Preparation method and application of a neutrophil-targeted drug-loaded bacterial membrane nanoparticle

Abstract

The present invention relates to a preparation method and application of neutrophil-targeted biofilm-loaded drug nanoparticles, which can effectively solve the problem that it is difficult to cross the blood-brain barrier in the prior art. The technical solution adopted is to construct a pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector and transform it into E.coil BL21(DE3) competent cells to obtain a recombinant strain. The recombinant strain is spread on an LB solid agar medium and cultured overnight. A single colony is picked into an LB broth medium and induced with isopropyl- β -D-thiogalactoside. After verifying the expression of the Angiopep-2 polypeptide, the bacterial cell precipitate is digested with lysozyme, and after ultrafiltration and centrifugation, an Angiopep-2 biofilm is prepared; PEI and CpG are incubated, and Tris-HCl and dopamine hydrochloride powder are added to obtain PDA-PEI-CpG; then the Angiopep-2 biofilm and PDA-PEI-CpG are incubated to obtain the desired product. The neutrophil-targeted biofilm-loaded drug nanoparticles prepared by the present invention solve the problems such as the difficulty in penetrating the blood-brain barrier in the treatment of glioblastoma with drugs, are simple and convenient to operate, and have broad application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of drug preparation, and particularly to a preparation method and application of a bacteria membrane-loaded drug nanoparticle targeting neutrophils. Background Art

[0002] Glioblastoma is the most common malignant tumor in the central nervous system, with a high recurrence rate and mortality rate. In recent years, the incidence of glioma has shown a gradually increasing trend. Due to the infiltrative growth characteristics of the tumor and the complexity of the intracranial anatomical structure and the central nervous system, it is very difficult to achieve radical resection by surgery. Ordinary radiotherapy is also limited by its effectiveness and radiation damage and cannot achieve radical cure. The nano-drug delivery system can concentrate drugs in tumor tissues, reduce the drug concentration in normal tissues, thereby improving the anti-tumor efficacy of drugs and reducing side effects, and has now become a research hotspot in anti-tumor. The existence of the blood-brain barrier hinders most drugs from entering the brain tissue, making the diagnosis and treatment of glioblastoma very difficult. The inflammatory property is one of the important characteristics of the tumor microenvironment. Neutrophils have a natural inflammatory homing effect, and their infiltration increases at the site of glioblastoma, and they can be developed into cell carriers of nano-drugs. However, the low phagocytosis rate and delivery efficiency of neutrophils to drugs limit their clinical application.

[0003] Utilizing the property that pathogens such as bacteria can be effectively recognized and phagocytosed by neutrophils, a bionic nano-pathogen system has been developed for neutrophil targeting of drug-loaded nanoparticles. In order to increase the efficiency of the bacteria membrane being phagocytosed and taken up by neutrophils, the bacteria membrane can be genetically engineered and modified with the Angiopep-2 targeting polypeptide. Angiopep-2 is a polypeptide derived from the Koitz domain of aprotinin and can specifically bind to low-denisitylipoprotein receptor-related protein 1 (LRP1). LRP1 is highly expressed on brain capillary endothelial cells and glioma cells. These properties make Angiopep-2 promising to be a candidate drug for LRP1-mediated targeted drug treatment of glioblastoma. CpG is an unmethylated DNA sequence, which mimics the immune process of bacteria in vivo and is a specific ligand of TLR-9. CpG is not stable in vivo, while the nano-delivery system can significantly improve the delivery efficiency, targeting effect and immune stimulation ability of CpG in the body. Based on this, CpG is loaded with PEI and then covered with a thin layer of polydopamine (PDA) to achieve stable delivery of CpG in vivo. At the same time, PDA scavenges ROS, changes the death mode of neutrophils from NETosis to apoptosis, and the released apoptotic bodies wrap PEI-CPG, and finally release the drug-loaded nanoparticles to treat tumor cells. There is no relevant report at present. Summary of the Invention

[0004] In view of the above situation, to solve the defects of the prior art, the object of the present invention is to provide a method for preparing a neutrophil-targeted bacteria membrane drug-loaded nanoparticle and its application, which can effectively solve the problem that it is difficult for the prior art to cross the blood-brain barrier.

[0005] The technical solution solved by the present invention is to obtain the inaX-N (GenBank number: ACN91081.1) gene sequence on NCBI, and insert the inaX-N and angiopep-2 (TFFYGGSRGKRNNFKTEEY) gene sequences into the pET-30a(+) vector Nde Ⅰ and Xho Ⅰ, construct a pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, and transform it into E. coli BL21(DE3) competent cells to obtain a recombinant strain. Coat the recombinant strain on an LB solid agar medium containing kanamycin sulfate and culture overnight. Pick a single colony into an LB broth medium containing kanamycin sulfate, and use isopropyl- β -D-thiogalactoside (IPTG) to induce to obtain an inaX-N-angiopep-2 culture. After verifying the expression of the Angiopep-2 polypeptide, digest the bacterial cell precipitate with lysozyme, and after ultrafiltration and centrifugation, prepare an Angiopep-2 bacteria membrane; incubate PEI(10KD) and CpG, ultrafilter and centrifuge to remove water, add Tris-HCl and dopamine hydrochloride powder, and stir at room temperature to obtain PDA-PEI-CpG; then incubate the Angiopep-2 bacteria membrane and PDA-PEI-CpG, first sonicate, then ultrafilter and centrifuge, and wash to obtain a neutrophil-targeted bacteria membrane drug-loaded nanoparticle, which specifically includes the following steps:

