A primer for thermostatic molecular detection marker of potato late blight and a detection method

By designing species-specific RAA constant temperature detection primers and probes, a high-sensitivity RAA constant temperature detection system for late-blight potatoes was developed, which solved the problems of insufficient sensitivity and long amplification time of existing detection technologies, and achieved rapid and accurate field on-site detection.

CN115961080BActive Publication Date: 2025-06-17SICHUAN RUWAN BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211675449.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-26
Publication Date
2025-06-17
Estimated Expiration
2042-12-26

AI Technical Summary

Technical Problem

The existing potato late blight detection technology has problems such as insufficient sensitivity, long amplification time, high equipment requirements and difficulty in realizing field inspection.

Method used

A species-specific recombinase-mediated constant temperature molecular detection primers and probes were designed, and a high-specific and highly sensitive RAA constant temperature detection system for late-bacterial potatoes was developed. RAA amplification was performed using RAA-Pi1F/RAA-Pi1R primers and Pi-Probe probes, and the amplification products were detected by gel electrophoresis or LFD test strips.

Benefits of technology

High sensitivity detection of Phytophthora in potato late blight was achieved, the amplification time was shortened to 10 minutes, and the minimum detection limit of RAA-LFD reached 1fg/μL, which was suitable for field on-site testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115961080B_ABST
    Figure CN115961080B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer and a detection method for constant-temperature molecular detection of potato late blight. The molecular marker primer includes an upstream primer RAA-Pi1F, a downstream primer RAA-Pi1R, and a Pi-Probe probe shown in SEQ ID NO: 1-3 in the sequence listing. The designed RAA amplification primer and probe are compared with the nucleic acid sequence database of NCBI, and it is determined that they have species specificity. The detection method of the present invention has high sensitivity. When the amplification time is 20 min, the lowest detection limit of RAA-LFD is 1×10-3 fg / μL; when the amplification time is 25 min, the lowest detection limit of RAA-LFD is 1×10-4 fg / μL, which is converted into the template molecule copy number of 27.4 copies / mL.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of potato late blight gene detection and relates to isothermal amplification detection technology. Background Art

[0002] Potato late blight causes huge economic losses every year. How to effectively prevent and control this disease remains a global problem.

[0003] Traditional late blight detection methods include observing disease symptoms and isolating pathogens for morphological identification. However, direct observation is likely to miss plant materials in the initial stage of the disease, and the diseases caused by Phytophthora infestans are easily confused with the disease symptoms caused by Pythium spp., Fusarium spp. and Rhizoctonia spp. Therefore, it is very necessary to isolate Phytophthora infestans. However, the isolation and pure culture of Phytophthora infestans have relatively high technical requirements, and there are few morphological characteristics available for pathogen identification, making it difficult to identify.

[0004] The emergence of molecular detection provides new ideas and methods for the rapid and accurate diagnosis of plant diseases. However, molecular detection technologies based on targets such as the internal transcribed spacer (ITS) and mitochondrial genes Cox1-Cox2 are limited by reasons such as small sequence differences and high GC content, making it difficult to distinguish target Phytophthora from its related species or unsuitable as molecular targets.

[0005] The PCR detection system relies on precision equipment such as PCR instruments, and has high requirements for the experimental environment and the professional level of operators, takes a long time, is difficult to be separated from the laboratory, and difficult to achieve field detection.

[0006] Compared with the conventional PCR technology, the isothermal amplification technology is simple to operate, has a short amplification time, and does not require precision instruments and equipment. Currently, relatively common isothermal amplification technologies include nucleic acid sequence-based amplification (NASBA), rolling circle amplification (RCA), helicase-dependent isothermal DNA amplification (HDA), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), etc.

[0007] When the template concentration of the RPA-LFD detection system for potato late blight established by Zhao Yumei et al. based on Ypt1 was 40 ng / μL, no detection line was seen on the test strip after 5 minutes of amplification, and the detection line was still very faint after 10 minutes of amplification. The lowest detection limit of the LAMP detection technology for Phytophthora infestans established by Mehran Khan et al. based on Ypt1 was 128 fg / μL. The detection sensitivity of the LAMP system for Phytophthora infestans established by Gaurav Verma et al. based on ITS-1 was 1 pg / μL. Moreover, the amplification time of the LAMP detection technology is usually above 60 minutes.

