Application of a maize ZmCP03 gene
By overexpressing the ZmCP03 gene in corn plants, the problem of insufficient drought resistance in the prior art was solved, and the drought resistance and survival rate of corn were significantly improved.
Patent Information
- Application Number
- CN202211109297.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-13
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2042-09-13
AI Technical Summary
The prior art is difficult to effectively improve the drought resistance of corn, and drought stress often leads to a decrease in corn yield.
By overexpressing the ZmCP03 gene in corn plants, the drought resistance of corn is improved by using genetic engineering technology cloning, bioinformatics analysis, vector construction and corn genetic transformation.
Through the overexpression of the ZmCP03 gene, the drought resistance of corn is significantly improved, and the survival rate and recovery ability of corn under drought stress are enhanced.
Smart Images

Figure CN115960948B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of maize drought resistance, and specifically relates to the application of a maize ZmCP03 gene. Background Art
[0002] Maize is an important food, feed, and energy crop. With the increase in population and the development of industry, the demand for maize is constantly increasing. The safety of maize production is a major national issue. Drought stress frequently occurs severely, leading to a decrease in yield. To reduce or solve this problem, it is necessary to cultivate new drought-resistant varieties. Drought stress has become one of the most important abiotic stresses affecting maize growth and development and yield. Excavating excellent drought-resistant genes and introducing drought-resistant genes into elite inbred lines through transgenic or molecular-assisted breeding can effectively improve the drought resistance of maize. Summary of the Invention
[0003] The technical problem to be solved by the present invention is to provide an application of a maize ZmCP03 gene in view of the deficiencies of the above-mentioned prior art. The maize ZmCP03 gene is overexpressed in maize plants and is used to improve the drought resistance of maize.
[0004] To solve the above technical problem, the technical solution adopted by the present invention is: an application of a maize ZmCP03 gene, wherein the maize ZmCP03 gene is overexpressed in maize plants and is used to improve the drought resistance of maize; the nucleotide sequence of the maize ZmCP03 gene is as shown in SEQ ID NO:1, and the amino acid sequence of the maize ZmCP03 gene is as shown in SEQ ID NO:2.
[0005] Preferably, the method for overexpressing the maize ZmCP03 gene in maize plants is as follows:
[0006] S1. Cloning of the ZmCP03 gene:
[0007] S101. Select the maize B73 inbred line as the experimental material, extract the RNA of maize leaf tissue at the three-leaf stage, and reverse transcribe it into cDNA;
[0008] S102. Using the cDNA obtained in S101 as a template, perform PCR amplification with primer ZmCP03-F and primer ZmCP03-R to obtain a PCR product;
[0009] The reaction system of the PCR amplification is: 1 μL of cDNA, 1 μL of KOD high-fidelity enzyme, 1 μL of primer ZmCP03-F, 1 μL of primer ZmCP03-R, 5 μL of buffer, 10 μL of dNTP mix, and make up to 50 μL with sterile water;
[0010] The reaction procedure of the PCR amplification is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 50°C for 45 s, extension at 72°C for 64 s. After 30 cycles, 0.5 μL of Taq enzyme is added and extension is carried out at 72°C for 10 min;
[0011] The nucleotide sequence of the primer ZmCP03-F is as shown in SEQ ID NO:3;
[0012] The nucleotide sequence of the primer ZmCP03-R is as shown in SEQ ID NO:4;
[0013] S103. After the PCR product obtained in S102 is subjected to gel cutting and recovery using a gel recovery kit, it is ligated to the vector pCambia3300, then transformed into Escherichia coli Trans5α competent cells, verified by double digestion with Xba I / BamH I, and 1 to 3 bacterial solutions corresponding to positive bands are screened and sequenced;
[0014] S2. Bioinformatics analysis of the ZmCP03 gene:
[0015] The sequencing result in S103 is aligned with the nucleotide sequence of the maize ZmCP03 gene using the Mega4.0 software. If the nucleotide sequences are the same, the cloning is successful, and the PCR product in S102 with successful cloning is the ZmCP03 target gene fragment;
[0016] S3. Construction of the overexpression vector of the maize ZmCP03 gene:
[0017] The vector pCambia3300 is digested with BsaI / Eco31I to obtain the large fragment of the pCambia3300 vector; the ZmCP03 target gene fragment in S3 is digested with BsaI / Eco31I to obtain the P-rDNAo1 target fragment. After verifying the fragment size by electrophoresis, the enzyme digestion electrophoresis products are recovered using an agarose gel recovery kit. Then, the large fragment of the pCambia3300 vector and the P-rDNAo1 target fragment are ligated under the action of T4 ligase at 37°C for 1 h to obtain a ligation product;
[0018] The system of the ligation reaction is as follows: 3 μL of the large fragment of the pCambia3300 vector, 5 μL of the P-rDNAo1 target fragment, 1 μL of T4 DNA ligase, 1 μL of 10×T4 DNA ligase buffer, and 1 μL of sterile water;
[0019] Transform the obtained ligated product into Escherichia coli competent cells. Spread the transformed bacterial solution on LB solid medium containing kanamycin. After culturing at 37 °C for 12 h, select positive clones for culture and perform colony PCR identification to obtain the overexpression vector of maize ZmCP03 gene, namely pCambia3300-ZmCP03 plasmid;
[0020] S4. Maize genetic transformation of ZmCP03 gene:
[0021] Use the pCambia3300-ZmCP03 plasmid obtained in S3 to transform Agrobacterium, and infect the young embryos of maize inbred line B104. Through induction culture, co-culture, screening culture, differentiation culture, rooting culture and transplanting into seedlings, obtain positive plants of ZmCP03 transgenic;
[0022] S5. Identification of positive plants of ZmCP03 transgenic: Perform ZmCP03 gene PCR detection on the positive plants of ZmCP03 transgenic obtained in S4. Amplify a band with the same size as that in the pCambia3300-ZmCP03 plasmid described in the positive control S3 at the position of 1059 bp. If the sequence alignment is correct after sequencing, it is an overexpression plant of maize ZmCP03 gene.
[0023] The present invention has the following advantages compared with the prior art:
[0024] The maize ZmCP03 gene of the present invention is overexpressed in maize plants and is used to improve the drought resistance of maize.
[0025] The following further describes the present invention in detail with reference to the drawings and embodiments. Description of the Drawings
[0026] Figure 1 It is the detection of ZmCP03 expression level in ZmCP03-OE overexpression plants of Example 3 of the present invention.
[0027] Figure 2 Drought resistance graph of ZmCP03-OE overexpression transgenic plants of Example 3 of the present invention.
[0028] Figure 3 Survival rate graph of ZmCP03-OE overexpression transgenic plants of Example 3 of the present invention under drought stress.
[0029] Figure 4 Analysis of ZmCP03 gene sequence in gene-edited knockout mutant ZmCP03-KO of Example 4 of the present invention.
[0030] Figure 5 Drought resistance graph of gene-edited knockout mutant ZmCP03-KO of Example 4 of the present invention.
[0031] Figure 6 Survival rate graph of the gene - editing knockout mutant ZmCP03 - KO of Example 4 of the present invention under drought stress. Detailed implementation manners
[0032] Example 1
[0033] Application of the maize ZmCP03 gene in this example, wherein the maize ZmCP03 gene is over - expressed in maize plants for improving the drought resistance of maize; the nucleotide sequence of the maize ZmCP03 gene is as shown in SEQ ID NO:1, and the amino acid sequence of the maize ZmCP03 gene is as shown in SEQ ID NO:2.
[0034] The method for over - expressing the maize ZmCP03 gene in maize plants is as follows:
[0035] S1. Cloning of the ZmCP03 gene: Retrieve the biological information of ZmCP03 from the maize database, and the transcript ID is GRMZM2G072448;
[0036] S101. Select the maize B73 inbred line as the experimental material, extract the RNA of maize leaf tissue at the three - leaf stage, and reverse - transcribe it into cDNA;
[0037] S102. Using the cDNA obtained in S101 as a template, perform PCR amplification with primer ZmCP03 - F and primer ZmCP03 - R to obtain a PCR product;
[0038] The reaction system for the PCR amplification is: 1μL of cDNA, 1μL of KOD high - fidelity enzyme, 1μL of primer ZmCP03 - F, 1μL of primer ZmCP03 - R, 5μL of buffer, 10μL of dNTP mix, and sterile water is added to make up to 50μL;
[0039] The reaction program for the PCR amplification is: pre - denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 50℃ for 45 s, extension at 72℃ for 64 s, for a total of 30 cycles, then add 0.5μL of Taq enzyme and extend at 72℃ for 10 min;
[0040] The nucleotide sequence of the primer ZmCP03 - F is as shown in SEQ ID NO:3;
[0041] The nucleotide sequence of the primer ZmCP03 - R is as shown in SEQ ID NO:4;
[0042] S103. After subjecting the PCR product obtained in S102 to gel extraction using a gel extraction kit, it was ligated to the vector pCambia3300, then transformed into Escherichia coli Trans5α competent cells, and verified by double digestion with Xba I / BamH I. The bacterial solutions corresponding to 1 - 3 positive bands were screened and sequenced.