[0006] 1) Preparation of recombinant strain: Obtain the inaX-N gene sequence on NCBI, and insert the inaX-N and angiopep-2 gene sequences into the pET-30a(+) vector Nde Ⅰ and Xho Ⅰ, construct a pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, and transform it into E. coli BL21(DE3) competent cells to obtain a recombinant strain;

[0007] 2) Preparation of angiopep-2 biofilm: Spread the recombinant strain obtained in step 1) on an LB solid agar medium containing kanamycin sulfate, culture overnight at 37 °C, pick a single colony into an LB broth medium containing kanamycin sulfate, and shake culture in a constant temperature shaker at 37 °C for 2 h - 4 h. Keep at 37 °C and induce with isopropyl- β -β-D-thiogalactoside for 6 h - 8 h to obtain an inaX-N-angiopep-2 culture. Collect the bacterial liquid, centrifuge the bacterial liquid, wash with PBS, add the prepared lysozyme, incubate in a water bath at 37 °C for 20 - 40 min, take out the bacterial liquid and disperse it in a 100 KD ultrafiltration tube with PBS, centrifuge, wash with PBS to remove unbroken Escherichia coli and bacterial contents, and resuspend the obtained Escherichia coli biofilm in PBS to obtain angiopep-2 biofilm;

[0008] 3) Preparation of PDA-PEI-CpG: Incubate PEI (10KD) and CpG under water bath conditions at 25 °C, ultrafilter and centrifuge to remove water, add Tris-HCl and dopamine hydrochloride powder, and stir at room temperature to obtain PDA-PEI-CpG;

[0009] 4) Preparation of biofilm-loaded drug nanoparticles targeting neutrophils: Extract the angiopep-2 biofilm prepared in step 2) without lysing, perform BCA protein quantification, and coat the angiopep-2 biofilm and the PDA-PEI-CpG prepared in step 3) according to a mass ratio of 6:1 - 16:1. First, ultrasonicate for 5 - 10 min, then ultrafilter and centrifuge, and wash to obtain biofilm-loaded drug nanoparticles targeting neutrophils, angiopep-2 biofilm@PDA-PEI-CpG.

[0010] The Escherichia coli in step 1) is BL21(DE3) Escherichia coli, the concentration of lysozyme is 1 mg / ml, and the molecular weight cut-off of the ultrafiltration tube is 100 KD.

[0011] In step 2), the concentration of PEI (10KD) is 2 mg / ml, CpG is type B CpG, the sequence is TCCATGACGTTCCTGACGTT, the concentration is 0.5 mg / ml, the N / P ratio is 6, Tris-HCl is 10 mM, and the pH is 8.5.

[0012] In step 3), the preferred ultrasonication time is 8 min, and the molecular weight cut-off of the ultrafiltration tube is 100 KD.

[0013] The particle size of the biofilm-loaded drug nanoparticles targeting neutrophils prepared by the method of the present invention is 190 - 250 nm.

[0014] Use of the neutrophil-targeted drug-loaded nanogranules prepared by the method of the present invention in the preparation of drugs for treating glioblastoma

[0015] In view of the need for exogenous proteins to be displayed on the surface of Escherichia coli cells in the prior art, the present invention provides a recombinant fusion protein based on a bacterial surface display system, using the N-terminal domain of ice nucleation protein as a bacterial surface anchoring element, and its application. This recombinant fusion protein can enable the Angiopep-2 polypeptide to be successfully expressed on the bacterial surface through the INP surface display system.

[0016] A recombinant fusion protein (hereinafter referred to as "fusion protein") includes the N-terminal domain of ice nucleation protein and the Angiopep-2 polypeptide. Among them, the N-terminal domain of ice nucleation protein provides the function of anchoring on the bacterial surface, enabling the Angiopep-2 polypeptide to be anchored and displayed on the cell surface; the Angiopep-2 polypeptide can act as a ligand to bind to LRP1 expressed at the brain capillary endothelial cells, enabling the bacterial membrane to be taken up by neutrophils. The above components are directly connected or connected through a linker peptide.

[0017] In order to verify whether the fusion protein is successfully prepared, an affinity purification tag is used. Preferably, the recombinant fusion protein includes a His tag sequence.

[0018] Furthermore, the amino acid sequence of the gene encoding the N-terminal domain of ice nucleation protein is as shown in SEQ ID No. 1; the amino acid sequence of the gene encoding Angiopep-2 is as shown in SEQ ID No. 2.

[0019] Furthermore, the nucleotide sequence of the recombinant fusion protein is as shown in SEQ ID No. 3.