[0008] Recombinase aided amplification (RAA) technology is a technology similar to RPA developed by domestic enterprises. The only difference between the two lies in the source of the recombinase. The recombinase in RPA technology comes from T4 phage, while the recombinase in RAA technology comes from bacteria or fungi. Compared with T4 phage, the recombinase used in RAA has a wider source and higher temperature adaptability. In the prior art, there are no specific RAA isothermal molecular detection primers and probes developed for Phytophthora infestans causing potato late blight. Summary of the Invention

[0009] In view of this, the object of the present invention is to design RAA isothermal molecular detection primers and probes with species specificity, and further develop a highly specific and highly sensitive RAA isothermal detection system for potato late blight.

[0010] Through long-term exploration and attempts, as well as multiple experiments and efforts, and continuous reform and innovation, the inventors provide the following technical solution to solve the above technical problems. The present invention provides a set of isothermal molecular detection primers for potato late blight, and the molecular marker primers are:

[0011] Forward primer RAA-Pi1F (5'to3'): ACCTGCTCATACTAATTCGTCTCCGAAATTG;

[0012] Reverse primer RAA-Pi1R (5'to3'): Bio-TCAAATATCAATGTAGTGATAGTGATACAGC;

[0013] Pi-Probe probe (5'to3'): (6-Carboxyfluorescein)-AGTGGACTAATGCGTTGACGTCTTCGA CGC-(THF)-GATACTATTGCAGGC-(SpacerC3).

[0014] According to an embodiment of the primer for the isothermal molecular detection marker of potato late blight of the present invention, the molecular marker primer is used to identify Phytophthora infestans.

[0015] The present invention also provides an isothermal molecular detection method based on the aforementioned molecular detection marker primer. Using the genomic DNA of the test potato leaf sample material as a template, RAA amplification is carried out with RAA-Pi1F / RAA-Pi1R primers and Pi-Probe probe. The amplification product is detected on a gel electrophoresis or an LFD test strip. The appearance of a positive band indicates that the test potato leaf sample contains the DNA of Phytophthora infestans.

[0016] Preferably, the temperature condition for the amplification is 35.0 °C to 39.0 °C.

[0017] Preferably, the temperature condition for the amplification is 37.0 °C.

[0018] Preferably, the duration of the amplification is 5 - 25 min.

[0019] Preferably, the duration of the amplification is 10 - 20 min.

[0020] Compared with the prior art, one of the above technical solutions has the following advantages:

[0021] a) The RAA amplification primers and probes designed in the present invention are compared with the nucleic acid sequence database of NCBI and are determined to have species specificity.

[0022] b) The detection method of the present invention has high sensitivity. When the amplification time is 10 min, the lowest detection limit of RAA-LFD is 1 fg / μL; when the amplification time is 15 min, the lowest detection limit of RAA-LFD is 5×10 -2 fg / μL; when the amplification time is 20 min, the lowest detection limit of RAA-LFD is 1×10 -3 fg / μL; when the amplification time is 25 min, the lowest detection limit of RAA-LFD is 1×10 -4 fg / μL, which is converted into the template molecule copy number of 27.4 copies / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0024] Figure 1These are the detection results of the primer effectiveness and specificity of the RAA-LFD system. Figure 1 In it, A and B are respectively the agarose gel electrophoresis and LFD detection of the RAA amplification product; C: control line; T: test line; M: DNA marker; CK-: blank control ddH2O; 1: virus-free potato seedlings; 2: Ralstonia solanacearum; 3: Phytophthora sojae; 4: Phytophthora nicotianae; 5: Phytophthora colocasiae; 6: Phytophthora capsici; 7: Phytophthora infestans.

[0025] Figure 2 These are the results of the temperature optimization of the RAA-LFD detection system. Figure 2 In it, CK-: blank control ddH2O; 1: 35°C; 2: 35.5°C; 3: 36°C; 4: 36.5°C; 5: 37°C; 6: 37.5°C; 7: 38°C; 8: 38.5°C; 9: 39°C.

[0026] Figure 3 These are the results of the time optimization of the RAA-LFD detection system. Figure 3 In it, CK-: blank control ddH2O; 1: 5 min; 2: 10 min; 3: 15 min; 4: 20 min; 5: 25 min; 6: 30 min; 7: 35 min.

