesized by Shanghai Bioengineering Co., Ltd.
[0124] The results of RNA hybridization detection showed that:
[0125] The viral genomic RNA could not be detected in the host plants inoculated with the control Mock, and the viral genomic RNA could be detected in the systemic leaves of plants infected with TRV, TRVe 1 , TRVe 3 and TRVeΔ CP , and there was no obvious difference in the content of the four viral genomes; in the plants infected with TRV and TRVe 1 , three RNA molecules (genomic RNA2, CP subgenomic RNA and 2b subgenomic RNA) were produced, and after TRVe 3 and TRVeΔ CP infected the host plants, genomic RNA2, CP subgenomic RNA, 2b subgenomic RNA and 2c subgenomic RNA were produced (see Figure 3 ). The above results confirmed that TRVeΔCP It can systematically infect tomatoes and produce three subgenomic RNA molecules.
[0126] Example 7. TRVeΔ in tomatoes CP Observation of the fluorescence phenotypes presented by the expression of GFP driven by each SGP
[0127] TRVeΔ CP -GFP-MCS2-MCS3, TRVeΔ CP -MCS1-GFP-MCS3 and TRVeΔ CP -MCS1-MCS2-GFP were inoculated into tomatoes for 10 days. The fluorescence phenotypes in the systemic leaves of each virus-inoculated plant were observed in a darkroom using a long-wave portable ultraviolet lamp (Black Ray model B 100AP / R, Upland, USA). The results are as Figure 5 shown. Figure 5 It was shown that the three GFP-carrying ones in TRVeΔ CP produced green fluorescence phenotypes in tomatoes, while no GFP phenotypes were observed in the plants inoculated with the control TRVeΔ CP and Mock. The above results indicate that the CP, 2b, and 2c SGPs in the virus TRVeΔ CP can all drive the expression of GFP.
[0128] Example 8. Western blot analysis of TRVeΔ CP Expression of foreign proteins in hosts
[0129] 10 days after inoculation by agroinfiltration, 0.1 g of the systemic leaves of tomatoes inoculated with the viruses TRVeΔ CP , TRVeΔ CP -GFP-MCS2-MCS3, TRVeΔ CP -MCS1-GFP-MCS3, TRVeΔ CP -MCS1-MCS2-GFP, TRVeΔ CP -CP-MCS2-MCS3, TRVeΔ CP -MCS1-GapC-MCS3 and TRVeΔ CP -CP-GapC-GFP were taken, ground into powder in liquid nitrogen, added with PBS buffer containing 2% β-mercaptoethanol and ground into a homogeneous liquid. After centrifugation, the supernatant was taken and 2×loading buffer was added. It was boiled in a 95℃ water bath for 10 min, centrifuged at 10000 r / min for 5 min, and the supernatant was taken for use. The methods of protein transfer membrane, antibody hybridization, and substrate color development refer to the Compendium of Molecular Biology Experiments (Third Edition). The antibodies used were polyclonal antibodies specific for GFP, TMV CP, and HA tags.
[0130] In TRVeΔ CP ,TRVeΔ CP -GFP-MCS2-MCS3, TRVeΔ CP -MCS1-GFP-MCS3,TRVeΔ CP -MCS1-MCS2-GFP infected host plant systemic leaf samples, GFP antibody can specifically detect the target band, while the control inoculated TRVeΔ CP No GFP signal was detected in tomato (see Figure 6 ), further indicating that CP, 2b and 2c SGP can all drive GFP expression throughout the host.
[0131] In order to determine the recombinant virus TRVeΔ CP Can three foreign proteins be expressed simultaneously in tomato? CP -CP-MCS2-MCS3, TRVeΔ CP -MCS1-GapC-MCS3, TRVeΔ CP -MCS1-MCS2-GFP and TRVeΔ CP -CP-GapC-GFP was inoculated into tomatoes for 10 days, and the total protein of each virus-infected system leaf was extracted for Western blot detection. Figure 8 shown. Figure 8 Display: TRVeΔ CP -CP-GapC-GFP infected tomato systemic leaves can simultaneously detect CP, GapC and GFP, TRVeΔ carrying a single exogenous gene CP Only one target protein was detected after infection, indicating that the recombinant virus TRVeΔ CP Three non-fusion foreign proteins can be expressed rapidly and simultaneously in the host plant.
[0132] It should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.