[0020] The neutrophil-targeted drug-loaded nanogranules prepared by the present invention solve the problems such as the difficulty in penetrating the blood-brain barrier in the drug treatment of glioblastoma, are simple and convenient to operate, and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the SDS-PAGE result diagram before and after the induction of inaX-N-angiopep-2 of the present invention.

[0022] Figure 2 It is the SDS-PAGE result diagram after the treatment with proteinase K after the induction of inaX-N-angiopep-2 of the present invention.

[0023] Figure 3 It is the TEM result diagram of the inaX-N-angiopep-2 bacterial membrane of the present invention.

[0024] Figure 4Standard curve graph established for measuring the concentration of inaX-N-angiopep-2 biofilm by the BCA method of the present invention.

[0025] Figure 5 SDS-PAGE result graph of the inaX-N-angiopep-2 biofilm of the present invention.

[0026] Figure 6 WB result graph for verifying whether the inaX-N-angiopep-2 biofilm is successfully extracted in the present invention.

[0027] Figure 7 2% agarose gel electrophoresis result graph under different N / P conditions of PEI and CpG in the present invention.

[0028] Figure 8 Particle size result graph under different N / P conditions of PEI and CpG in the present invention.

[0029] Figure 9 Potential result graph under different N / P conditions of PEI and CpG in the present invention.

[0030] Figure 10 TEM result graph of PDA-PEI-CpG.

[0031] Figure 11 TEM result graph of angiopep-2 biofilm@PDA-PEI-CpG of the present invention.

[0032] Figure 12 Particle size detection graph of angiopep-2 biofilm@PDA-PEI-CpG of the present invention.

[0033] Figure 13 WB verification graph of His tag and E. coli characteristic membrane protein ompA of angiopep-2 biofilm@PDA-PEI-CpG of the present invention.

[0034] Figure 14 Colocalization analysis graph of angiopep-2 biofilm@PDA-PEI-CpG of the present invention.

[0035] Figure 15 CpG release curve graph of PDA-PEI-CpG after encountering ROS in the present invention.

[0036] Figure 16 Degradation TEM graph of PDA-PEI-CpG after encountering ROS in the present invention, (a) is 12h, (b) is 24h.

[0037] Figure 17 UV degradation curve graph of PDA-PEI-CpG after encountering ROS in the present invention.

[0038] Figure 18 This is the confocal analysis diagram of the uptake of angiopep-2 biofilm @PDA-PEI-CpG by neutrophils in the present invention.

[0039] Figure 19 This is the cytotoxicity analysis diagram of PEI-CpG on GL261 cells in the present invention. Detailed implementation manners

[0040] The following further elaborates on the detailed implementation manners of the present invention in conjunction with the accompanying drawings and embodiments.

[0041] Example 1

[0042] When the present invention is specifically implemented, it specifically includes the following steps:

[0043] 1) Preparation of recombinant strain: Obtain the inaX-N gene sequence on NCBI, and insert the inaX-N and angiopep-2 gene sequences between the vectors Nde Ⅰ and Xho Ⅰ to construct a pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, and transform it into E. coli BL21(DE3) competent cells to obtain a recombinant strain;

[0044] 2) Preparation of angiopep-2 biofilm: Spread the recombinant strain obtained in step 1) on an LB solid agar medium containing kanamycin sulfate, culture overnight at 37°C, pick a single colony into an LB broth medium containing kanamycin sulfate, shake culture in a constant temperature shaker at 37°C for 2 h, maintain at 37°C, and induce with isopropyl-β-D-thiogalactoside for 6 h to obtain an inaX-N-angiopep-2 culture. Collect the bacterial liquid, take 40 mL of the inaX-N-angiopep-2 bacterial liquid, centrifuge at 4°C and 10,000 rpm for 10 min, and wash once with PBS; add 4 mL of lysozyme with a prepared concentration of 1 mg / mL to each, and incubate in a 37°C water bath for 20 min; take out the bacterial liquid, add 15 mL of PBS and disperse it in a 100 KD ultrafiltration tube, centrifuge at 4°C and 5,000 rpm for 10 min, and wash twice with PBS to remove unbroken Escherichia coli and bacterial contents. Resuspend the obtained Escherichia coli biofilm in 1.5 mL of PBS respectively to obtain angiopep-2 biofilm;

[0045] 3) Preparation of PDA-PEI-CpG: Incubate PEI (10KD) and CpG in a water bath at 25°C. Among them, the concentration of PEI (10KD) is 2 mg / ml, the concentration of CpG is 0.5 mg / ml, the N / P ratio of CpG is 6. Remove water by ultrafiltration centrifugation, add 10 mM Tris-HCl with a pH of 8.5 and dopamine hydrochloride powder. The added amount of dopamine hydrochloride powder is 2 times the sum of the masses of PEI and CpG. Stir at room temperature to obtain PDA-PEI-CpG;

[0046] 4) Preparation of neutrophil-targeted bacterial membrane drug-loaded nanoparticles: Extract the angiopep-2 bacterial membrane prepared in step 2) without lysis, perform BCA protein quantification, and coat the angiopep-2 bacterial membrane and the PDA-PEI-CpG prepared in step 3) according to a mass ratio of 10:1. First, ultrasonicate for 8 min, then ultrafilter with a 100 KD ultrafiltration tube, wash, and concentrate to 100 μL to obtain neutrophil-targeted bacterial membrane drug-loaded nanoparticles angiopep-2 bacterial membrane @PDA-PEI-CpG.