[0027] Figure 4 These are the detection results of the RAA-LFD sensitivity. Figure 4 In it, CK-: blank control ddH2O; 1-9 are the amplification products using the plasmid 10-fold serial dilution as the template, and the highest template amount in lane 1 is: 1.31 ng / μL (2.69×10 8 copies / μL).

[0028] Figure 5 These are the detection results of the RAA-LFD sensitivity with an amplification time of 25 min. Figure 5 In it, 1-16 are recombinant plasmid solutions with different concentrations, 1: 125 fg / μL; 2: 100 fg / μL; 3: 75 fg / μL; 4: 50 fg / μL; 5: 25 fg / μL; 6: 10 fg / μL; 7: 5 fg / μL; 8: 1 fg / μL; 9: 5×10 -1 fg / μL; 10: 1×10 -1 fg / μL; 11: 5×10 -2 fg / μL; 12: 1×10 -2 fg / μL; 13: 1×10 -3 fg / μL; 14: 1×10 -4 fg / μL; 15: 1×10 -5 fg / μL; 16: 1×10 -6 fg / μL.

[0029] Figure 6 These are the detection results of RAA-LFD for field leaf samples. Figure 6 Among them, A and B are the RAA-LFD detection results of field samples in Chongzhou City and Jintang County respectively; C: control line; T: test line; CK-: blank control ddH2O; 1-21: leaf samples, which are healthy leaves and diseased leaves of grades 0, 1, 3, 5, 7, and 9 from left to right, with 3 replicates of each leaf sample; C, D, and E are the field RAA-LFD detections of grade 0 diseased leaves under amplification conditions of 15, 20, and 25 minutes respectively, where 1-3 and 4-6 are grade 0 diseased leaves in Chongzhou City and Jintang County respectively. Specific implementation manners

[0030] The following will be described in conjunction with the accompanying drawings and a specific embodiment.

[0031] To make the purposes, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the claimed present invention, but merely represents the selected embodiments of the present invention.

[0032] Example 1

[0033] Currently, the molecular detection technology system for Phytophthora infestans often uses the ITS or Ypt1 sequence as the detection target. The ITS sequence has the characteristics of large interspecies variation and intraspecies conservation, which is more suitable for distinguishing different species. However, some studies have found that some species with very close taxonomic status have very similar ITS sequences, and it is difficult to distinguish multiple species in the genus Phytophthora through the ITS sequence.

[0034] The Ypt1 gene in the genus Phytophthora contains multiple exons and introns. The exons are conserved, but the introns are variable among different species and can be used to design primers for the molecular detection of oomycetes in the genus Phytophthora. However, this variability only exists in a small number of sites in the introns, and not the entire intron is variable. It is difficult to design molecular detection primers with high specificity.

[0035] The isothermal molecular detection marker primers for Phytophthora infestans described in this example are RAA isothermal detection primers and probes designed based on the Phytophthora infestans genome sequence (see Table 1). The nucleotide sequence of the upstream primer RAA-Pi1F is shown in Sequence Listing SEQ ID NO: 1, the nucleotide sequence of the downstream primer RAA-Pi1R is shown in Sequence Listing SEQ ID NO: 2, and the nucleotide sequence of the Pi-Probe probe is shown in Sequence Listing SEQ ID NO: 3. The length of the primer amplification fragment is 328 bp, and the sequence is shown in Sequence Listing SEQ ID NO: 4.

[0036] The RAA amplification primers and probes designed in this example were compared with the nucleic acid sequence database of NCBI (the database with the most and most complete nucleic acid sequence information globally at present), and it was determined that they have species specificity. Therefore, it can be determined that their specificity is "species-specific" primers and probes under the current knowledge background.

[0037] Table 1 RAA amplification primers for specific DNA regions of Phytophthora infestans

[0038]

[0039] Note: Biotin-: 5'-terminal antigen label, biotin; 6-Carboxyfluorescein: 5'-labeled 6-carboxyfluorescein group; THF: empty base site; SpacerC3: 3'-terminal block.

[0040] Example 2

[0041] The isothermal molecular detection method for Phytophthora infestans described in this example uses the isothermal molecular detection marker primers for Phytophthora infestans described in Example 1 to detect Phytophthora infestans, the causative agent of potato late blight.

[0042] Where no special description is made in this example, it should be understood that existing technical means are applied.