[0043] S2. Bioinformatics analysis of the ZmCP03 gene:
[0044] The sequencing result in S103 was aligned with the nucleotide sequence of the maize ZmCP03 gene (SEQ ID NO: 1) using the Mega4.0 software. If the nucleotide sequences were the same, it was considered a successful clone, and the PCR product in S102 with successful cloning was the ZmCP03 target gene fragment.
[0045] Sequence analysis revealed that the full - length coding region of the ZmCP03 gene was 1059 bp, encoding a total of 352 amino acids, with a pI of 8.02 and an Mw of 38.089 kD.
[0046] S3. Construction of the over - expression vector of the maize ZmCP03 gene:
[0047] The vector pCambia3300 was double - digested with BsaI / Eco31I to obtain the large fragment of the pCambia3300 vector; the ZmCP03 target gene fragment in S3 was double - digested with BsaI / Eco31I to obtain the P - rDNAo1 target fragment. After verifying the fragment size by electrophoresis, the enzyme - digested electrophoresis products were recovered using an agarose gel extraction kit. Then, the large fragment of the pCambia3300 vector and the P - rDNAo1 target fragment were ligated under the action of T4 ligase at 37°C for 1 h to obtain a ligation product.
[0048] The system of the ligation reaction was: 3 μL of the large fragment of the pCambia3300 vector, 5 μL of the P - rDNAo1 target fragment, 1 μL of T4 DNA ligase, 1 μL of 10×T4 DNA ligase buffer, and 1 μL of sterile water.
[0049] The obtained ligation product was transformed into Escherichia coli competent cells. The transformed bacterial solution was spread on an LB solid medium containing kanamycin and cultured at 37°C for 12 h. Then, positive clones were selected for culture and identified by colony PCR to obtain the over - expression vector of the maize ZmCP03 gene, that is, the pCambia3300 - ZmCP03 plasmid.
[0050] S4. Maize genetic transformation of the ZmCP03 gene:
[0051] The pCambia3300-ZmCP03 plasmid obtained in S3 was used to transform Agrobacterium tumefaciens, which was then used to infect the young embryos of maize inbred line B104. Through induction culture, co-culture, screening culture, differentiation culture, rooting culture and transplanting into seedlings, positive plants of ZmCP03 transgenic maize were obtained.
[0052] The specific method is as follows: First, select young embryos of maize inbred line B104 with uniform size, peel the young embryos in a sterile operation table, and conduct dark culture at 34°C for 3 days under high temperature induction; then place them in an incubator at 25°C for dark culture for 7 days. Cut off the endogenous buds from the induced callus, inoculate them into the subculture medium, and conduct dark culture at 25°C for 7 days. Subculture twice for use in Agrobacterium transformation. The callus was placed in a sterile infection medium and washed twice; after the last wash, pour out the liquid and add the bacterial solution (OD600 = 0.4) for infection for 30 minutes; after Agrobacterium infection, the embryos were blotted dry on sterile filter paper, transferred to the surface of the co-culture medium, with the hypocotyl end in contact with the medium (scutellum facing up), and dark cultured at 23°C for 3 days. Screen twice, and transfer to the rooting medium after complete regenerated seedlings grow out, and conduct rooting and strengthening of seedlings at 28°C with 16 hours of light. When the roots grow to about 2 cm, carry out acclimatization and transplantation.
[0053] S5. Identification of positive plants of ZmCP03 transgenic maize: The positive plants of ZmCP03 transgenic maize obtained in S4 were subjected to ZmCP03 gene PCR detection. A band with the same size as that in the pCambia3300-ZmCP03 plasmid described in the positive control S3 was amplified at the position of 1059 bp. After sequencing and correct sequence alignment, it was a maize ZmCP03 gene overexpression plant, named ZmCP03-OE-30 transgenic plant.