[0047] The neutrophil-targeted bacterial membrane drug-loaded nanoparticles prepared by the present invention can be used as a targeted drug for anti-glioblastoma. It does not require methods such as light irradiation and ultrasound to trigger drug release, and also avoids premature drug leakage before reaching the tumor site, thereby maximizing the anti-tumor activity, achieving precise drug release, and having significant anti-tumor activity. The relevant experimental data are as follows:

[0048] I. Expression of inaX-N-angiopep-2 protein, extraction and characterization of Angiopep-2 bacterial membrane

[0049] 1) Preparation of BL21(DE3) competent cells

[0050] Specific experimental method: Pick a single clone of the host bacterium BL21(DE3) into 3 mL of LB liquid medium, culture at 37°C and 210 rpm until OD600 = 0.35 - 0.50 (actually: process after the bacterial solution becomes slightly turbid, OD600 should not be too high, otherwise the transformation efficiency cannot be guaranteed), and then place it on ice to stop the growth of the host bacterium; Take 1 mL of the above bacterial solution into a 1.5 mL EP tube, centrifuge at 1500×g and 4°C for 5 min, and discard all the supernatant; Add 100 μL of 0.1 mol / L CaCl2 solution pre-cooled at 4°C to the precipitate, gently flick the EP tube to resuspend the bacterial cell precipitate, avoiding violent oscillation; Centrifuge at 1500×g and 4°C for 5 min, and discard all the supernatant; Add 100 μL of 0.1 mol / L CaCl2 solution pre-cooled at 4°C to the precipitate, gently flick the EP tube to resuspend the bacterial cell precipitate, avoiding violent oscillation; The preparation of competent cells is completed.

[0051] 2) Plasmid transformation of Inax-N / angiopep-2

[0052] Specific experimental method: Take 100 μl of competent cells BL21(DE3) and transfer them to a new EP tube; add 4 μL of the plasmid for transformation (10 ng / ml) to the competent cells, gently mix, and place on ice for 30 min; place in a 42 °C water bath for 50 s, and then immediately place on ice for 1 - 2 min; add 890 μl of SOC medium preheated to 37 °C; culture with shaking at 37 °C and 210 rpm for 1 h; take an appropriate amount of the bacterial solution and spread it on a plate (Kan+), place it upright for 30 min first, and then invert it and culture it overnight in a 37 °C incubator.

[0053] 3) Protein expression of Inax-N / angiopep-2

[0054] Specific experimental method: Take an overnight culture plate and a test tube containing 50 mL of LB liquid medium (Kan+), pick a single colony and inoculate it into the above medium, culture at 37 °C and 210 rpm until the OD600 value is about 0.6 (the actual value of Inax-N / angiopep-2 = 0.60), and reserve a sample for SDS-PAGE; add IPTG with a final concentration of 0.2 mmol / L, induce at 37 °C and 210 rpm for 6 h; after the induction expression is completed (the actual value of Inax-N / angiopep-2 = 2.55), reserve a sample for SDS-PAGE, then centrifuge at 10000×g and 4 °C for 10 min to collect the bacterial cell precipitate, and reserve the supernatant for SDS-PAGE; perform quantitative SDS-PAGE to verify the protein expression.

[0055] The experimental results are as Figure 1 shown. According to the SDS-PAGE results, it shows that there is an obvious and thicker protein band between 25 - 35 kDa in lane 3 of the induced inaX-N / angiopep-2, determining the protein expression.

[0056] 4) Treatment of the target protein with proteinase K

[0057] Specific experimental method: Take 15 mL of each induced inaX-N / angiopep-2 bacterial cells, wash them three times with PBS, and resuspend; divide the resuspended bacterial solution into three equal parts of 500 μL, and place one 500 μL equal part on ice; add 20 μL of 25 mM CaCl2 to the second and third equal parts; add 2.5 μL of 20 mg / mL proteinase K to the third equal part; incubate the second and third parts in a 37 °C water bath for 20 min, and then add 6 μL of 200 mM EDTA to both of them. Wash the three 500 μL equal parts three times with ice-cold PBS buffer.

[0058] The experimental results are asFigure 2 As shown in the figure, after digestion with proteinase K, some of the target protein bands of the inaX-N / angiopep-2 recombinant bacteria disappeared, the target bands were partially degraded, and many small molecular weight proteins appeared. This result confirmed that the target protein was successfully displayed on the cell surface.