[0043] To illustrate the specificity of the RAA-LFD primers of the present invention, a specificity test of the RAA-LFD primers was conducted in this example.

[0044] Using the genomic DNA of potato virus-free seedlings, Ralstonia solanacearum, Phytophthora sojae, Phytophthora nicotianae, Phytophthora colocasiae, Phytophthora capsici, and Phytophthora infestans as templates, and ddH2O as a negative control, RAA amplification was performed using the RAA-Pi1F / RAA-Pi1R primers and the Pi-Probe probe to detect the specificity and effectiveness of the primers and probes. The test results are as Figure 1As shown in the figure. The results showed that only when the genomic DNA of Phytophthora infestans was used as a template for RAA amplification, positive bands appeared in the gel electrophoresis and on the LFD test strip. The amplified product was recovered, sequenced and identified, and the similarity between the sequencing result and the expected sequence was 96.34%.

[0045] To obtain the most convenient isothermal detection conditions, 9 temperatures of 35.0 °C, 35.5 °C, 36.0 °C, 36.5 °C, 37.0 °C, 37.5 °C, 38.0 °C, 38.5 °C, and 39.0 °C were set for RAA amplification, and the amplified products obtained at different amplification temperatures were detected with a disposable lateral flow chromatography test strip. The results are as Figure 2 shown. The results showed that obvious test lines appeared in the amplified products under the above 9 temperature conditions, and there was no significant difference in the brightness of the test lines. The agarose gel electrophoresis results showed that the amplified products obtained at 9 different amplification times all had a target band of 328 bp, with no significant difference, indicating that the RAA technology has high adaptability to temperature. To make the detection system more convenient in subsequent applications, the inventor selected 37 °C, which is close to the axillary temperature of the human body, as the optimized amplification temperature.

[0046] To obtain the most convenient isothermal detection conditions, with 37 °C as the amplification temperature, 7 different amplification times of 5, 10, 15, 20, 25, 30, and 35 min were set for RAA amplification, and the amplified products were detected with a disposable lateral flow chromatography test strip. The test results are as Figure 3 shown. Obvious test lines all appeared, and there was no significant difference in the brightness of the test lines.

[0047] To prove the sensitivity of the RAA-LFD isothermal detection method, the target amplification fragment of RAA-Pi1F / RAA-Pi1Rd was cloned and ligated with the pEASY-T1 vector to construct a recombinant plasmid. The plasmid concentration was measured and converted into copy number (2.69×10 8 copies / μL), and 10-fold serial dilutions were performed in turn to construct a gradient dilution solution, and recombinant plasmid solutions with copy numbers of 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL order of magnitude were constructed. RAA amplification and detection were performed under the RAA amplification conditions of 37 °C / 5 min. The detection results are as Figure 4 shown. The results showed that the copy number of the recombinant plasmid was 10 8 ~10 4When there are 10 copies, a test line can appear on the test strip, and the color of the test line gradually decreases as the copy number of the recombinant plasmid decreases. When the copy number of the recombinant plasmid is at the order of magnitude of 10 3 the test line on the disposable lateral flow chromatography test strip disappears; when the copy number of the recombinant plasmid is at the order of magnitude of 10 4 the band on the agarose gel electrophoresis disappears. Therefore, the lowest plasmid copy number that can be detected under this amplification condition is: 2.69×10 4 copies / μL, and the concentration is 131 fg / μL.

[0048] Furthermore, low-concentration recombinant plasmids with different dilution multiples were used as templates to explore the lowest detection limit of RAA under different amplification times. When the amplification time was 5 min, no test line appeared on the disposable lateral flow chromatography test strip in the concentration range of 1×10 -6 fg / μL - 125 fg / μL; when the amplification time was 10 min, the lowest detection limit of RAA-LFD was 1 fg / μL; when the amplification time was 15 min, the lowest detection limit of RAA-LFD was 5×10 -2 fg / μL; when the amplification time was 20 min, the lowest detection limit of RAA-LFD was 1×10 -3 fg / μL; see Figure 5 when the amplification time was 25 min, the lowest detection limit of RAA-LFD was 1×10 - 4 fg / μL, and the converted template molecule copy number was 27.4 copies / mL.