[0054] Example 2
[0055] This example is the method for obtaining negative control plants of Example 1:
[0056] The construction method of the CRISPR / Cas9 knockout vector pOSCas9-ZmCP03 is as follows:
[0057] (I) Construction of the origin-9 gene knockout vector:
[0058] (1) Three knockout target sequence fragments were found in the database of the National Center for Biotechnology Information (NCBI) in the United States, as follows:
[0059] Target 1: The nucleotide sequence is ccgcaacattgagcacatcgagg;
[0060] Target 2: The nucleotide sequence is gtgctgcagcctcataatgctgg;
[0061] Target 3: The nucleotide sequence is cggtggtgacaggctgatgatgg;
[0062] And the primers linked to the target sequence were designed as follows:
[0063] origin-9-T1+: The nucleotide sequence is as shown in SEQ ID NO:5;
[0064] origin-9-T1-: The nucleotide sequence is as shown in SEQ ID NO:6;
[0065] origin-9-T2+: The nucleotide sequence is as shown in SEQ ID NO:7;
[0066] origin-9-T2-: The nucleotide sequence is as shown in SEQ ID NO:8;
[0067] origin-9-T3+: The nucleotide sequence is as shown in SEQ ID NO:9;
[0068] origin-9-T3-: The nucleotide sequence is as shown in SEQ ID NO:10;
[0069] (2) First, the maize mutant with gene function deletion was created by CRISPR-Cas9 site-directed mutagenesis technology. The sgRNA of ZmPCP was designed using the online analysis software CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ), the intermediate vector was constructed, and then the method of isocaudarner ligation was used to ligate multiple intermediate vector fragments containing the target sites into the final vector at one time. The specific procedure is as follows:
[0070] ① First, the primers of 3 pairs of vectors were synthesized into double-stranded DNA by PCR;
[0071] The PCR reaction system is as follows: Forward primer: 5 μL; Reverse primer: 5 μL; H2O: 40 μL;
[0072] PCR program: Pre-denaturation at 95°C for 10 min, denaturation at 55°C for 10 min, annealing at 14°C for 5 min
[0073] origin-9-T1+ and origin-9-T1- synthesize the gRNA-T1 fragment;
[0074] origin-9-T2+ and origin-9-T2- synthesize the gRNA-T2 fragment;
[0075] origin-9-T3+ and origin-9-T3- synthesize the gRNA-T3 fragment;
[0076] ②Perform digestion-ligation reactions on origin-9-T1, origin-9-T2, and origin-9-T3 with Eco31I at 37°C for 2 h to obtain digestion-ligation products, named pSgA(pSgB)-T1 vector, pSgA(pSgB)-T2 vector, and pSgA(pSgB)-T3 vector, respectively;
[0077] The digestion reaction system is as follows:
[0078] Table 1 Digestion system of gRNA-T1 fragment and origin-9-T1
[0079] Raw material Dosage gRNA-T1 fragment 2 μL origin-9-T1 1.5 μL Eco31I 0.5 μL T4-ligase 0.5 μL T4-buffer 1 μL Sterile water 4.5 μL Total volume 10 μL
[0080] Table 2 Digestion system of gRNA-T2 fragment and origin-9-T2
[0081]
[0082]
[0083] Table 3 Digestion system of gRNA-T3 fragment and origin-9-T3
[0084] Raw material Dosage gRNA-T3 fragment 2 μL origin-9-T3 1.5 μL Eco31I 0.5 μL T4-ligase 0.5 μL T4-buffer 1 μL Sterile water 4.5 μL Total volume 10 μL
[0085] ③After the digestion-ligation reaction, transform the recombinant plasmid into Escherichia coli competent cells, screen positive clone colonies, and extract plasmid DNA for standby.