[0059] 5) Extraction of angiopep-2 biofilm

[0060] Specific experimental method: Take 40 mL of inaX-N / angiopep-2 bacterial solution, centrifuge at 4°C and 10,000 rpm for 10 min, and wash once with PBS; add the prepared lysozyme (1 mg / mL, 4 mL) to each, and incubate in a 37°C water bath for 20 min; take out the bacterial solution and add 15 mL of PBS to disperse it in a 100 KD ultrafiltration tube, centrifuge at 4°C and 5,000 rpm for 10 min, and wash twice with PBS to remove the undamaged Escherichia coli and bacterial contents. Resuspend the obtained Escherichia coli biofilm in 1.5 mL of PBS each. Prepare the biofilm for TEM imaging by squeezing it multiple times through a 0.8 μm filter membrane.

[0061] The results are as Figure 3 shown. TEM characterized the morphology of the negatively stained biofilm and found that the biofilm structure was uniform and vesicular.

[0062] 6) Measure the concentration of the extracted biofilm by BCA method

[0063] Specific experimental method: Use the BCA protein concentration assay kit from Solarbio to measure the concentration of the biofilm. Gradient dilute the 0.5 mg / mL BSA protein standard to 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL. Dilute the cell membrane vesicles and PBS 10-fold at a ratio of 2:18. Take 20 μL of each concentration standard and the sample to be measured, vortex and mix well with 200 μL of BCA working solution respectively, then pipette 200 μL of the mixture into the microplate, and incubate in a 37°C incubator for 30 min; use the A562 absorbance of the microplate reader to detect the readings of the standards and samples. According to the detection results, make a concentration-reading standard curve with the readings of the standards, find the formula and R-squared value, substitute the readings of the samples to be measured, and thus calculate the concentration of the diluted samples.

[0064] The experimental results are as shown in Figure 4. The biofilm concentration of inaX-N-angiopep-2 is 2.88 mg / mL

[0065] 7) Perform SDS-PAGE and WB to verify the expression of biofilm proteins

[0066] Specific experimental methods: SDS-PAGE 180V, 35min; transfer: prepare the transfer tank and transfer solution, pour the transfer solution into the tank to completely soak the absorbent paper; cut the PVDF membrane with the same area as the glue, soak the membrane in methanol for 5min, soak the glue in transfer solution for 5min, 100V, transfer for 90min. The temperature will rise during transfer and it needs to be done in an ice water bath; blocking: wash the membrane three times with PBST, 10min each time; prepare 5% skim milk powder (prepared with PBST) as blocking solution, decolorize and block on a shaker at room temperature for 2h; primary antibody incubation: wash the membrane three times with PBST, 10min each time; add primary antibody (His monoclonal antibody containing HRP, 1 mg / mL), dilute it with 5% skim milk powder 1:1000 (30μL:30 mL), and incubate it at 4℃ overnight; color development: wash the membrane five times with PBST, 5min each time; prepare DAB color developer for color development.

[0067] The experimental results are shown in Figures 5 and 6. The inaX-N-angiopep-2 induction and the extracted inaX-N-angiopep-2 bacterial membrane protein bands are at the same position, and the WB results are normal, proving that the recombinant fusion protein has been successfully constructed and expressed.

[0068] 2. Preparation and Characterization of PDA-PEI-CpG

[0069] 1) Determination of N / P of PEI (10KD) and CpG

[0070] The specific operation was as follows: CpG (0.5 mg / ml) was coated with 2 mg / ml PEI (10KD) according to different N / P ratios (N / P=1, 2.5, 4, 5, 6, 7.5, 9), and incubated at 25°C for 30 min.

[0071] Detection: 2% agarose gel, particle size, and potential were used to detect CpG loading under different N / P ratios.

[0072] The results are as follows Figure 7 , 8 As shown in Figure 9, the agarose gel electrophoresis results show that when the N / P of PEI-CpG is 6, it shows that CpG can be encapsulated, and based on the comprehensive consideration of the particle size and potential diagram, it is determined that when N / P=6, the particle size of PEI-CpG is 160nm and the potential is 20mv.

[0073] 2) Preparation of PDA-PEI-CpG

[0074] The specific operation is as follows: incubate PEI (10KD) and CpG in a water bath at 25°C, remove water by ultrafiltration and centrifugation, add Tris-HCl and dopamine hydrochloride powder, stir at room temperature, and obtain PDA-PEI-CpG.

[0075] Detection: Perform TEM characterization on PDA-PEI-CpG.

[0076] The results are as Figure 10 shown. PDA-PEI-CpG has a spherical structure. PEI-CpG has a core with a thin coating on its surface, which is polydopamine (PDA), proving the successful preparation of PDA-PEI-CpG.

[0077] III. Preparation and Characterization of angiopep-2 Bacterial Membrane @ PDA-PEI-CpG

[0078] 1) Preparation of angiopep-2 Bacterial Membrane @ PDA-PEI-CpG

[0079] The specific operation is as follows: Extract the angiopep-2 bacterial membrane without lysis, perform BCA protein quantification, and coat the angiopep-2 bacterial membrane and PDA-PEI-CpG according to a certain mass ratio (based on the mass of PDA). First, ultrasonicate for 8 min, then ultrafilter with a 100KD ultrafiltration tube, wash, and concentrate to about 100 μL; the mass ratio of the bacterial membrane to PDA-PEI-CpG is 6:1 to 16:1.