[0049] Detection of potato leaf samples in the field by the RAA-LFD detection system

[0050] On April 18, 2021, healthy potato leaf samples were collected from non-diseased fields in Jintang County and Chongzhou City (the occurrence of late blight in this field was continuously monitored until after harvest to confirm that late blight did not occur), marked as CK and used as negative controls; potato leaf samples with different degrees of disease were collected from diseased fields. According to the potato late blight grading standard, the disease conditions were divided into grade 0 (no lesions on the leaves), grade 1 (lesion area on the leaves < 5%), grade 3 (6% < lesion area on the leaves < 10%), grade 5 (11% < lesion area on the leaves < 20%), grade 7 (21% < lesion area on the leaves < 50%), and grade 9 (lesion area on the leaves > 50%). Three replicates were taken for each disease grade, photographed and put into disposable self-sealing bags. One diseased leaf was put in each collection bag, and after sealing the bag mouth, it was placed in an ice box or ice bottle and taken back to the laboratory to extract genomic DNA for disease detection.

[0051] Forty-two leaf samples of field-grown potatoes (36 diseased field leaf samples and 6 non-diseased field leaf samples) collected from Chongzhou City and Jintang County were subjected to RAA-LFD amplification detection at 37 °C for 5 min. The results showed that no detection lines appeared in all samples. When the RAA amplification time was extended to 10 min, 15 positive samples were detected from 18 diseased field leaf samples collected from Chongzhou City ( Figure 6 A), and the positive detection rate was 83.33%; 18 positive samples were detected from 18 diseased field leaf samples collected from Jintang County, and the positive detection rate was 100% ( Figure 6 B). The overall positive detection rate of leaf samples collected from diseased fields in the two cities and counties was 91.67%.

[0052] The RAA amplification time was further extended to amplify the grade 0 leaves. The results showed that:

[0053] See Figure 6 C. When the amplification time was 15 min, no detection lines appeared in the grade 0 leaf samples collected from diseased fields in Chongzhou City, while relatively faint detection lines appeared in all grade 0 leaf samples collected from diseased fields in Jintang County;

[0054] See Figure 6 D. When the amplification time was 20 min, 1 positive sample was detected from the grade 0 leaves in Chongzhou City and 3 positive samples were detected from the grade 0 leaves in Jintang County;

[0055] See Figure 6 E. When the amplification time was 25 min, 1 positive sample was detected from the grade 0 leaves in Chongzhou City and 3 positive samples were detected from the grade 0 leaves in Jintang County.

[0056] The above are only the preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the protection scope of the present invention should be defined by the scope of the claims. For those of ordinary skill in the art in this technical field, without departing from the spirit and scope of the present invention, several improvements and refinements can still be made, and these improvements and refinements should also be regarded as within the protection scope of the present invention.

Claims

1. A primer-probe set for isothermal molecular detection of potato late blight, characterized in that, The primer-probe set for molecular detection labeling is as follows: Forward primer RAA-Pi1F: 5'- ACCTGCTCATACTAATTCGTCTCCGAAATTG -3'; Reverse primer RAA-Pi1R: 5'- Bio-TCAAATATCAATGTAGTGATAGTGATACAGC -3'; Pi-Probe probe: 5'- 6-Carboxyfluorescein-AGTGGACTAATGCGTTGACGTCTTC GACGC-THF-GATACTATTGCAGGC-SpacerC3 -3'.

2. The primer-probe set for isothermal molecular detection of potato late blight according to claim 1, characterized in that, The primer-probe set for molecular detection labeling is used for identifying Phytophthora infestans.

3. An isothermal molecular detection method based on the primer-probe set for molecular detection markers according to claim 1, characterized in that, Using the genomic DNA of the potato leaf sample to be tested as a template, RAA amplification is performed with the primers RAA-Pi1F, RAA-Pi1R and the Pi-Probe probe, and the amplification product is detected on a gel electrophoresis or an LFD test strip. The appearance of a positive band indicates that the potato leaf sample to be tested contains the DNA of Phytophthora infestans.

4. The method according to claim 3, characterized in that, The temperature condition for the amplification is 35.0°C to 39.0°C.

5. The method according to claim 4, characterized in that, The duration of the amplification is 5 to 25 minutes.

Citation Information

Patent Citations

  • Loop-mediated isothermal amplification primer composition for detecting phytophthora infestans and application thereof

    CN108676851A

  • Molecular marker primer and potato late blight detection method

    CN115198028A