[0086] Take one tube of 200 μL Escherichia coli competent cells DH5a and mix with 5 μL of the digestion-ligation product, and incubate on ice for 30 min; then quickly place it in a 42°C water bath for 90 s of heat shock, and incubate on ice for 2 min; then add 500 μL of LB liquid medium, mix well; then culture at 37°C and 200 rpm for 45 min to allow the cells to resume normal growth state; finally, evenly spread the bacterial solution on an LB solid medium plate with kanamycin resistance; after 30 min, place it in a 37°C constant temperature incubator for overnight culture. Then screen positive clones and send them to the company for sequencing;
[0087] ④Final vector ligation:
[0088] Adopt the method of isocaudarner ligation to ligate the three intermediate vectors containing the target sites into the final vector at one time. First, linearize the pOSCas9 expression vector and the intermediate vectors;
[0089] Digest the pOSCas9 vector with AscI and EcoRⅠ successively;
[0090] Then digest the three intermediate vectors with different enzymes respectively, that is:
[0091] Digest the pSgA (pSgB)-T1 vector with AscⅠ and XbaⅠ enzymes;
[0092] Digest the pSgA (pSgB)-T2 vector with NheⅠ + XhoⅠ enzymes;
[0093] Digest the pSgA (pSgB)-T3 vector with SalⅠ + EcoRⅠ enzymes;
[0094] Use T4 DNA ligase to ligate the intermediate vector and the pOSCas9 expression vector to construct the CRISPR / Cas9 knockout vector OsCas9-ZmCP03. The ligation reaction system is as follows:
[0095] Table 4 Ligation reaction system for constructing the CRISPR / Cas9 knockout vector OsCas9-ZmCP03
[0096] Raw material Dosage pOSCas9 expression vector 50 ng pSgA(pSgB)-T1 vector 8 ng pSgA(pSgB)-T2 vector 8 ng pSgA(pSgB)-T3 vector 8 ng T4 ligase Buffer 1 μL T4 ligase 0.5 μL Sterile water Make up to 10 μL
[0097] ⑤ Transformation and screening of recombinant vectors and Agrobacterium transformation
[0098] Take 2 - 4 μL of the ligation product to transform Escherichia coli DH5α competent cells. After identification by PCR and double digestion of plasmid DNA, extract plasmid DNA. Transform Agrobacterium, and perform colony PCR verification, then preserve the bacteria at -20°C. Use the CRISPR / Cas9 knockout vector pOSCas9-ZmCP03 to transform the immature embryos of B104. The transformation method is the same as that of the pCambia3300-ZmCP03 plasmid transforming the immature embryos of B104 in Example 1. Finally, obtain the gene-edited knockout mutant ZmCP03-KO-3.
[0099] Example 3
[0100] This example is the drought tolerance analysis of the overexpressing plant of maize ZmCP03 gene (ZmCP03-OE-30 transgenic plant) in Example 1:
[0101] Through qRT-PCR experiments, it was found that the expression level of the ZmCP03 gene in the ZmCP03-OE-30 transgenic plant was significantly higher than that of the control B104( Figure 1) To confirm whether the overexpressing ZmCP03-OE-30 maize is more drought-resistant than B104 maize, drought stress treatments were conducted on the two types of maize. During normal growth, the soil moisture was maintained at 90 - 100%. Watering was stopped when the maize grew to the three-leaf stage. Before drought stress, there was little difference in the growth vigor between B104 and the overexpressing ZmCP03-OE-30 maize. After 14 days of drought stress, significant differences appeared in their phenotypes. B104 showed severe leaf curling, wilting, and gradually turning yellow compared to the overexpressing ZmCP03-OE-30 maize. After re-watering, the overexpressing ZmCP03-OE-30 maize could recover to its original growth state, and its survival rate was significantly higher than that of B104. The overexpressing maize ZmCP03-OE-30 had stronger drought resistance than B104( Figure 2 and Figure 3 ), indicating that overexpressing the ZmCP03 gene enhances the drought resistance of maize.
[0102] Example 4
[0103] This example is the drought resistance test of the gene-edited knockout mutant ZmCP03-KO-3 in Example 2:
[0104] To further confirm the function of the ZmCP03 gene in drought resistance, we knocked out the ZmCP03 gene through gene editing technology. Through sequencing analysis, it was found that 2 sites in the ZmCP03 gene were successfully knocked out. One site had a large fragment deleted, and the other site had a single base deleted, resulting in the loss of the gene function( Figure 4 ). To confirm whether B104 is more drought-resistant than the gene-edited knockout mutant ZmCP03-KO-3 maize, drought stress treatments were conducted on the two types of maize. During normal growth, the soil moisture was maintained at 90 - 100%. Watering was stopped when the maize grew to the three-leaf stage. Before drought stress, there was little difference in the growth vigor between B104 and the gene-edited knockout mutant ZmCP03-KO-3 maize. After 10 days of drought stress, significant differences appeared in their phenotypes. The gene-edited knockout mutant ZmCP03-KO-3 maize showed severe leaf curling, wilting, and gradually turning yellow compared to B104. After re-watering, B104 could recover to its original growth state, and its survival rate was significantly higher than that of the gene-edited knockout mutant ZmCP03-KO-3. B104 had stronger drought resistance than the gene-edited knockout mutant ZmCP03-KO-3( Figure 5 and Figure 6 ), indicating that the loss of ZmCP03 function leads to a decrease in the drought resistance of maize.