[0080] Characterization: TEM, WB to verify the His tag, expression of the Escherichia coli characteristic membrane protein ompA, and particle size detection

[0081] Result analysis: As Figure 11 、 12 、13 shown, the TEM results indicate that angiopep-2 bacterial membrane @ PDA-PEI-CpG has a spherical structure. At the edge of PDA-PEI-CpG, there is a clear membranous structure, which is the angiopep-2 bacterial membrane; the WB results show that for the color development result of the His tag, the BL21 strain without plasmid in the negative control has no color reaction, while angiopep-2 whole bacteria, angiopep-2 bacterial membrane, and angiopep-2 bacterial membrane @ PDA-PEI-CpG have obvious color reactions. For the color development result of the Escherichia coli characteristic membrane protein ompA, the BL21 strain without plasmid in the negative control, angiopep-2 whole bacteria, angiopep-2 bacterial membrane, and angiopep-2 bacterial membrane @ PDA-PEI-CpG have obvious color reactions, proving the successful preparation of angiopep-2 bacterial membrane @ PDA-PEI-CpG; the particle sizes of PDA, PEI-CpG, PDA-PEI-CpG, angiopep-2 bacterial membrane, and angiopep-2 bacterial membrane @ PDA-PEI-CpG are gradually increasing, and the particle size of angiopep-2 bacterial membrane @ PDA-PEI-CpG is 197 nm.

[0082] 2) Co-localization analysis of angiopep-2 biofilm @ PDA-PEI-CpG

[0083] The specific operation is as follows: Take 1 mL of angiopep-2 biofilm (protein content 2.88 mg / mL) and label it with 20 μL of DiO. After incubation at 37 °C for 30 min, centrifuge at 12,000 rpm for 10 min in a 5 mL EP tube, wash twice with PBS, and then resuspend to 1 mL; Label PDA with Rho-B, and add 4 mg of Rho-B dissolved in 0.5 mL of ethanol dropwise to 10 mL of Tris buffer (10 mM, pH = 8.5) containing 2 mg of DA. After 24 h, centrifuge at 12,000 rpm for 10 min, wash twice, and then resuspend to 2 mL. Mix the DiO-labeled angiopep-2 biofilm and Rho-B-labeled PDA at a mass ratio of 16:1, and then pass through a 0.8 μm filter (10 times) and a 0.4 μm filter (10 times). Take 50 μL and put it into a 1.5 mL EP tube, add 10 μL of anti-fluorescence quencher, for a total system of 60 μL. In this system, take 10 μL and drop it on a glass slide, cover it with a coverslip, and seal it with a mounting medium for confocal microscopy to take pictures of the co-localization situation.

[0084] Result analysis: The results are as Figure 14 shown. There is a certain overlap between the DiO-labeled angiopep-2 biofilm and the Rho-B-labeled PDA, and angiopep-2 biofilm @ PDA-PEI-CpG is a spherical structure, proving that the co-localization of angiopep-2 biofilm and PDA-PEI-CpG can be achieved, that is, the preparation is successful.

[0085] IV. In vitro anti-tumor treatment of the neutrophil-targeted biofilm drug-loaded nanoparticles prepared by the present invention

[0086] 1) Determination of CpG release after PDA-PEI-CpG encounters ROS

[0087] The specific operation is as follows: Take 600 μL of PDA-PEI-CpG and disperse it in a solution system of PH5.3 + H2O2 (5 mM). Monitor the release of CpG at time intervals of 0, 2, 4, 6, 8, 12, and 24. At each sampling time, centrifuge the NP suspension at 12,000 rpm under a 30 KD ultrafiltration tube for 10 min. The release amount is calculated based on the increase in the ultraviolet absorbance (A266) in the supernatant.

[0088] The results are as Figure 15 shown. As time extends, the release rate of CpG gradually increases, and at 24 h, the release rate reaches 83%.

[0089] 2) Degradation of PDA-PEI-CpG upon encountering ROS

[0090] The specific operation is as follows: Take 600 μL of PDA-PEI-CpG, and then disperse it in a solution system of PH5.3 + H2O2 (5 mM). Samples are taken at 12 and 24 h respectively for TEM imaging and UV degradation detection.

[0091] The results are as Figure 16 、 17 shown. PDA-PEI-CpG degrades more severely at 24 h than at 12 h.

[0092] 3) Investigation of the uptake of angiopep-2 biofilm @ PDA-PEI-CpG by neutrophils

[0093] The specific operation is as follows: Extract rat neutrophils, plate them on coverslips in 24-well plates (5×10 5 cells / well), plate two wells, set two groups, the FMLP induction group + angiopep-2 biofilm @ PDA-PEI-CpG, the Control group + angiopep-2 biofilm @ PDA-PEI-CpG. After 30 minutes, induce FMLP for 10 min, add angiopep-2 biofilm @ PDA-PEI-CpG (at a concentration of 100 μg / mL of PDA), fix after 3 h, stain with DAPI, and take confocal images to observe the uptake.