Claims
1. Construction method of virus vector pTRVeΔ that simultaneously expresses three non-fused foreign proteins CP , characterized by: Using the vector pTRV2e that can simultaneously express two non-fused foreign proteins 3 as the material, a gene deletion strategy was adopted to construct a subgenomic promoter vector pTRV2eΔ CP , 2b and 2c containing TRV CP ; pTRV2eΔ CP The size of genomic RNA2 is 1496 bp, and the sequence is as described in SEQ ID NO: 1; Using the recombinant plasmid pTRV2e 3 , the ORF sequence of the gene of TRV is missing in the pTRV2e 3 vector, and restriction enzyme sites are introduced to obtain CP the vector pTRV2eΔ that contains cloning sites downstream of CP , 2b and 2c SGP. CP .
2. Use the vector pTRV2eΔ as described in claim 1 CP to prepare a virus TRVeΔ that can simultaneously express the tobacco mosaic virus (TMV) CP protein, Arabidopsis glyceraldehyde-3-phosphate dehydrogenase GapC, and GFP CP -[[-END]] CP -[[-END]] GapC -[[-END]] GFP The method is characterized in that comprising the following steps: 1), PCR amplifies three pairs of primers containing different restriction enzyme sites, and the PCR amplification GFP , and the PCR products are respectively cloned into the vector pTRV2eΔ CP after double digestion with different enzymes, to obtain pTRV2eΔ CP - GFP -MCS2-MCS3, pTRV2eΔ CP -MCS1- GFP -MCS3 and pTRV2eΔ CP -MCS1-MCS2- GFP ; 2), PCR amplify the CP ORF of, double digest and ligate it into plasmid pTRV2eΔ CP to obtain pTRV2eΔ CP - CP -MCS2-MCS3; 3), PCR amplify the Arabidopsis glyceraldehyde-3-phosphate dehydrogenase gene ( GapC ), double digest and clone it into plasmid pTRV2eΔ CP to obtain vector pTRV2eΔ CP -MCS1- GapC -MCS3; 4), Clone the double-digested PCR product obtained in step 2) into the vector pTRV2eΔ CP obtained in step 1), CP -MCS1-MCS2- GFP to obtain pTRV2eΔ CP - CP -MCS2- GFP ; Clone the double-digested PCR product obtained in step 3) GapC into the vector pTRV2eΔ CP - CP -MCS2- GFP to obtain the vector pTRV2eΔ CP - CP - GapC - GFP ; 5), Transform the product obtained in step 4), pTRV2eΔ CP - CP - GapC - GFP into Agrobacterium tumefaciens GV3101, and mix it with Agrobacterium pTRV1 to obtain virus TRVeΔ CP - CP - GapC - GFP .
3. Use of the exogenous protein viral vector pTRVeΔ constructed by the method according to claim 1 CP , characterized in that: TRVeΔ CP Induces a mild mosaic symptom response in host plants, and TRVeΔ carrying three foreign genes CP - CP -GapC- GFP Simultaneously expresses tobacco mosaic virus (TMV) CP protein, Arabidopsis glyceraldehyde-3-phosphate dehydrogenase GapC, and GFP in the whole plant.
4. The use according to claim 3, characterized in that: The TRVeΔ CP is composed of pTRV1 and pTRV2eΔ CP ; TRVeΔ CP - GFP - MCS2 - MCS3 is composed of pTRV1 and pTRV2eΔ CP - GFP - and consists of MCS2 - MCS3; TRVeΔ CP -MCS1- GFP -MCS3 consists of pTRV1 and pTRV2eΔ CP -MCS1- GFP -MCS3 is composed of; TRVeΔ CP -MCS1-MCS2- GFP Composed of pTRV1 and pTRV2eΔ CP -MCS1-MCS2- GFP Composition; TRVeΔ CP - CP - MCS2 - MCS3 is composed of pTRV1 and pTRV2eΔ CP - CP - and MCS2 - MCS3; TRVeΔ CP -MCS1- GapC - MCS3 consists of pTRV1 and pTRV2eΔ CP -MCS1- GapC - MCS3 is composed of; TRVeΔ CP - CP - GapC - GFP Composed of pTRV1 and pTRV2eΔ CP - CP - GapC - GFP Composition.
Citation Information
Patent Citations
Construction method for simultaneously expressing two foreign protein vectors TRVe2 and application
CN108486147A
Construction method of vector for simultaneously expressing two foreign proteins by using tobacco rattle virus
CN113604496A