[0105] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments based on the technical essence of the invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. Application of a maize ZmCP03 gene, characterized in that, The maize ZmCP03 gene is overexpressed in maize plants to improve the drought resistance of maize; the nucleotide sequence of the maize ZmCP03 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the maize ZmCP03 gene is shown in SEQ ID NO: 2; the method for overexpressing the maize ZmCP03 gene in maize plants is as follows: S1. Cloning of the ZmCP03 gene: S101. Select the maize inbred line B73 as the experimental material, extract the RNA of maize leaf tissue at the three-leaf stage, and reverse transcribe it into cDNA; S102. Using the cDNA obtained in S101 as a template, perform PCR amplification with primer ZmCP03-F and primer ZmCP03-R to obtain a PCR product; The reaction system for the PCR amplification is as follows: 1 μL of cDNA, 1 μL of KOD high-fidelity enzyme, 1 μL of primer ZmCP03-F, 1 μL of primer ZmCP03-R, 5 μL of buffer, 10 μL of dNTP mix, and sterile water is added to make up to 50 μL; The reaction program for the PCR amplification is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 50 °C for 45 s, extension at 72 °C for 64 s. After a total of 30 cycles, 0.5 μL of Taq enzyme is added, and extension is carried out at 72 °C for 10 min; The nucleotide sequence of the primer ZmCP03-F is shown in SEQ ID NO: 3; The nucleotide sequence of the primer ZmCP03-R is shown in SEQ ID NO: 4; S103. After cutting and recovering the PCR product obtained in S102 with a gel recovery kit, it is ligated with the vector pCambia3300, then transformed into Escherichia coli Trans5α competent cells, verified by double digestion with Xba I / BamH I, and 1 - 3 bacterial solutions corresponding to positive bands are selected for sequencing; S2. Bioinformatics analysis of the ZmCP03 gene: Compare the sequencing results in S103 with the nucleotide sequence of the maize ZmCP03 gene through Mega4.0 software. If the nucleotide sequences are the same, the cloning is successful, and the PCR product described in S102 with successful cloning is the ZmCP03 target gene fragment; S3. Construction of the overexpression vector of the maize ZmCP03 gene: Double-digest the vector pCambia3300 with BsaI / Eco31I to obtain the large fragment of the pCambia3300 vector; double-digest the ZmCP03 target gene fragment described in S3 with BsaI / Eco31I to obtain the P-rDNAo1 target fragment. After verifying the fragment size by electrophoresis, recover the enzyme-digested electrophoresis product with an agarose gel recovery kit. Then, under the action of T4 ligase, the large fragment of the pCambia3300 vector and the P-rDNAo1 target fragment are ligated at 37 °C for 1 h to obtain a ligation product; The system of the ligation reaction is as follows: 3 μL of the large fragment of the pCambia3300 vector, 5 μL of the P-rDNAo1 target fragment, 1 μL of T4 DNA ligase, and 1 μL of 10×T4 DNA ligase buffer; The obtained ligation product was transformed into Escherichia coli competent cells. The transformed bacterial solution was spread on an LB solid medium containing kanamycin and cultured at 37 °C for 12 h. Then, positive clones were selected for culture and identified by colony PCR to obtain the overexpression vector of the maize ZmCP03 gene, namely the pCambia3300-ZmCP03 plasmid; S4. Maize genetic transformation of the ZmCP03 gene: The pCambia3300-ZmCP03 plasmid obtained in S3 was used to transform Agrobacterium, which was then used to infect the young embryos of the maize inbred line B104. After induction culture, co-culture, screening culture, differentiation culture, rooting culture, and transplanting into seedlings, positive plants transgenic for ZmCP03 were obtained; S5. Identification of positive plants transgenic for ZmCP03: The positive plants transgenic for ZmCP03 obtained in S4 were subjected to ZmCP03 gene PCR detection. A band of the same size as that in the pCambia3300-ZmCP03 plasmid in the positive control S3 was amplified at the position of 1059 bp. If the sequence alignment was correct after sequencing, it was an overexpression plant of the maize ZmCP03 gene.
Citation Information
Patent Citations
Gene ZmSAG39 for regulating and controlling leaf senescence, encoded protein and application of gene ZmSAG39
CN114480417A
Application of corn ZmNAC78 gene
CN114807165A
Alfalfa cysteine prolease and its coding gene and uses
CN1807611A