[0094] Result analysis: The results are as Figure 18 shown. FMLP can induce the phagocytic ability of rat neutrophils, increasing it. Compared with the Control group, the FMLP induction group shows significantly increased uptake of angiopep-2 biofilm @ PDA-PEI-CpG by neutrophils, proving that angiopep-2 biofilm @ PDA-PEI-CpG can be taken up by neutrophils.

[0095] 4) Determination of the cytotoxicity of PEI-CpG against GL261 cells

[0096] Culture GL261 cells (8×10 3 cells per well, in 96-well plates) in 200 μL of medium for 24 hours. Among them, the drug concentrations of PEI-CpG are 5, 10, 20, 25, 50, 75, 100 μg / mL -1 , and incubate the cells for 24 hours respectively. Test the cell viability using CCK-8, and the results are shown in the figure.

[0097] Analysis shows that Figure 19 as the drug concentration increases, the cell survival rate gradually decreases. When the drug concentration is 50 μg / mL -1When there is an IC 50 value, it inhibits the proliferation of tumor cells.

[0098] Compared with the prior art, the present invention has the following advantages:

[0099] 1) In the neutrophil-targeted bacterial membrane drug-loaded nanoparticles of the present invention, the bacterial membrane has a rich source, is convenient to obtain, and has a low cost; it can be effectively recognized and phagocytosed by neutrophils only through the bacterial membrane, achieving neutrophil targeting, and the prepared drug-loaded nanoparticles can inhibit tumor growth;

[0100] 2) As an anti-glioblastoma targeted drug, the neutrophil-targeted bacterial membrane drug-loaded nanoparticles provided by the present invention do not require methods such as light irradiation and ultrasound to trigger drug release, and also avoid premature drug leakage before reaching the tumor site, enabling more drug to be transported to the tumor site. Then, under the action of PDA, ROS is cleared, the death mode of neutrophils is changed from NETosis to apoptosis, and the released apoptotic bodies wrap PEI-CPG, finally releasing the drug-loaded nanoparticles, thus maximizing the anti-tumor activity;

[0101] 3) As an anti-glioblastoma targeted drug, the neutrophil-targeted bacterial membrane drug-loaded nanoparticles provided by the present invention solve the problems that currently in clinical practice, glioblastoma is mainly treated by surgery, radiotherapy and chemotherapy, with relatively high risks, and drugs cannot penetrate the blood-brain barrier when using drugs for treatment. The entire system has the advantages of low toxicity, good water solubility, strong stability, good biocompatibility, and no obvious toxic and side effects; for the drug coated with PDA, PDA can clear ROS, change the death mode of neutrophils from NETosis to apoptosis, and the released apoptotic bodies wrap PEI-CPG, finally realizing precise drug release, having significant anti-tumor activity, and having the value of popularization and application.

[0102] The present invention provides a preparation method of neutrophil-targeted bacterial membrane drug-loaded nanoparticles and its application in anti-glioblastoma to solve the problem that drugs are difficult to cross the blood-brain barrier. It utilizes the fact that neutrophils carrying bacterial membrane drug-loaded nanoparticles can actively chemotax to the inflammatory tumor site. After being stimulated by inflammatory molecules, neutrophils are activated. The activated neutrophils release NETs extracellularly. PDA clears ROS, changes the death mode of neutrophils from NETosis to apoptosis, and the released apoptotic bodies wrap the drug, finally releasing the drug-loaded nanoparticles to treat tumor cells. The neutrophil-targeted bacterial membrane drug-loaded nanoparticles provided by the present invention are a major innovation in the drug treatment of glioblastoma.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the present technical solution, and they should all be covered by the protection scope of the present invention.

Claims

1. A preparation method of a neutrophil-targeted drug-loaded nanofiber, characterized in that, It includes the following steps: 1) Preparation of recombinant strain: Obtain the inaX-N gene sequence on NCBI, and insert the inaX-N and angiopep-2 gene sequences between Ⅰ and Ⅰ of the pET-30a(+) vector to construct the pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, which is then transformed into BL21(DE3) competent cells to obtain the recombinant strain; Nde Ⅰ and Xho Ⅰ to construct the pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, which is then transformed into E. coil BL21(DE3) competent cells to obtain the recombinant strain; 2) Preparation of angiopep-2 biofilm: Spread the recombinant strain obtained in step 1) on an LB solid agar medium containing kanamycin sulfate, culture overnight at 37 °C, pick a single colony into an LB broth medium containing kanamycin sulfate, and culture with shaking in a constant temperature shaker at 37 °C for 2 h - 4 h. Keep at 37 °C and induce with isopropyl- β -β-D-thiogalactoside for 6 h - 8 h to obtain an inaX-N-angiopep-2 culture. Collect the bacterial liquid, centrifuge the bacterial liquid, wash with PBS, add the prepared lysozyme, incubate in a water bath at 37 °C for 20 - 40 min, take out the bacterial liquid, disperse it in a 100 KD ultrafiltration tube with PBS, centrifuge, wash with PBS to remove the unbroken Escherichia coli and bacterial contents, and resuspend the obtained Escherichia coli biofilm in PBS to obtain the angiopep-2 biofilm; 3) Preparation of PDA-PEI-CpG: Incubate PEI10KD and CpG in a water bath at 25 °C, remove water by ultrafiltration centrifugation, add Tris-HCl and dopamine hydrochloride powder, and stir at room temperature to obtain PDA-PEI-CpG; 4) Preparation of neutrophil-targeted drug-loaded nanovesicles: Extract the angiopep-2 nanovesicles prepared in step 2) without lysis, perform BCA protein quantification, and coat the angiopep-2 nanovesicles and the PDA-PEI-CpG obtained in step 3) at a mass ratio of 6:1 to 16:

1. First, ultrasonicate for 5 - 10 min, then centrifuge with an ultrafiltration tube, wash, to obtain neutrophil-targeted drug-loaded nanovesicles angiopep-2 nanovesicles@PDA-PEI-CpG.

2. The preparation method of the neutrophil-targeted drug-loaded nanovesicles with bacterial membranes according to claim 1, wherein, The Escherichia coli in step 2) is BL21(DE3) Escherichia coli, the concentration of lysozyme is 1 mg / ml, and the molecular weight cut-off of the ultrafiltration tube is 100 KD.

3. The preparation method of the neutrophil-targeted drug-loaded bacterial membrane nanoparticles according to claim 1, wherein, In step 3), the concentration of PEI10KD is 2 mg / ml, CpG is type B CpG, the sequence is TCCATGACGTTCCTGACGTT, the concentration is 0.5 mg / ml, the N / P ratio is 6, Tris-HCl is 10 mM, and the pH is 8.

5.

4. The preparation method of the neutrophil-targeted drug-loaded nanovesicles with biofilm according to claim 1, characterized in that, In step 4), the molecular weight cut-off of the ultrafiltration tube is 100 KD.

5. The preparation method of the neutrophil-targeted biofilm-loaded drug nanoparticles according to claim 1, wherein, The particle size of the neutrophil-targeted drug-loaded nanovesicles is 190 - 250 nm.

6. The preparation method of the neutrophil-targeted biofilm-loaded drug nanoparticles according to claim 1, characterized in that, Specifically, it includes the following steps: 1) Preparation of recombinant strain: Obtain the inaX-N gene sequence on NCBI, and insert the inaX-N and angiopep-2 gene sequences between Ⅰ and Ⅰ of the pET-30a(+) vector to construct the pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, which is then transformed into BL21(DE3) competent cells to obtain the recombinant strain; Nde Ⅰ and Xho Ⅰ to construct the pET-30a(+)-inaX-N-angiopep-2 recombinant plasmid expression vector, which is then transformed into E. coil BL21(DE3) competent cells to obtain the recombinant strain; 2) Preparation of angiopep-2 nanovesicles: Spread the recombinant strain obtained in step 1) on an LB solid agar medium containing kanamycin sulfate, culture overnight at 37 °C, pick a single colony into an LB broth medium containing kanamycin sulfate, shake culture in a constant temperature shaker at 37 °C for 2 h, maintain at 37 °C, induce with isopropyl-β-D-thiogalactoside for 6 h to obtain an inaX-N-angiopep-2 culture, collect the bacterial liquid, take 40 mL of the inaX-N-angiopep-2 bacterial liquid, centrifuge at 4 °C and 10000 rpm for 10 min, and wash once with PBS; Add 4 mL of lysozyme with a prepared concentration of 1 mg / mL to each, incubate in a water bath at 37 °C for 20 min; take out the bacterial liquid, add 15 mL of PBS and disperse it in a 100 KD ultrafiltration tube, centrifuge at 4 °C and 5000 rpm for 10 min, and wash twice with PBS to remove unbroken Escherichia coli and bacterial contents. Resuspend each of the obtained Escherichia coli biofilms in 1.5 mL of PBS to obtain angiopep-2 nanovesicles; 2) Preparation of PDA-PEI-CpG: Incubate PEI10KD and CpG in a water bath at 25°C. Among them, the concentration of PEI is 2 mg / ml, the concentration of CpG is 0.5 mg / ml, the N / P ratio of CpG is 6. Remove water by ultrafiltration centrifugation, add 10 mM Tris-HCl with a pH of 8.5 and dopamine hydrochloride powder. The added amount of dopamine hydrochloride powder is twice the sum of the masses of PEI and CpG. Stir at room temperature to obtain PDA-PEI-CpG; 3) Preparation of neutrophil-targeted bacterial membrane drug-loaded nanoparticles: Extract the angiopep-2 bacterial membrane prepared in step 1) without lysis, perform BCA protein quantification, and coat the angiopep-2 bacterial membrane and PDA-PEI-CpG at a mass ratio of 10:

1. First, sonicate for 8 min, then centrifuge with a 100 KD ultrafiltration tube, wash, and concentrate to 100 μL to obtain neutrophil-targeted bacterial membrane drug-loaded nanoparticles angiopep-2 bacterial membrane@PDA-PEI-CpG.

7. Use of the neutrophil-targeted bacterial membrane drug-loaded nanoparticles prepared by the method according to any one of claims 1-6 in the preparation of anti-glioblastoma drugs.

Images